Cysteine proteases cleaving IgG and uses thereof

By mutating the amino acid composition of the IdeS protein to enhance its ability to degrade IgG, the problems of immunogenicity and antibody neutralization of the IdeS protein were solved, achieving low-dose and high-efficiency IgG degradation.

CN122038360APending Publication Date: 2026-05-15BEIJING GENECRADLE PHARM CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
BEIJING GENECRADLE PHARM CO LTD
Filing Date
2024-11-07
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Existing IdeS proteins require high doses due to their immunogenicity, and subjects often have anti-IdeS antibodies, which affects their efficacy.

Method used

IdeS protein variants were designed and constructed, and their ability to specifically degrade IgG and reduce immunogenicity was enhanced by introducing amino acid mutations (such as E226 or R167E) at specific positions.

Benefits of technology

It achieves the same IgG degradation effect as wild-type IdeS at lower doses or concentrations, reducing immunogenicity issues.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005124322570000201
    Figure BDA0005124322570000201
  • Figure BDA0005124322570000202
    Figure BDA0005124322570000202
  • Figure BDA0005124322570000203
    Figure BDA0005124322570000203
Patent Text Reader

Abstract

The present invention relates to IdeS protein variants having IgG cleaving cysteine protease activity and having at least 90%, at least 95%, at least 98%, at least 99% sequence identity to SEQ ID No.2 and (a) having glutamic acid (E) at a position corresponding to position 226 of SEQ ID No.1; or (b) arginine (R) at the position 167 corresponding to SEQ ID No.1 and glutamic acid (E) at the position 226 corresponding to SEQ ID No.1. The present invention also relates to a nucleic acid encoding said IdeS protein variant, a vector comprising said nucleic acid, and the use of said IdeS protein variant for the treatment or prevention of a disease or disorder associated with IgG; or as a tool enzyme for biotechnology in vitro.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology. Specifically, it relates to cysteine ​​proteases that cleave IgG and their uses. The IgG-cleaving cysteine ​​protease of this invention is a novel IdeS variant capable of clearing immunoglobulin G in vivo and for use in vitro as a biotechnology tool enzyme. Background Technology

[0002] Streptococcus pyogenes is one of the most common bacterial pathogens in humans, widely found in nature and in the oropharynx, respiratory tract, and intestines of humans and animals. Streptococcal infection can cause throat and skin infections, as well as life-threatening invasive diseases such as necrotizing fasciitis and toxic shock syndrome (Cunningham MW. Pathogenesis of group A streptococcal infections. Clin Microbiol Rev. 2000; 13(3): 470-511).

[0003] Immunoglobulin G degrading enzymes of Streptococcus pyogenes ( I mmunoglubulin G- de grading enzyme of S treptococcus pyogenes (IdeS), also known as Mac-1, is a cysteine ​​protease secreted by Streptococcus pyogenes. It can specifically recognize IgG and enzymatically cleave IgG, hydrolyzing it into complete F(ab')2 and Fc fragments, thereby inhibiting the IgG-mediated immune response and protecting Streptococcus pyogenes from phagocytosis mediated by the host through antibodies (Xu Jing et al., “Prokaryotic expression, purification and activity identification of cysteine ​​protease IdeS” [J]. China Biotechnology Journal, 2014, 34(10): 8-14).

[0004] Immunoglobulins (Ig) are a class of globulins with antibody activity or chemical structures similar to antibodies. They play a crucial role in the human immune defense system, primarily by specifically recognizing and mediating phagocytes or the complement system, or both, to clear foreign microorganisms. Besides their protective functions, IgG is also associated with disease. For example, in approximately 5% of the human body, IgG is involved in various autoimmune diseases, such as rheumatoid arthritis, systemic lupus erythematosus, myasthenia gravis, and immune (or spontaneous) thrombocytopenic purpura.

[0005] In August 2020, the European Union approved IdeS (trade name "imlifidase"), developed by Lufthansa Biopharmaceuticals, for use as a desensitizing agent in highly sensitized adult kidney transplant patients who are cross-matched with available ABO-compatible donors (Lionel Couzi et al., "Imlifidase for Kidney Transplantation of Highly Sensitized Patients With a Positive Crossmatch: The French Consensus Guidelines", Transpl Im., 2023, Vol. 36, Article 11244, https: / / doi.org / 10.3389 / ti.2023.11244). Imlifidase is a recombinant form of IdeS produced in E. coli with the ability to cleave and degrade all human IgG. Four to six hours after Imlifidase infusion, the entire IgG library is degraded into F(ab')2 and Fc fragments. In vitro, Imlifidase inhibits HLA antibody-mediated NK cell activation and antibody-dependent cell-mediated cytotoxicity. Imlifidase also degrades IgG of the B cell receptor (BCR), inhibits BCR-mediated cell signaling, and temporarily prevents memory B cells from responding to antigen stimulation and transforming into antibody-producing cells.

[0006] In addition, studies have shown that IdeS reduces the level of anti-AAV antibodies in human plasma samples in vitro, providing a solution to overcome the pre-existing anti-AAV antibodies in vivo during AAV gene therapy (Christian Leborgne et al., “IgG-cleaving endopeptidase enables in vivo gene therapy in the presence of anti-AAV neutralizing antibodies”, Nat Med. 2020; 26(7): 1096-1101).

[0007] Since wild-type IdeS from Streptococcus pyogenes is an immunogenic protein, IdeS-specific antibodies are also widely distributed in healthy individuals (Per...). (E.g., "Low Antibody Levels against Cell Wall-Attached Proteins of Streptococcus pyogenes Predispose for Severe Invasive Disease," The Journal of Infectious Diseases, Vol. 189, No. 5, March 1, 2004, pp. 797-804). To indirectly reduce immunogenicity by achieving the same effect as wild-type IdeS with lower doses or concentrations, there is a need in the art to further develop IdeS variants with high cleavage activity against IgG. Summary of the Invention

[0008] This invention designs and constructs an IdeS protein variant and demonstrates that, compared with wild-type IdeS, the IdeS protein variant of this invention has a significantly enhanced specific degradation effect on IgG.

[0009] Therefore, in a first aspect, the present invention provides an IdeS protein variant that has IgG cysteine ​​protease activity and, relative to the parental IdeS protein

[0010] (a) Contains glutamic acid (E) at position 226 corresponding to SEQ ID No. 1; or

[0011] (b) It contains arginine (R) at position 167 corresponding to SEQ ID No. 1 and glutamic acid (E) at position 226.

[0012] In some embodiments, the parental IdeS protein from which the IdeS protein variants of the present invention are derived comprises or consists of the following amino acid sequence:

[0013] (a) The amino acid sequence of SEQ ID No. 2;

[0014] (b) An amino acid sequence having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with SEQ ID No. 2 and having IgG cysteine ​​protease activity; or

[0015] (c) Compared with the amino acid sequence of (a) or (b), it has one or more (e.g., 1, 2, 3, 4, 5, 7, 8, 9 or 10) amino acid residue substitutions, deletions and / or additions (preferably, conserved amino acid substitutions) and has IgG cysteine ​​protease activity.

[0016] In some embodiments, the IdeS protein variant of the present invention (a) comprises or consists of the amino acid sequence of SEQ ID No. 4; or (b) comprises or consists of the amino acid sequence of SEQ ID No. 5.

[0017] In some embodiments, the IdeS protein variant of the present invention further includes a signal peptide sequence at the N-terminus, for example, the amino acid sequence of positions 2-29 of SEQ ID No. 1.

