A method for constructing a glycogen storage disease type 3 zebrafish f0 generation model and application thereof in drug screening

Abstract

The application discloses a construction method of a glycogen storage disease type 3 (GSD III) zebrafish F0 generation model and application thereof in drug screening, mixes sgRNA combinations with Cas9 protein, and jointly injects into single-cell period embryos of wild type zebrafish to cultivate and obtain F0 generation zebrafish models with double allelic mutations. The sgRNA combinations comprise a first targeting sequence and a second targeting sequence for an agla gene, and a third targeting sequence and a fourth targeting sequence for an aglb gene. The application breaks through the technical barrier that a traditional GSD III zebrafish double knockout homozygous strain construction cycle lasts for 6-12 months, through screening of high-activity sgRNA combinations and a high-concentration Cas9 protein co-injection strategy in the single-cell period, the application realizes a very high double allelic mutation rate in the F0 generation, and effectively overcomes the defects of high chimerism and unstable phenotype in the traditional F0 generation.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology and animal model construction technology, and particularly relates to a method for constructing a zebrafish F0 generation model of glycogen storage disease type 3 and its application in drug screening. Background Technology

[0002] Glycogen storage disease type 3 (GSD III) is an autosomal recessive genetic disorder caused by a mutation in the AGL gene, leading to a deficiency in the function of glycogen debranching enzymes and resulting in abnormal accumulation of glycogen in target tissues such as the liver or muscles. Constructing animal models that highly mimic the pathological characteristics of human GSD III is a crucial prerequisite for elucidating its pathogenic mechanism and conducting targeted drug screening. Zebrafish, due to their high reproductive rate, good permeability, and ease of high-throughput manipulation, have become an ideal disease model vector.

[0003] However, existing technologies face significant bottlenecks when constructing GSD III models using zebrafish. First, the zebrafish genome contains two paralogous genes of AGL, agla and aglb. Due to strong compensatory effects between gene functions, knocking out a single gene often fails to fully replicate the typical lethality or severe pathological characteristics of human GSD III. Second, to overcome gene compensation, traditional methods tend to construct homozygous mutant lines with two gene knockouts (stable lines). However, this requires cumbersome steps such as F0 generation microinjection, F1 generation hybridization screening, and F2 generation purification, typically taking 6-12 months. The construction cycle is extremely long and costly, severely hindering the progress of new drug development.

[0004] On the other hand, although there have been attempts in recent years to use F0 generation chimeras (Crispant) for rapid research, conventional F0 generation models often suffer from low gene editing efficiency and uneven chimerism among individuals, resulting in huge phenotypic differences and making them difficult to use directly for drug evaluation. More importantly, current research on GSD III zebrafish models is mostly focused on adult or late juvenile stages, lacking early (juvenile) sensitive indicators and precise detection time windows suitable for high-throughput small molecule screening.

[0005] In summary, there is an urgent need in this field for a rapid screening model that can overcome homologous gene compensation, construct a highly homogeneous phenotype within a very short time (within 2 weeks), and completely and stably replicate the human GSD III characteristics of "hepatomegaly, hypoglycemia, high CK and motor deficits," and there is also an urgent need to establish a matching early high-throughput drug efficacy evaluation system. Summary of the Invention

[0006] The purpose of this invention is to provide a method for constructing a zebrafish F0 generation model of glycogen storage disease type 3 (GSD III) and its application in drug screening. The invention utilizes CRISPR / Cas9 gene editing technology to simultaneously target and knock out the agla and aglb genes to construct a rapid screening model of GSD III zebrafish F0 generation, and establishes a high-throughput drug screening and evaluation system based on biochemical indicators at 8 days postfertilization (8 dpf) and behavioral indicators at 9 dpf.

[0007] To achieve the above objectives, this application adopts the following technical solution:

[0008] In a first aspect, the present invention provides a combination of sgRNAs that simultaneously target and knock out the zebrafish agla gene and aglb gene, the combination of sgRNAs comprising a first and a second targeting sequence for the agla gene, and a third and a fourth targeting sequence for the aglb gene.