[0018] In some embodiments, the IdeS protein variant of the present invention further includes one or more tag sequences at the N-terminus or C-terminus, for example, the tag sequence is a histidine tag sequence, a GST tag, or a HA tag sequence.

[0019] In a second aspect, the present invention provides an isolated nucleic acid comprising a multinucleotide sequence encoding a variant of the IdeS protein of the present invention, for example, comprising a nucleotide sequence of SEQ ID No. 8 or SEQ ID No. 9.

[0020] In a third aspect, the present invention provides an expression frame that includes promoter sequence elements and the nucleic acid described in the second aspect of the present invention in a 5'-3' orientation.

[0021] In a fourth aspect, the present invention provides a nucleic acid vector, for example, a nucleic acid expression vector, which comprises the nucleic acid described in the second aspect of the present invention or the expression frame described in the third aspect of the present invention.

[0022] In a fifth aspect, the present invention provides a host cell comprising the nucleic acid described in the second aspect of the present invention, the expression cassette described in the third aspect of the present invention, or the nucleic acid vector described in the fourth aspect of the present invention, preferably the host cell being a bacterial cell, such as an Escherichia coli cell.

[0023] In a sixth aspect, the present invention provides a pharmaceutical composition comprising the IdeS protein variant described in the first aspect of the present invention, the nucleic acid described in the second aspect of the present invention or the nucleic acid carrier described in the fourth aspect of the present invention, and a pharmaceutically acceptable excipient.

[0024] In a seventh aspect, the present invention provides the use of the IdeS protein variant according to the first aspect of the invention, the nucleic acid according to the second aspect of the invention, or the nucleic acid vector according to the fourth aspect of the invention for the preparation of a medicament for the treatment or prevention of diseases or disorders related to IgG, preferably, the medicament is administered by intravenous injection.

[0025] In some implementations, the IgG-related disease or disorder is selected from: disorders caused by neutralizing antibodies against AAV that affect gene therapy, diseases mediated by pathogenic IgG antibodies (e.g., autoimmune diseases), and IgG antibody-mediated transplant rejection.

[0026] In an eighth aspect, the present invention provides a method for detecting or analyzing the presence of IgG in a sample, a method for in vitro cleavage of IgG, or a method for removing IgG from a sample, said method comprising contacting a sample containing IgG with an IdeS protein variant according to a first aspect of the present invention. Attached Figure Description

[0027] Figure 1 The diagram shows the IdeS-IgG interaction obtained from molecular docking analysis of IdeS and IgG. "MG50" in the diagram indicates the research project number.

[0028] Figure 2 The results of structural analysis of the K167R+D226E double mutant protein of wild-type IdeS using X-ray crystallography are shown.

[0029] Figure 3 The results show the in vitro detection of IgG cleavage by IdeS_WT protein (shown as "WT" in the figure), IdeS_D226E protein (shown as "D226E" in the figure), or IdeS_M33 protein (shown as "M33" in the figure) containing a 6×His tag. Figure 3 The inset on the left shows the SDS-PAGE results of each IdeS protein reacting with IgG for 0 min, 10 min, 25 min, 40 min, and 60 min. Figure 3 The small right figure shows the ratio of the gray values ​​of the F(ab′)2 fragments obtained by cutting IdeS_D226E for 60 minutes and the F(ab′)2 fragments obtained by cutting IdeS_M33 for 60 minutes to the gray values ​​of the F(ab′)2 fragments obtained by cutting IdeS_WT for 60 minutes.

[0030] Figure 4This paper illustrates the affinity purification of the GST-tagged IdeS_M33 protein using an affinity chromatography column containing reduced glutathione (GSH). The effect of conductivity on the elution efficiency of IdeS_M33 protein during elution is shown. In the figure, the leftmost lane represents the molecular weight marker (kDa). During the 35-50 ml sampling process, the salt ion concentration gradually increases, which means the conductivity gradually increases. The Acta chromatogram used for purification can detect conductivity, showing that the IdeS_M33 protein band is thickest when the conductivity is between 5 and 10 mS / cm in the SDS-PAGE electrophoresis image.

[0031] Figure 5 This diagram illustrates how IdeS cleaves IgG through a two-stage mechanism.

[0032] Figure 6 The results of in vitro detection of IgG cleavage by IdeS_WT protein (shown as "WT" in the figure) and IdeS_M33 protein (shown as "M33" in the figure) obtained in Example 3 are shown. Figure 6 The inset on the left shows the SDS-PAGE results of IdeS protein cleaving IgG at the reaction times (minutes) indicated above each lane; Figure 6 The small right plot shows the ratio of the grayscale value of the F(ab′)2 fragment obtained by IdeS_M33 cutting IgG to the grayscale value of the F(ab′)2 fragment obtained by IdeS_WT cutting IgG at the reaction time (minutes) indicated on each horizontal axis. In the figure, "scIgG" represents a single-cut IgG.

[0033] Figure 7 The SDS-PAGE results of IdeS_WT protein (shown as "WT" in the figure) and IdeS_M33 protein (shown as "M33" in the figure) obtained in Example 3 on IgG cleavage in rabbit serum at 0 min, 5 min, 15 min, 30 min, 60 min, 120 min and 240 min are shown. Detailed Implementation

[0034] Unless otherwise defined below, all technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference in their entirety. Furthermore, the materials, methods, and examples described herein are illustrative only and are not intended to be limiting. Other features, objects, and advantages of the invention will become apparent from this specification and the accompanying drawings, and from the appended claims.

[0035] I. Definition

[0036] In this document, the term "about" when used in conjunction with a numeric value means to cover a range of numeric values ​​having a lower limit of 5% less than the specified numeric value and an upper limit of 5% greater than the specified numeric value. The term is also intended to cover values ​​within ±1%, ±0.5%, or ±0.1% of the specified numeric value.

[0037] In this document, the expression “and / or” is used to refer to any and all possible combinations of any one of the listed related items, or multiple of the listed related items.

[0038] In this document, the terms "comprising" or "including" mean including the stated elements, integers, or steps, or groups of elements, integers, or steps, but do not exclude any other elements, integers, or steps, or other groups of elements, integers, or steps. When the terms "comprising" or "including" are used herein, unless otherwise specified, they also cover situations consisting of the stated elements, integers, or steps. For example, when referring to a polypeptide / protein that "comprising" a specific sequence, it is also intended to cover polypeptides / proteins consisting of that specific sequence.

[0039] The term "immunoglobulin" refers to a protein with a structure that contains naturally occurring antibodies. For example, IgG immunoglobulins are heterotetrameric glycoproteins of approximately 150,000 Daltons, composed of two light chains and two heavy chains linked by disulfide bonds. Each heavy chain has a variable region (VH), also called a variable heavy chain domain or heavy chain variable structure domain, from the N-terminus to the C-terminus, followed by three constant domains (CH1, CH2, and CH3), also called heavy chain constant regions. Similarly, each light chain has a variable region (VL), also called a variable light chain domain or light chain variable structure domain, from the N-terminus to the C-terminus, followed by a constant light chain (CL) domain, also called a light chain constant region. The heavy chains of immunoglobulins can be classified into one of five types, called α (IgA), δ (IgD), ε (IgE), γ (IgG), or μ (IgM), some of which can be further subdivided into subtypes, such as γ1 (IgG1), γ2 (IgG2), γ3 (IgG3), γ4 (IgG4), α1 (IgA1), and α2 (IgA2). The light chains of immunoglobulins can be classified into one of two types based on the amino acid sequence of their constant domains, called K and λ. Immunoglobulins are essentially composed of two Fab molecules linked by an immunoglobulin hinge region and an Fc domain. The Fab molecule is a monovalent fragment composed of VL, VH, CL, and CH1 domains.

[0040] The "hinge region" is typically defined as region 216-238 (EU code) or 226-251 (Kabat code) of human IgG1. The native hinge region is the hinge region that is normally connected to the CH1 domain of the immunoglobulin molecule.

[0041] The term "F(ab')2 fragment" refers to a fragment in which two Fab molecules of an immunoglobulin are linked together by two disulfide bonds in a core hinge. IdeS eliminates the C-terminal heterogeneity observed during pepsin digestion, yielding a highly homogeneous F(ab')2 fragment. The Fab' fragment is a monovalent fragment consisting of VL, VH, CL, CH1 domains and a hinge region.

[0042] The term "Fc fragment" is used herein to define the C-terminal region of an immunoglobulin heavy chain containing at least a portion of its constant domain. While the boundaries of the Fc region in the IgG heavy chain may vary slightly, the human IgG heavy chain Fc fragment is generally defined as extending from Cys226 or Pro230 to the C-terminus of the heavy chain. However, the C-terminal lysine residue (Lys447) of the Fc fragment may or may not be present. The IgG Fc fragment contains the IgG CH2 and IgG CH3 constant domains.

[0043] "Wild-type IdeS" is an immunoglobulin G degrading enzyme produced by Streptococcus pyogenes, and its full-length amino acid sequence is shown in NCBI reference sequence number WP_010922160.1, provided herein as SEQ ID No. 1 (339aa). This sequence contains an N-terminal methionine and the subsequent 28 amino acids, which form a secretion signal sequence. In mature IdeS protein, the N-terminal methionine and the subsequent 28 amino acids are typically removed, resulting in the sequence shown herein as SEQ ID No. 2.

[0044] The term "conserved amino acid substitution" refers to a substitution in which an amino acid residue is replaced by an amino acid residue having a similar side chain. Groups of amino acid residues with similar side chains have been defined in the art. These groups include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chain amino acids (e.g., aspartic acid, glutamic acid), non-polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chain amino acids (e.g., threonine, valine, isoleucine), and aromatic side chain amino acids (e.g., tyrosine, phenylalanine, tryptophan, histidine). Therefore, the non-essential amino acids desired in the proteins of the present invention are preferably replaced with another amino acid residue from the same side chain group.

[0045] As used herein, the term "isolated" means a substance that has been artificially removed and exists separately from its original environment and is therefore not a natural product. Isolated substances or molecules (such as DNA molecules or proteins) may exist in purified form or may exist in unnatural environments such as transgenic host cells. For example, naturally occurring nucleic acid molecules or polypeptides present in living cells are not isolated, but the same nucleic acid molecules or polypeptides isolated from some or all of the coexisting substances in a natural system are isolated. Such nucleic acid molecules may be part of a carrier and / or such nucleic acid molecules or polypeptides may be part of a composition and are isolated because such carriers or compositions are not part of their original environment. Preferably, when used with respect to nucleic acid molecules, the term "isolated," as in "isolated nucleic acid sequence," refers to a nucleic acid sequence that has been identified and separated from at least one contaminating nucleic acid molecule.

[0046] The term "recombinant" in relation to nucleic acid molecules refers to nucleic acid molecules produced through recombinant DNA technology. This term also includes nucleic acid molecules that do not exist in nature but have been modified, altered, mutated, or otherwise manipulated by humans. Preferably, a "recombinant nucleic acid molecule" is a non-naturally occurring nucleic acid molecule that has at least one nucleotide different from naturally occurring nucleic acid molecules. A "recombinant nucleic acid molecule" may also comprise a "recombinant construct" which contains, preferably effectively linked, sequences of non-naturally occurring nucleic acid molecules. Preferred methods for producing said recombinant nucleic acid molecules may include cloning techniques, directed or non-directed mutagenesis, synthesis, or recombination techniques.

[0047] The following is a calculation of sequence identity between sequences.

[0048] To determine the percentage of identity between two amino acid sequences or two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., vacancies may be introduced in one or both of the first and second amino acid sequences or nucleic acid sequences for optimal alignment, or non-homologous sequences may be discarded for comparison purposes). In a preferred embodiment, for comparison purposes, the length of the reference sequence being aligned is at least 30%, preferably at least 40%, more preferably at least 50%, 60%, and even more preferably at least 70%, 80%, 90%, 100% of the reference sequence length. The amino acid residues or nucleotides at corresponding amino acid or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide at the corresponding position in the second sequence, the molecules are identical at that position.

[0049] Mathematical algorithms can be used to compare sequences and calculate the percentage of identity between two sequences. In a preferred embodiment, the Needlema and Wunsch ((1970) J. Mol. Biol. 48: 444-453) algorithm (available at http: / / www.gcg.com) is used in the GAP program integrated into the GCG software package, employing a Blossum 62 matrix or a PAM250 matrix and vacancy weights of 16, 14, 12, 10, 8, 6, or 4, and length weights of 1, 2, 3, 4, 5, or 6, to determine the percentage of identity between two amino acid sequences. In yet another preferred embodiment, the GAP program in the GCG software package (available at http: / / www.gcg.com) is used, employing an NWSgapdna.CMP matrix and vacancy weights of 40, 50, 60, 70, or 80, and length weights of 1, 2, 3, 4, 5, or 6, to determine the percentage of identity between two nucleotide sequences. The particularly preferred set of parameters (and unless otherwise specified, a set of parameters to be used) is a Blossum 62 scoring matrix with a vacancy penalty of 12, a vacancy extension penalty of 4, and a shift vacancy penalty of 5.

[0050] Alternatively, the PAM120 weighted remainder table, gap length penalty 12, gap penalty 4) can be used to determine the percentage of identity between two amino acid sequences or nucleotide sequences using the E. Meyers and W. Miller algorithm ((1989) CABIOS, 4:11-17) which has been incorporated into the ALIGN program (version 2.0).

[0051] Additionally or alternatively, the nucleic acid and protein sequences described herein may be further used as “query sequences” to perform searches against public databases, for example, to identify other family member sequences or related sequences.

[0052] The term "treatment" refers to a clinical intervention intended to alter the natural course of a disease in an individual undergoing treatment. Desired therapeutic effects include, but are not limited to, preventing the onset or recurrence of the disease, alleviating symptoms, reducing any direct or indirect pathological consequences of the disease, slowing the rate of disease progression, improving or mitigating the disease state, and alleviating or improving prognosis.

[0053] When used herein, "prevention" includes the suppression of the occurrence or development of a disease or symptoms of a specific disease. In some implementations, subjects with a predisposition to IgG-related diseases or disorders are candidates for preventative protocols.

[0054] II. IdeS protein variants

[0055] IdeS, the immunoglobulin G degrading enzyme of Streptococcus pyogenes, is an extracellular cysteine ​​protease produced by the human pathogen Streptococcus pyogenes. It exhibits high substrate specificity, recognizing only IgG. The "Y"-shaped IgG molecule is a large tetramer (approximately 150 kDa) composed of two similar heavy chains and two similar light chains. Each light chain is linked to the heavy chain by a disulfide bond, while the two heavy chains are linked by at least two disulfide bonds in the hinge region. The cleavage site for IdeS action is located on the IgG heavy chain, between Gly-236 and Gly-237 in the hinge region, preceding the CH2 domain.