[0009] The nucleotide sequence of the first target sequence is shown in SEQ ID NO. 1, the nucleotide sequence of the second target sequence is shown in SEQ ID NO. 2, the nucleotide sequence of the third target sequence is shown in SEQ ID NO. 3, and the nucleotide sequence of the fourth target sequence is shown in SEQ ID NO. 4.

[0010] Secondly, the present invention provides a method for constructing a GSD III zebrafish F0 generation model, comprising the following steps: mixing the above-mentioned sgRNA combination with Cas9 protein and injecting them together into the single-cell embryos of wild-type zebrafish to obtain an F0 generation zebrafish model with biallelic mutations.

[0011] In the above technical solutions, the final concentration of the Cas9 protein is 200 ng / µL ~ 300 ng / µL, and the total final concentration of the sgRNA combination is 300 ng / µL ~ 400 ng / µL.

[0012] In the above technical solution, the final concentration of the Cas9 protein is 250 ng / µL, the concentration of each individual sgRNA in the sgRNA combination is 90 ng / µL, and the total concentration is 360 ng / µL.

[0013] In the above technical solutions, the injection volume for co-injection is 0.5 nL / embryo to 2 nL / embryo.

[0014] In the above technical solutions, the injection volume is 1 nL / embryo.

[0015] Thirdly, this invention provides the application of the above-mentioned sgRNA combination, or the zebrafish F0 generation model constructed using the above-mentioned construction method, in screening drugs for the treatment of glycogen storage disease type 3.

[0016] Fourthly, the present invention provides a method for high-throughput screening of drugs for treating GSD III, using a zebrafish F0 generation model constructed using the above-described method. The screening method includes the following steps:

[0017] (1) Drug treatment: During a specific time window after fertilization, the compound to be tested was added to the culture water containing the zebrafish F0 generation model for drug bath treatment;

[0018] (2) Phenotypic detection: Zebrafish samples were collected at specific detection points after fertilization, and their biochemical and / or behavioral indicators were detected;

[0019] (3) Evaluation of efficacy: If the test compound can significantly reverse abnormal biochemical indicators or significantly improve behavioral motor deficits, then the test compound is determined to have the potential to improve GSD III symptoms.

[0020] In the above technical solution, in step (1), the specific time window period is from the 3rd to the 8th day after fertilization.

[0021] In the above technical solution, in step (2), the specific detection node of the biochemical indicators is the 8th day after fertilization. The biochemical indicators include: whole fish creatine kinase activity, whole fish alanine aminotransferase activity, whole fish total glucose content, and one or more of liver size or fluorescent area.

[0022] The specific detection point for the behavioral indicators is the 9th day after fertilization. The behavioral indicators include: the distance of movement and / or the maximum speed of movement in the spontaneous behavior test, and the distance of movement in the dark field environment in the light and dark stimulus test.

[0023] The beneficial effects of this invention are as follows:

[0024] 1. Overcoming time barriers to achieve rapid construction of efficient double knockout models with uniform phenotypes:

[0025] This invention breaks through the technical barrier of constructing homozygous double-knockout strains of glycogen storage disease type III (GSD III) in zebrafish, which typically takes 6-12 months. By carefully selecting a combination of highly active sgRNAs (two each targeting the agla and aglb genes) and employing a high-concentration Cas9 protein co-injection strategy during the single-cell stage, this invention achieves an extremely high biallelic mutation rate in the F0 generation, effectively overcoming the shortcomings of high chimerism and phenotypic instability in the traditional F0 generation. This method not only significantly shortens the model construction cycle to less than two weeks but also successfully induces a severe GSD III lethal phenotype (21dpf survival rate reduced to 15.33%, P < 0.0001), providing an efficient, low-cost, and highly reliable model source for high-throughput drug screening.