[0056] IdeS catalyzes the cleavage of the heavy chain of all subclasses of human IgG and some subclasses of IgG in various animals. IdeS cleaves IgG into Fc fragments and F(ab′)2 fragments through a two-stage mechanism. Figure 5 In the first stage, IdeS cleaves one IgG heavy chain to produce a single-cleaved IgG (scIgG) molecule with a non-covalently bound Fc molecule; in the second stage, IdeS cleaves the other IgG heavy chain to release the F(ab')2 fragment and the homodimeric Fc fragment. These fragments are products normally observed under physiological conditions. Under reducing conditions, the F(ab')2 fragment can dissociate into two Fab' fragments, and the homodimeric Fc can dissociate into monomeric Fc.

[0057] Some common infections, such as tonsillitis and streptococcal pharyngitis, are caused by Streptococcus pyogenes. IdeS, secreted by Streptococcus pyogenes, specifically recognizes human IgG and enzymatically cleaves it into intact F(ab')2 and Fc fragments. Therefore, it can inhibit the IgG-mediated immune response, allowing Streptococcus pyogenes to evade host phagocytosis via IgG. On the other hand, IdeS secreted by Streptococcus pyogenes is an immunogenic protein. Therefore, most human subjects likely have anti-IdeS antibodies in their bloodstream.

[0058] Even if a subject does not have anti-IdeS antibodies before the initial administration of IdeS, these antibodies may still be generated after administration. As neutralizing antibodies, anti-IdeS antibodies may reduce the potency of IdeS, leading to the need for higher or repeated doses to achieve the desired effect.

[0059] The inventors obtained multiple IdeS protein variants by modifying the amino acid sequence of wild-type IdeS. Compared with wild-type IdeS, some modifications can increase the IgG cleavage efficacy of the IdeS protein variants of the present invention, thereby allowing the use of lower doses or concentrations of IdeS protein variants to achieve the same effect as wild-type IdeS, thereby reducing the immunogenicity problems caused by wild-type IdeS.

[0060] In some embodiments, the present invention provides an IdeS protein variant having IgG cysteine ​​protease activity and an amino acid sequence that is at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID No. 2.

[0061] (a) Contains glutamic acid (E) at position 226 corresponding to SEQ ID No. 1; or

[0062] (b) It contains arginine (R) at position 167 corresponding to SEQ ID No. 1 and glutamic acid (E) at position 226.

[0063] The IdeS protein variant of the present invention is capable of cleaving IgG and is more effective than wild-type IdeS in cleaving IgG, thereby enabling administration to human subjects at lower doses or concentrations of the IdeS protein variant and reducing immunogenicity problems caused by wild-type IdeS.

[0064] In some embodiments, the amino acid sequence that is at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID No. 2 is a sequence obtained by deleting any one of the last 1 to the last 4 residues from the C-terminus of SEQ ID No. 2.

[0065] In some embodiments, the amino acid sequence that is at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID No. 2 is a sequence obtained by deleting any one of the first to 20th residues from the N-terminus of SEQ ID No. 2.

[0066] In some embodiments, the amino acid sequence that is at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID No. 2 is a sequence obtained by deleting any one of the last 1 to the last 4 residues of the C-terminus of SEQ ID No. 2; and a sequence obtained by deleting any one of the first to the 20th residues of the N-terminus of SEQ ID No. 2.

[0067] In some embodiments, the present invention provides an IdeS protein variant, wherein the IdeS protein variant comprises or is composed of the amino acid sequence of SEQ ID No. 4.

[0068] In some embodiments, the present invention provides an IdeS protein variant, wherein the IdeS protein variant comprises or is composed of the amino acid sequence of SEQ ID No. 5.

[0069] In some embodiments, the present invention provides an IdeS protein variant wherein the IdeS protein variant contains a signal peptide sequence at its N-terminus, for example, the amino acid sequence of SEQ ID No. 1 from position 2 to 29.

[0070] In some embodiments, the present invention provides an IdeS protein variant, wherein the IdeS protein variant further includes one or more tag sequences at the N-terminus or C-terminus, for example, the tag sequences are histidine tag sequences, GST tags, or HA tag sequences.

[0071] In some embodiments, the present invention provides an IdeS protein variant having IgG cysteine ​​protease activity and an amino acid sequence that is at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID No. 2.

[0072] (a) Contains glutamic acid (E) at position 226 corresponding to SEQ ID No. 1; or

[0073] (b) Contains arginine (R) at position 167 corresponding to SEQ ID No. 1 and glutamic acid (E) at position 226; and

[0074] The amino acid sequence of SEQ ID No. 4 or SEQ ID No. 5 is modified, for example, by adding, deleting, or substituting amino acids. The substitution is preferably a conserved amino acid substitution. The deletion is preferably a deletion corresponding to any one of the last 1 to the last 4 residues at the C-terminus of SEQ ID No. 2; and / or a deletion corresponding to any one of the 1st to the 20th residues at the N-terminus of SEQ ID No. 2.

[0075] III. Production of IdeS protein variants

[0076] The IdeS protein variant of the present invention can be synthesized using chemical synthesis methods such as the Fmoc method (fluorenylmethyloxycarbonyl method) and the tBoc method (tert-butyloxycarbonyl method). Alternatively, it can be synthesized using conventional methods with various commercially available peptide synthesizers.

[0077] The IdeS protein variant of the present invention can also be prepared using known genetic engineering methods (Sambrook et al., Molecular Cloning, 2nd edition, Current Protocols in Molecular Biology (1989), ColdSpring Harbor Laboratory Press; Ausubel et al., Short Protocols in Molecular Biology, 3rd edition, A compendium of Methods from Current Protocols in Molecular Biology (1995), John Wiley & Sons et al.), to prepare a polynucleotide encoding the IdeS protein variant of the present invention, integrate the polynucleotide into an expression vector and introduce it into a host cell, and produce a polypeptide in the host cell, thereby obtaining the IdeS protein variant of the present invention.

[0078] The polynucleotide encoding the IdeS protein variant of the present invention can be readily prepared by known genetic engineering methods and / or by conventional methods using commercially available nucleic acid synthesizers.

[0079] The host cell for the expression vector can be any cell capable of expressing the IdeS protein variant of the present invention. Examples of prokaryotic cells include Escherichia coli, and examples of eukaryotic cells include mammalian cells such as monkey kidney cells (COS1), Chinese hamster ovary cells (CHO), human embryonic kidney cell line HEK293, mouse embryonic skin cell line NIH3T3, yeast cells such as budding yeast and fission yeast, silkworm cells, Xenopus oocytes, etc., but are not limited to these cells.

[0080] When prokaryotic cells are used as host cells, expression vectors are used that possess a replication origin, promoter, ribosome binding site, multiple cloning site, terminator, antibiotic resistance gene, auxotrophic complement gene, etc., enabling replication in prokaryotic cells. Examples of expression vectors for *E. coli* include the pUC line, pBluescriptII, pET expression system, and pGEX expression system. If DNA encoding a variant of the IdeS protein of this invention is integrated into such an expression vector, and prokaryotic host cells are transformed with this vector, the resulting transformants can express the DNA-encoded polypeptide in the prokaryotic host cells.

[0081] When using eukaryotic cells as host cells, eukaryotic cell expression vectors having promoters, splice regions, poly(A) addition sites, etc., are used as expression vectors. Examples of such expression vectors include pssAAV-CMV-EGFP, pBK-CMV, pcDNA3, and pYES2. DNA encoding the IdeS protein variant of the present invention is integrated into such an expression vector, and after transformation of eukaryotic host cells with this vector, the resulting transformants can express the polypeptide encoded by the DNA in the eukaryotic host cells.

[0082] The IdeS protein variant of the present invention can be expressed as a fusion protein with multiple tags such as His tag, GST tag, FLAG tag, myc tag, HA tag, and GFP.

[0083] The introduction of expression vectors into host cells can be achieved using well-known methods such as electroporation, calcium phosphate method, liposome method, DEAE dextran method, microinjection, viral infection, liposome transfection, and binding to cell membrane permeable peptides.

[0084] To isolate and purify a target peptide from host cells, known separation techniques can be combined. Examples include, but are not limited to, treatment with denaturing agents such as urea and / or surfactants, sonication, enzymatic digestion, salting out and / or solvent precipitation, dialysis, centrifugation, ultrafiltration, gel filtration, SDS-PAGE, isoelectric point electrophoresis, ion exchange chromatography, hydrophobic chromatography, affinity chromatography, and reversed-phase chromatography.

[0085] IV. Compositions and formulations containing IdeS protein variants

[0086] In some embodiments, the present invention provides a composition comprising the IdeS protein variant of the present invention, its encoding nucleic acid, a vector comprising the encoded nucleic acid, and a pharmaceutically acceptable excipient.

[0087] When the IdeS protein variant of the present invention is used as a pharmaceutical composition, it can be formulated using methods known to those skilled in the art. For example, it can be used non-orally as an injectable form of a sterile solution or suspension of water or a pharmaceutically permissible liquid other than water. For example, it is considered that it can be formulated by mixing with a suitable combination of a pharmacologically permissible carrier or medium, specifically sterile water and / or physiological saline, vegetable oil, emulsifier, suspending agent, surfactant, stabilizer, flavoring agent, excipient, solvent, preservative, binder, etc., in a unit dosage manner as generally considered necessary for pharmaceutical implementation.

[0088] Sterile compositions for injection can be prepared using solvents such as distilled water for injection, following standard pharmaceutical preparation practices.

[0089] Examples of aqueous solutions for injection include physiological saline, isotonic solutions containing glucose and / or other adjuvants such as D-sorbitol, D-mannose, D-mannitol, and sodium chloride, and solutions that can be used in combination with appropriate solubilizing agents such as alcohols, specifically ethanol, polyols such as propylene glycol, polyethylene glycol, and nonionic surfactants such as polysorbate 80(TM) and HCO-60.

[0090] Examples of oily solutions include sesame oil and soybean oil, which can also be used in combination with benzyl benzoate and benzyl alcohol as dissolving agents. Additionally, they can be combined with buffers such as phosphate buffer and sodium acetate buffer, analgesics such as procaine hydrochloride, stabilizers such as benzyl alcohol and phenol, and antioxidants. The prepared injection solution is typically filled into appropriate ampoules.

[0091] The administration can be oral or non-oral, preferably non-oral. Specifically, examples include injectable formulations, nasal formulations, pulmonary formulations, and transdermal formulations. Examples of injectable formulations include systemic or local administration via intravenous injection, intramuscular injection, intraperitoneal injection, or subcutaneous injection. Preferably, the composition of the present invention is administered via intravenous infusion.

[0092] Furthermore, an appropriate method of administration can be selected based on the patient's age, weight, sex, symptoms, etc. The dosage of the pharmaceutical composition containing the IdeS protein variant of the present invention can be selected, for example, from 0.01 mg to 2.0 mg of the IdeS protein variant per kg of body weight in a single administration, but is not necessarily limited to these values. The dosage and method of administration vary depending on the patient's weight, age, sex, symptoms, etc., and can be appropriately selected by those skilled in the art. For example, the amount of the IdeS protein variant of the present invention administered can be between about 0.10 and 1 mg / kg of body weight, preferably between 0.25 mg / kg and 0.5 mg / kg of body weight.

[0093] In vivo applications of V. IdeS protein variants

[0094] Administering the IdeS protein variant of the present invention to a subject can treat or prevent diseases or disorders associated with IgG.

[0095] In some implementations, IgG-related diseases or disorders are disorders caused by neutralizing antibodies against AAV that affect gene therapy.

[0096] Gene therapy can treat a variety of human diseases by systemic administration of AAV vectors. However, neutralizing antibodies against the adeno-associated virus (AAV) capsid are ubiquitous in humans and prevent hepatic transduction of AAV vectors and re-administration of AAV vectors. Therefore, neutralizing antibodies against AAV have become a limitation of in vivo gene therapy. To overcome the adverse effects of anti-AAV antibodies on gene therapy, it is necessary to remove the pre-existing anti-AAV antibodies before gene therapy is administered. Administration of the IdeS protein variant of the present invention can eliminate anti-AAV antibodies in vivo, thereby enabling gene therapy efficacy even after a period of time between AAV vector infusions. Treatment with the IdeS protein variant of the present invention before AAV vector administration results in enhanced hepatic transduction of AAV vectors, even in the event of AAV vector re-infusion. The IdeS protein variant of the present invention can restore the efficacy of gene therapy by eliminating neutralizing antibodies against AAV.

[0097] In some implementations, IgG-related diseases or disorders are diseases mediated by pathogenic IgG antibodies.

[0098] This invention provides a method for treating or preventing diseases mediated by pathogenic IgG antibodies by administering the IdeS protein variant of the invention to a subject. The method may include repeated administration of the IdeS protein variant of the invention. In some embodiments, the diseases mediated by pathogenic IgG antibodies are autoimmune diseases, such as celiac disease, Graves' disease, rheumatoid arthritis, Hashimoto's thyroiditis, type 1 diabetes, systemic lupus erythematosus, vasculitis, Addison's disease, polymyositis, Sjögren's syndrome, progressive systemic sclerosis, glomerulonephritis, myasthenia gravis, immune (or spontaneous) thrombocytopenic purpura, etc. The IdeS protein variant of the invention is capable of treating or preventing all or part of autoimmune diseases mediated by pathogenic IgG antibodies.

[0099] In some implementations, IgG-related diseases or disorders are IgG antibody-mediated transplant rejection.

[0100] In organ recipients, those who have previously undergone transplantation, blood transfusion, or pregnancy may have developed antibodies against human major histocompatibility (MHC) antigens (also known as human leukocyte antigens (HLA)). Such recipients are referred to as "sensitized" recipients. Whether an organ recipient is "sensitized" can be determined by any suitable method. For example, a population reactive antibody (PRA) test can be used to determine if the recipient is sensitized. A PRA score >30% is generally considered "sensitized." Alternatively, a cross-match test can be performed, in which a blood sample from the organ recipient is mixed with a blood sample from the organ donor. A positive cross-match result means that the organ recipient has antibodies that react with the donor's organ.

[0101] Since approximately one-third of patients awaiting organ transplantation are "sensitized" subjects, and up to 15% are "highly sensitized" subjects, to overcome the harmful effects of donor-specific antibodies on organs transplanted into "sensitized" subjects, administering the IdeS protein variant of this invention before organ transplantation can clear donor-specific antibodies from highly sensitized patients, desensitizing them and thus allowing organ transplantation while avoiding antibody-mediated acute rejection. Administering a single dose of the IdeS protein variant of this invention before organ transplantation will enable transplantation in patients with donor-specific IgG antibodies.