[0026] 2. Establish a "golden screening window" to fill the gap in early high-throughput evaluation systems:

[0027] Addressing the challenge of unclear early screening indicators and time points in existing technologies, this invention, through rigorous temporal screening, negates the detection windows of 3 dpf (no behavioral difference) and 5 dpf (no significant morphological difference), creatively defining 8 days (8 dpf) and 9 days (9 dpf) post-fertilization as the "golden screening windows" for the outbreak of pathological and functional defects. At 8 dpf, as the period of explosive biochemical and pathological phenotype development, the model fish exhibited a highly significant increase in creatine kinase (CK) and a large accumulation of liver glycogen; at 9 dpf, significant spontaneous behavior and motor defects under both light and dark stimuli were observed. The establishment of this multi-dimensional evaluation system provides extremely precise time points and objective evidence for high-throughput drug efficacy initial and secondary screening.

[0028] 3. Revealing the early pathological sequence of myopathy, providing novel drug efficacy intervention targets and evaluation dimensions:

[0029] During model validation, this invention yielded an unexpected scientific discovery: although whole-fish CK levels were significantly elevated at 8 days post-flop (dpf) and severe motor deficits were observed at 9 dpf, no significant pathological glycogen solidification and accumulation was observed in PAS staining of muscle tissue at 8 and 10 dpf. This characteristic profoundly reveals the pathological timeline of early GSD III muscle damage (elevated CK, decreased motor ability) preceding the large-scale deposition of glycogen in the muscle body. Based on this characteristic, the model and screening method provided by this invention can accurately capture the "functional impairment / subclinical stage" before the occurrence of solid pathological changes, greatly advancing the intervention time point for drug efficacy evaluation and providing an extremely sensitive evaluation platform for the development of targeted drugs to improve early myopathy symptoms. Attached Figure Description

[0030] The specific embodiments of the present invention will be described in detail below with reference to the accompanying drawings. It should be noted that the accompanying drawings are merely schematic illustrations, used to help illustrate the technical solutions and preferred embodiments of the present invention, and do not constitute a limitation on the scope of protection of the technical solutions of the present invention. Within the scope defined by the claims of the present invention, any equivalent transformations or modifications based on the principles of the present invention should be considered to fall within the protection scope of the present invention.

[0031] Figure 1 This is a comparison of the survival rate curves of zebrafish in the Cas9 control group and the agla&b editing group in an embodiment of the present invention;

[0032] Figure 2 This is a graph showing the test results of the touch escape response of 3 pf zebrafish in an embodiment of the present invention;

[0033] Figure 3 This is a statistical chart showing the bright field morphology and eye distance / body length measurement of 5 dpf zebrafish juveniles in this embodiment of the invention;

[0034] Figure 4 This is a statistical and comparative diagram of the liver fluorescence area of ​​8 dpf zebrafish in an embodiment of the present invention;

[0035] Figure 5 Here are HE-stained and PAS-stained sections of liver tissue from 8 dpf zebrafish in this embodiment of the invention;

[0036] Figure 6 This is a bar chart showing the whole-fish biochemical indicators of 8 dpf zebrafish in this embodiment of the invention;

[0037] Figure 7 This is a PAS-stained section of muscle tissue from an 8 dpf zebrafish in an embodiment of the present invention.

[0038] Figure 8 This is a PAS-stained section of muscle tissue from a 10 dpf zebrafish in an embodiment of the present invention.

[0039] Figure 9 This is a diagram showing the test results of spontaneous behavior of 9 dpf zebrafish in an embodiment of the present invention;

[0040] Figure 10 This is a graph showing the light and dark stimulus behavior test results of 9 dpf zebrafish in an embodiment of the present invention. Detailed Implementation

[0041] To better illustrate the objectives, technical solutions, and advantages of this invention, the invention will be further described below in conjunction with specific embodiments. This invention can be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the inventive concept to those skilled in the art. This invention will be defined only by the claims.

[0042] Unless otherwise specified, the test methods or experimental methods described in the following examples are conventional methods; unless otherwise specified, the reagents and materials are obtained from conventional commercial sources or prepared by conventional methods.

[0043] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0044] This invention provides a rapid screening model for F0 generation zebrafish that simultaneously and efficiently knocks out the agla and agleb genes using CRISPR / Cas9 technology. By screening for highly active sgRNA combinations targeting the two genes, a high concentration of Cas9 protein is co-injected with four sgRNAs (agla-sgRNA1 / 3 + agleb-sgRNA2 / 3) during the single-cell stage, achieving a high proportion of bicelesteal mutations in F0 generation individuals, thereby overcoming the compensatory effect of single gene knockout.

[0045] 1. Target selection: For zebrafish agla and aglb genes, the target is preferably designed in the first half of the CDS sequence region encoding the protein, while avoiding possible off-target sites, to ensure the destruction of the catalytic active site of glycogen debranching enzyme.

[0046] 2. Highly active sgRNA sequence:

[0047] (1) Targeting the agla gene:

[0048] agla-sgRNA1: TGCAGTCCAGGGGCAAGACATGG (SEQ ID NO. 1, CRISPRater score 0.60, measured efficiency ~89%)

[0049] agla-sgRNA3: TTCCAAATGCCTCGGGCCCCTGG (SEQ ID NO. 2, CRISPRater score 0.58, measured efficiency ~90%).

[0050] (2) Targeting the aglb gene:

[0051] aglb-sgRNA2: GCTGCTATAATATTCCCTCCTGG (SEQ ID NO. 3, CRISPRater score 0.68, measured efficiency ~94%)

[0052] aglb-sgRNA3: TCCATACTTCAGAGGCATCCAGG (SEQ ID NO. 4, CRISPRater score 0.61, measured efficiency ~88%).

[0053] 3. Injection system:

[0054] (1) Final concentration of Cas9 protein: 250 ng / µL;

[0055] (2) Total concentration of sgRNA: approximately 360 ng / µL (the concentration of a single sgRNA is 90 ng / µL, and there are 4 sgRNAs in total);

[0056] (3) Injection volume: 1 nL / embryo.

[0057] Example 1: Design, screening, and activity validation of highly efficient sgRNAs targeting the agla and aglB genes.

[0058] To overcome the compensatory effect of single gene knockout, this invention preferably knocks out two paralogous genes (agla and aglb) in the zebrafish genome simultaneously.

[0059] 1. Target Design and sgRNA Synthesis: Using the CHOPCHOP online tool, multiple sgRNAs were designed targeting the first half of the coding sequences (CDS) of the zebrafish agla and agleb genes to ensure disruption of the catalytic active site of glycogen debranching enzymes and to strictly avoid potential off-target sites. After the target sequences were transcribed into sgRNAs in vitro, the integrity and high purity of the synthesized products were ensured by concentration determination (controlled within the range of 870-880 ng / µL) and agarose gel electrophoresis.

[0060] 2. In vivo editing activity verification: The purified sgRNAs (final concentration 90 ng / µL) were mixed with Cas9 protein (final concentration 250 ng / µL) and injected separately into single-cell embryos of wild-type (WT) zebrafish. Genomic DNA was extracted from the embryos 24 hours post-fertilization (24 hpf) and PCR amplification was performed using specific primers (agla-F1 / R1, aglb-F1 / R1).

[0061] Agla verification primer: agla-F1: AAGTATTCCACACCTATCACAG (SEQ ID NO. 5);

[0062] agla-R1: AGCATGGTTATTGATTTGTGCAT (SEQ ID NO. 6);

[0063] aglb validation primer: aglb-F1: AAATGGTGGGCTACTTGCGA (SEQ ID NO. 7);

[0064] aglb-R1: TTGTTTCCTACCTCCCGCAG (SEQ ID NO. 8).