[0102] VI. In vitro applications of IdeS protein variants

[0103] The IdeS protein variant of the present invention can be used as a useful tool enzyme in biotechnology.

[0104] In one embodiment, the present invention provides a method for in vitro cleavage of IgG, the method comprising contacting a sample containing IgG with an IdeS protein variant of the present invention under conditions allowing specific cysteine ​​protease activity to occur, thereby specifically cleaving IgG (e.g., human IgG) in vitro. The method for in vitro cleavage of IgG is particularly suitable for generating F(ab')2 and Fc fragments.

[0105] Furthermore, the resulting F(ab')2 fragment can be used to generate the Fab' fragment via a reduction step (e.g., in 2-mercaptoethanolamine or cysteine).

[0106] In one embodiment, the present invention provides a method for detecting or analyzing the presence of IgG in a sample, the method comprising contacting an IgG-containing sample with an IdeS protein variant of the present invention under conditions allowing specific cysteine ​​protease activity. The presence of IgG in the sample can be detected or analyzed by detecting specific IgG cleavage products.

[0107] In one embodiment, the present invention provides a method for removing IgG from a sample, the method comprising contacting a sample containing IgG with an IdeS protein variant of the present invention under conditions allowing specific cysteine ​​protease activity to occur, thereby specifically cleaving the IgG (e.g., human IgG) in vitro and removing the IgG from the sample.

[0108] Example

[0109] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, all reaction reagents involved in the embodiments can be purchased through commercial channels.

[0110] Example 1: Molecular docking prediction and crystal analysis

[0111] In this embodiment, molecular docking studies were conducted, revealing a precise interaction between IdeS and IgG molecules. IdeS variants were designed by gaining a deeper understanding of the molecular docking between IdeS and IgG.

[0112] 1.1 Molecular docking analysis

[0113] Using Poymol software, a detailed molecular docking analysis of IdeS and human IgG molecules was performed, identifying the key pocket region for the interaction between IdeS and human IgG.

[0114] The results showed that the R167K mutation in wild-type IdeS mainly altered the interaction between IdeS and human IgG glycosylation sites, while the D226E mutation in wild-type IdeS significantly affected the binding of IdeS to the Fc segment of human IgG.

[0115] 1.2 Mutant Functional Prediction

[0116] Aspartic acid (Asp, D) and glutamate (Glu, E) are both negatively charged amino acids. Molecular docking predictions indicate that glutamate has a stronger interaction with IgG due to its longer side chain compared to aspartic acid. Therefore, the D226E mutation in wild-type IdeS is expected to enhance the binding affinity between IdeS and IgG (e.g., Figure 1 As shown in the figure, it can potentially enhance the substrate binding ability with IgG, thereby accelerating the cleavage process of IgG by IdeS.

[0117] 1.3 Design and Validation of Double Mutants

[0118] Based on the molecular docking analysis of IdeS and human IgG molecules in Example 1.1, a K167R+D226E double mutant of wild-type IdeS was designed and constructed. This double mutant protein was expressed using a prokaryotic expression system, and its structure was determined using X-ray crystallography. Figure 2 The results showed that, compared with the overall structure of wild-type IdeS, the overall structure of the K167R+D226E double mutant of wild-type IdeS was not significantly altered, maintaining a similar three-dimensional conformation. However, the interaction forces at the mutation site region differed from those reported in the literature. This finding supports the hypothesis that K167R+D226E may alter enzyme activity, but does not substantially affect the overall structure of the IdeS mutant protein. These findings provide strong theoretical support for further verification of the function of the IdeS mutant.

[0119] Example 2: Comparison of Molecular Construction and Cleavage

[0120] In this embodiment, a prokaryotic expression vector for the IdeS variant was constructed, and the cleavage activity of the expressed IdeS variant of IgG was compared.

[0121] 2.1 Construction of prokaryotic expression vectors for the IdeS variant

[0122] The amino acid sequence of the wild-type full-length IdeS (NCBI Reference Sequence NO. WP_010922160.1) is shown in SEQ ID NO. 1. The positions of the mutant amino acids in this paper are based on SEQ ID No. 1. The secretion signal sequence of the N-terminal methionine and the 28 amino acids following it in the wild-type full-length IdeS is usually removed, resulting in the mature IdeS protein (also referred to as IdeS_WT in this paper), whose amino acid sequence is shown in SEQ ID No. 2. The amino acid sequence of the IdeS_K167R variant is shown in SEQ ID No. 3, and the amino acid sequence of the IdeS_D226E variant is shown in SEQ ID No. 4. The coding nucleotide sequences of the IdeS_WT, IdeS_K167R, and IdeS_D226E variants were codon-optimized using E. coli, and a 6×His tag coding nucleotide sequence was ligated into the N-terminus to obtain the nucleotide sequences shown in SEQ ID No. 6, SEQ ID No. 7, and SEQ ID No. 8, respectively. These sequences were then synthesized by Sangon Biotech (Shanghai) Co., Ltd. and cloned into the pUC57 cloning vector, resulting in the pUC57-IdeS_WT, pUC57-IdeS_K167R, and pUC57-IdeS_D226E vectors, respectively.

[0123] The pUC57-IdeS_WT vector was double-digested with NdeI and ShoI enzymes. The double-digested gene fragment was cloned into the pET28a vector (purchased from Shanghai Qiangyao Biotechnology Co., Ltd.) by ligation to obtain the expression vector of IdeS_WT, which is called pET28a-IdeS_WT.

[0124] The pUC57-IdeS_D226E vector was double-digested with NdeI and XhoI enzymes. The double-digested gene fragment was cloned into the pET28a vector (purchased from Shanghai Qiangyao Biotechnology Co., Ltd.) by ligation to obtain the expression vector of IdeS_D226E, which is called pET28a-IdeS_D226E.

[0125] Using the pUC57-IdeS_K167R vector as a template, a nucleic acid fragment containing the K167R mutation site was amplified. The primer sequence used was as follows:

[0126] KZ-K167R-F:AGAAGGAGATATACCATGGGC(SEQ ID No.10)

[0127] KZ-K167R-R: TGATGAACATGTCGATAACGT (SEQ ID No. 11)

[0128] The PCR amplification procedure was as follows: denaturation at 95℃ for 15s, annealing at 57℃ for 30s, and extension at 72℃ for 30s. The PCR products were subjected to gel electrophoresis and purified using a gel purification and recovery kit to obtain a nucleic acid fragment containing the K167R mutation site, with a size of 0.5kb.

[0129] Using the pUC57-IdeS_D226E vector as a template, a nucleic acid fragment containing the D226E mutation site was amplified. The primer sequence used was as follows:

[0130] KZ-D226E-F:ACGTTATCGACATGTTCATCA(SEQ ID No.12)

[0131] KZ-D226E-R:TGGTGGTGGTGCTCGAGT(SEQ ID No.13)

[0132] The PCR amplification procedure was as follows: denaturation at 95℃ for 15s, annealing at 57℃ for 30s, and extension at 72℃ for 30s. The PCR products were subjected to gel electrophoresis and purified using a gel purification and recovery kit to obtain a nucleic acid fragment containing the D226E mutation site, with a size of 0.5kb.