[0065] 3. Optimization and Establishment of Highly Active Sequences: The amplified products were analyzed by Sanger sequencing combined with the TIDE algorithm. The results showed that the average editing efficiencies of sgRNA1 and sgRNA3 targeting the agla gene were as high as 89% and 90%, respectively; the average editing efficiencies of sgRNA2 and sgRNA3 targeting the aglb gene were as high as 94% and 88%, respectively. Furthermore, significant Indel mutations were consistently detected in all tested samples (3 / 3). Therefore, the above four highly active sgRNA combinations were established for the subsequent construction of the double knockout F0 generation model (agla&b editing group).

[0066] Example 2: Construction and survival evaluation of a double gene knockout model of glycogen storage disease type 3 (GSD III) in F0 generation zebrafish.

[0067] 1. Co-injection system configuration and model construction: A mixed injection solution containing the above-mentioned four preferred sgRNAs (agla-1, agla-3, aglb-2, aglb-3) was prepared to achieve a final Cas9 protein concentration of 250 ng / µL and a total sgRNA concentration of approximately 360 ng / µL (90 ng / µL for a single sgRNA). This mixture was co-injected into TU strain zebrafish single-cell embryos at a volume of 1 nL / embryo, while the control group was injected with the same concentration of pure Cas9 protein.

[0068] 2. Survival statistics and lethal window analysis: Continuous culture and phenotypic tracking of embryos after injection ( Figure 1 The Log-rank test results showed a significant difference in survival rates between the two groups of zebrafish (P < 0.0001). At 21 dpf, the survival rate of the Cas9 control group (n=96) was 87.50%, while the survival rate of the agla&b editing group (n=137) was only 15.33%. Mortality events were mainly concentrated between 6 and 12 dpf, suggesting that this period is a critical timeframe for lethality due to metabolic defects.

[0069] like Figure 1As shown, the survival rate of zebrafish in the Cas9 control group (n = 96) and the Agla&b edited group (n = 137) differed significantly (Log-rank test, p-value < 0.0001). At 21 days post-flop (dpf), 87.50% of individuals in the Cas9 control group survived, while 15.33% of individuals in the Agla&b edited group survived. Mortality was mainly concentrated between 6 and 12 dpf, with no obvious mortality observed from 13 dpf onwards.

[0070] Example 3: Time-series investigation and verification of the "golden screening window" for biochemical and behavioral tests

[0071] To establish a stable and reliable high-throughput screening and evaluation system, this invention conducted a systematic screening of early developmental stages at temporal intervals (3 dpf, 5 dpf, 8 dpf, 9 dpf, 10 dpf).

[0072] 1. Exclude early and mid-stage detection windows (3 DPF and 5 DPF):

[0073] (1) 3 dpf behavioral test: Touch escape response test on juvenile fish ( Figure 2 Imaging data analysis showed that the needle-touch swimming distance (P=0.9126) and response rate (P=0.1660) of the edited group juvenile fish were not significantly different from those of the control group.

[0074] like Figure 2 As shown, zebrafish juveniles with a 3 dpf cas9 control group and the agla&b editing group were selected for the experiment. A normally shaped juvenile fish was placed in a 17mm × 15mm × 1mm groove, with the water surface level with the groove. The microscope magnification was set to 0.6x. A fine needle was used to gently touch the back of the juvenile fish, and video was recorded simultaneously for data analysis. The microscope was a Mingmei NSZ-608T stereo microscope, paired with an MS60-2 CCD camera. ImageJ was used to measure the swimming distance of the zebrafish in the video after the needle touch (exposure value 80 ms / frame), and the response rate was analyzed. No significant differences were found in either parameter in the agla&b editing group.

[0075] (2) 5dpf morphological detection: ( Figure 3 The interocular distance, body length, and interocular distance / body length ratio of juvenile fish were measured under a stereomicroscope. The results showed no significant morphological abnormalities between the two groups (P values ​​were 0.3793, 0.2960, and 0.1024, respectively). This ruled out the possibility of 3 dpf and 5 dpf as drug efficacy screening nodes.