[0133] The In-Fusion cloning reaction system was prepared according to the instructions of the TAKARA fusion kit (Clontech, 638948). A nucleic acid fragment containing the K167R mutation site, a nucleic acid fragment containing the D226E mutation site, and the pET28a vector (purchased from Shanghai Qiangyao Biotechnology Co., Ltd.) double-digested with NdeI and XhoI enzymes were subjected to an In-Fusion reaction (incubated at 50℃ for 15 minutes) to obtain the expression vector with the K167R / D226E double mutation, named pET28a-IdeS_M33. In this paper, the IdeS with the K167R and D226E double mutation is named IdeS_M33, and its amino acid sequence is shown in SEQ ID No. 5.

[0134] 2.2 Expression of IdeS variant and in vitro IgG cleavage efficiency

[0135] Three prokaryotic expression vectors, pET28a-IdeS_WT, pET28a-IdeS_D226E, and pET28a-IdeS_M33, were transformed into competent *E. coli* BL21 cells, streaked, and incubated overnight at 37°C to obtain the first-generation protein expression strains. These first-generation protein expression strains were then transferred to LB medium containing kanamycin resistance. When the OD value reached 0.5–0.6, 5 mM IPTG was added for induction at 30°C for 12–16 hours. After induction, the bacterial cells were collected by centrifugation, and the protein was released by sonication. The supernatant obtained after centrifugation at 12000 rpm was used as the stock solution for the induced protein expression, which was used for subsequent affinity purification.

[0136] Ni column packing was used for affinity adsorption of IdeS_WT, IdeS_D226E, or IdeS_M33 proteins containing a 6×His tag. After column equilibration and column efficiency validation, the target proteins were purified in four steps, as follows:

[0137] 1) Sample loading: Load each sample at a flow rate of 1.5 ml / min.

[0138] 2) Rinse: Rinse the column with Tris-HCl buffer, using approximately 3 column volumes for equilibration.

[0139] 3) Elution: Elute once with 300mM imidazole concentration eluent, the volume of eluent used is 2 column volumes.

[0140] 4) The purity of the protein in the eluent was detected by SDS-PAGE.

[0141] The purified proteins were analyzed by measuring their OD280 values ​​to obtain protein concentrations. The protein concentration was then adjusted to 1 mg / ml and diluted 1:1000. An in vitro cleavage reaction was then performed with an equal volume of 1 mg / ml IgG (Merck I4506). Samples were taken at 0 min, 10 min, 25 min, 40 min, and 60 min to analyze the F(ab′)2 fragments generated from IgG cleavage. After the reaction, SDS-PAGE loading buffer was added to the reaction system, and the reaction was terminated by boiling. The differences in cleavage activity among different IdeS variants were evaluated by analyzing the gray values ​​at the final time points. The results are as follows: Figure 3 As shown.

[0142] Specifically, the sampled material was loaded onto 12.5% ​​SDS-PAGE, and the amount of F(ab′)2 fragments generated from IgG cleavage was analyzed. Figure 3(Left small image in the image) Using the grayscale value of the F(ab′)2 fragment obtained by IdeS_WT at a reaction time of 60 min as 100%, the ratio of the grayscale value of the F(ab′)2 fragments obtained by IdeS_D226E and IdeS_M33 to that of the F(ab′)2 fragment obtained by IdeS_WT was calculated. The results are as follows. Figure 3 The results, as shown in the inset on the right, demonstrate that the IdeS_D226E mutant does indeed enhance the cleavage activity of IdeS. Notably, the cleavage activity of the IdeS_M33 variant is significantly higher than that of the IdeS_WT and IdeS_D226E single mutants, reaching 2.08 times that of IdeS_WT. This indicates that the K167R and D226E mutant combination significantly affects the interaction mode and intermolecular forces between IdeS and IgG, thereby significantly improving the cleavage efficiency of IgG.

[0143] Example 3 Comparison of the in vitro IgG cleavage activity of each IdeS protein purified by GST tag

[0144] Using the CDS region of IdeS in the IdeS_WT and IdeS_M33 vectors obtained in Example 2 as amplification templates, the IdeS_WT and IdeS_M33 gene sequences were amplified by PCR, and homologous arms were introduced at both ends. The primer sequences used for PCR amplification are shown below:

[0145] KZ-GST-IdeS-F:TGCAGAACGTCGCGAGACTCTTTCTCTGCAAACCA(SEQ ID No.14)

[0146] KZ-GST-IDES-R:GTGGTGGTGGTTGGTGTCATTATTAGTTGGTCTGGTTCCA(SEQ ID No.15)

[0147] The PCR amplification procedure was as follows: denaturation at 95℃ for 15s, annealing at 57℃ for 30s, and extension at 72℃ for 30s. The PCR products were subjected to gel electrophoresis and purified using a gel purification and recovery kit to obtain nucleic acid fragments of IdeS_WT and IdeS_M33, with a size of approximately 1kb.

[0148] The GST tag expression vector (Takara, 3372) was digested with XhoI to obtain a linearized GST tag expression vector. The In-Fusion cloning reaction system was prepared according to the instructions of the Takara Fusion Kit (Clontech, 638948). The IdeS_WT and IdeS_M33 nucleic acid fragments (without tags) were incubated with the XhoI-digested linearized GST tag expression vector in the reaction system for In-Fusion reaction (incubation at 50°C for 15 minutes). The obtained expression vectors were named pGST-IdeS_WT and pGST-IdeS_M33 expression vectors.

[0149] The obtained pGST-IdeS_WT and pGST-IdeS_M33 prokaryotic expression constructs were activated in bacterial strains. These two plasmid vectors were then transformed into competent *E. coli* BL21 cells, streaked, and incubated overnight at 37°C to obtain the first-generation protein expression strains. These first-generation protein expression strains were then transferred to LB medium containing kanamycin resistance. When the OD value reached 0.5–0.6, 5 mM IPTG was added for induction at 16°C for 12–16 hours. After induction, the bacterial cells were collected by centrifugation, and the protein was released by sonication. The supernatant obtained after centrifugation at 12000 rpm was the induced protein stock solution, used for subsequent affinity purification.

[0150] Affinity chromatography using a column containing reduced glutathione (GSH) was employed for the affinity purification of GST-tagged IdeS_WT and IdeS_M33 proteins. First, after preparing the column, the sample was loaded onto the column at a rate of 1 mL / min. Subsequently, the column was washed with 20 mM Tris (pH 8.0) working buffer for approximately 2–3 column volumes to remove unbound components. Next, elution was performed using 20 mM Tris (pH 8.0) elution buffer containing 1 M NaCl, ensuring a conductivity of 5–10 mS / cm to obtain optimal elution efficiency for IdeS_WT and IdeS_M33 proteins (see [link to documentation]). Figure 4The purified proteins were further washed using a molecular sieve to replace the buffer with PBS. GST-IdeS_WT and GST-IdeS_M33 proteins were treated with thrombin and incubated at 22°C for 2 to 16 hours to remove the GST tag. After the reaction, 1 mM of benzyl sulfonyl fluoride (PMSF) or 4-(2-aminoethyl)benzenesulfonyl fluoride (AEBSF) was added to terminate the digestion reaction, and the digestion efficiency was assessed by SDS-PAGE. If uncleaved GST tags and proteases were present, they were purified again using a GSH affinity chromatography column. The column eluent was collected and treated with thrombin to obtain the target protein with the GST tag removed.

[0151] The protein concentration was then determined using OD280 and adjusted to 1 mg / ml. The adjusted protein was then diluted 500-fold, 1000-fold, and 2500-fold, and mixed with an equal volume of 1 mg / ml IgG (Merck I4506) for in vitro cleavage experiments. A schematic diagram of IdeS's two-stage IgG cleavage mechanism is shown below. Figure 5 As shown, the reaction time is as follows Figure 6 The horizontal axis of the smaller right-hand plot is shown. After the reaction time, SDS-PAGE loading buffer was added to the reaction system and the mixture was boiled to terminate the IdeS cleavage reaction. Samples were then taken. The differences in cleavage activity among different IdeS variants were evaluated by analyzing the gray values ​​at each reaction time point. The results are shown below. Figure 6 As shown.

[0152] Specifically, the sampled data were loaded onto 12.5% ​​SDS-PAGE, and the amount of F(ab′)2 fragments generated from IgG cleavage was analyzed. Figure 6 (Left small image in the image) By taking the grayscale value of the F(ab′)2 fragment obtained by IdeS_WT at each dilution ratio as 100%, the ratio of the grayscale value of the F(ab′)2 fragment obtained by IdeS_M33 at each dilution ratio to the grayscale value of the F(ab′)2 fragment obtained by IdeS_WT at each dilution ratio is calculated. The results are as follows. Figure 6 As shown in the small image on the right. Figure 6 The cleavage results showed that the cleavage activity of IdeS_M33 protein at different dilutions and the same reaction time was significantly higher than that of IdeS_WT. Specifically, cleavage activity increased by 7.1-fold when cleaving IgG at a 500-fold dilution for 3 minutes, with an average increase of 3.76-fold (based on the difference in the increase of F(ab′)2). Furthermore, this study also demonstrates that adding different purification tags to the IdeS protein terminus does not significantly affect its activity. Therefore, multiple tagging methods can be adopted for future large-scale production purification.

[0153] Example 4: Comparison of IdeS_M33's in vivo IgG cleavage activity

[0154] The IdeS_WT and IdeS_M33 proteins (1 mg / ml) purified in Example 3 were diluted and added to rabbit serum (prepared in our laboratory) to achieve a final concentration of 2 μg / ml. The mixture was then cut at 37°C. The reacted rabbit serum was collected at 5 min, 15 min, 30 min, 60 min, 120 min, and 240 min, respectively. The samples were separated by SDS-PAGE and analyzed by Western blotting (WB) (standard transfer, blocking, then addition of anti-rabbit IgG secondary antibody (purchased from Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.), thorough washing three times, and color development; all procedures were standard). The results are as follows: Figure 7 As shown.

[0155] Figure 7 The results showed that, compared with the residual amount of serum IgG after 240 min of IdeS_WT cutting, the IdeS_M33 variant can significantly shorten the time required to cut serum IgG. The IdeS_M33 variant can achieve the cutting effect of IdeS_WT after 240 min in only 60 min.

[0156] The foregoing describes exemplary embodiments of the present invention. Those skilled in the art should understand that these disclosures are merely exemplary, and various other substitutions, adaptations, and modifications can be made within the scope of the present invention. Therefore, the present invention is not limited to the specific embodiments listed herein.

[0157] Exemplary sequence information

[0158] SEQ ID NO.1: Full-length amino acid sequence of wild-type IdeS containing N-terminal methionine and signal sequence (NCBI Reference Sequence NO.WP_010922160.1, 339aa)

[0159]

[0160] SEQ ID No. 2: Mature sequence of wild-type IdeS (310aa) lacking N-terminal methionine and signal sequence.

[0161]

[0162] SEQ ID No. 3: Amino acid sequence (310aa) of the IdeS_K167R variant.

[0163]

[0164]

[0165] SEQ ID No. 4: Amino acid sequence (310aa) of the IdeS_D226E variant.

[0166]

[0167] SEQ ID No. 5: Amino acid sequence of the IdeS_M33 variant (310aa)

[0168]

[0169] SEQ ID NO.6: E. coli codon-optimized IdeS_WT encoded nucleotide sequence (with His tag) (1002bp)

[0170]

[0171] SEQ ID NO.7: E. coli codon-optimized Ides_K167R encoding nucleotide sequence (with His tag) (1002bp)

[0172]

[0173]

[0174] SEQ ID NO.8: The nucleotide sequence encoded by the codon-optimized Ides_D226E of *E. coli* (with a His tag).

[0175]

[0176] SEQ ID NO.9: E. coli codon-optimized Ides_M33 encoding nucleotide sequence (with His tag)

[0177]

Claims

1. A variant of the IdeS protein, possessing IgG cysteine ​​protease activity, and relative to the parental IdeS protein. (a) Contains glutamic acid (E) at position 226 corresponding to SEQ ID No. 1; or (b) It contains arginine (R) at position 167 corresponding to SEQ ID No. 1 and glutamic acid (E) at position 226.

2. The IdeS protein variant according to claim 1, wherein the parental IdeS protein comprises or is composed of the following amino acid sequence: (a) The amino acid sequence of SEQ ID No. 2; (b) An amino acid sequence having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with SEQ ID No. 2 and having IgG cysteine ​​protease activity; or (c) Compared with the amino acid sequence of (a) or (b), it has one or more (e.g., 1, 2, 3, 4, 5, 7, 8, 9 or 10) amino acid residue substitutions, deletions and / or additions (preferably, conserved amino acid substitutions) and has IgG cysteine ​​protease activity.

3. The IdeS protein variant according to claim 1, wherein, The IdeS protein variant (a) Containing or consisting of the amino acid sequence of SEQ ID No. 4; or (b) Contains or consists of the amino acid sequence of SEQ ID No.

5.

4. The IdeS protein variant according to any one of claims 1-3, wherein the N-terminus contains a signal peptide sequence, for example, the amino acid sequence of positions 2-29 of SEQ ID No.

1.

5. The IdeS protein variant according to any one of claims 1-4, further comprising one or more tag sequences at the N-terminus or C-terminus, for example, the tag sequence being a histidine tag sequence, a GST tag, or a HA tag sequence.

6. An isolated nucleic acid, wherein the nucleic acid comprises a multinucleotide sequence encoding a variant of the IdeS protein according to any one of claims 1-5, for example, comprising the nucleotide sequence of SEQ ID No. 8 or SEQ ID No.

9.

7. An expression box that contains, in a 5'-3' direction: (a) Starter sequence elements, and (b) The nucleic acid according to claim 6.

8. A nucleic acid vector, for example, a nucleic acid expression vector, comprising the nucleic acid of claim 6 or the expression cassette of claim 7.

9. A host cell comprising the nucleic acid of claim 6, the expression cassette of claim 7, or the nucleic acid vector of claim 8, preferably the host cell being a bacterial cell, such as an Escherichia coli cell.

10. A pharmaceutical composition comprising an IdeS protein variant according to any one of claims 1-5, a nucleic acid according to claim 6 or a nucleic acid vector according to claim 8, and a pharmaceutically acceptable excipient.

11. Use of the IdeS protein variant according to any one of claims 1-5, the nucleic acid according to claim 6, or the nucleic acid vector according to claim 8 for the preparation of a medicament for the treatment or prevention of IgG-related diseases or disorders, preferably administered by intravenous injection, for example, the IgG-related diseases or disorders being selected from: disorders caused by neutralizing antibodies against AAV that affect gene therapy, diseases mediated by pathogenic IgG antibodies (e.g., autoimmune diseases), and IgG antibody-mediated transplant rejection.

12. A method for detecting or analyzing the presence of IgG in a sample, a method for cleaving IgG in vitro, or a method for removing IgG from a sample, said method comprising contacting a sample containing IgG with an IdeS protein variant according to any one of claims 1-5.