[0076] like Figure 3As shown, 5 dpf zebrafish juveniles were selected, and their positions were adjusted to ensure they were horizontal and back-facing on the display screen. The bright-field microscope was set to 2x magnification, and photos were taken and saved. The microscope was a Nikon SMZ800N stereo microscope paired with a Touptek high-resolution CCD camera. ImageJ was used to measure the zebrafish's eye-to-body distance and brain fluorescence area in the images. The measurement method is as follows: Figure 3 A. No obvious morphological abnormalities were observed in the agla&b editing group.

[0077] 2. Establish 8 dpf as the optimal window for biochemical and pathological testing:

[0078] (1) Liver solid phenotype: ( Figure 4 Qualitative and quantitative analysis using fluorescence microscopy confirmed that the liver fluorescence area was significantly increased in the 8 dpf edited group (P = 0.0014). Figure 5 Histological examination showed that hepatocytes were significantly edematous under HE staining; PAS staining showed a large area of ​​purplish-red positive signal, confirming that there was a large amount of glycogen accumulation in the liver area.

[0079] like Figure 4 As shown, 8 dpf zebrafish juveniles were selected, and their positions were adjusted to ensure they were horizontal and back-facing on the display screen. Liver fluorescence microscopy was performed at 4x magnification, and images were taken and saved. The microscope used was a Nikon SMZ800N stereo microscope paired with a Touptek high-resolution CCD camera. ImageJ was used to measure the zebrafish's eye-to-body distance and brain fluorescence area in the images, using the following measurement method: Figure 4 The liver fluorescence area of ​​the A, agla&b editing group was significantly increased.

[0080] like Figure 5 As shown, 8-day-old zebrafish juveniles were selected for the experiment. HE staining showed obvious edema in the liver region of the agla&b editing group; PAS staining showed a large area of ​​obvious purplish-red PAS staining positive signal in the liver region of the agla&b editing group, indicating that there was a large amount of glycogen accumulation in the liver of the experimental group.

[0081] (2) Biochemical indicators: ( Figure 6 When whole fish tissue homogenates were collected at 8 dpf, the activity of creatine kinase (CK) in the edited group was found to be significantly elevated (P < 0.0001); accompanied by a significant increase in alanine aminotransferase (ALT) (P = 0.0049) and a significant decrease in total glucose content (P = 0.0089).

[0082] like Figure 6 As shown, juvenile zebrafish with a dpf of 8 were selected for the experiment, and 4 tubes of samples were prepared for each group for each indicator (n=4). Figure 6These respectively represent: The agla & b editing group showed a significant increase in ALT enzyme activity in all fish. Figure 6 A); there was no significant difference in AST enzyme activity ( Figure 6 B); The total glucose content of the whole fish in the agla&b editorial group decreased significantly ( Figure 6 C); The CK enzyme activity of whole fish in the agla&b editing group increased significantly ( Figure 6 D).

[0083] (3) Histological identification of early muscle injury: 8 dpf ( Figure 7 ) and 10 dpf ( Figure 8 Muscle tissue sections from juvenile zebrafish were prepared and stained with PAS. Results showed no significant glycogen accumulation in the muscle sections from both the cas9 control group and the agla&b edited group. This suggests that large-scale pathological glycogen solidification and deposition had not yet occurred in the muscle tissue during this window period.

[0084] 3. Establish 9 dpf as the optimal window for behavioral (motor defect) detection:

[0085] To verify whether the model fish exhibited muscle weakness symptoms, 9 dpf juvenile fish were selected for testing.

[0086] (1) Spontaneous behavior test: ( Figure 9 Young fish were placed in the DanioVision system and allowed to acclimatize to darkness for 30 minutes before their spontaneous behavioral trajectories were recorded for 45 minutes. The results showed that the movement distance (P < 0.0001) and maximum movement speed (P < 0.0001) of the edited group both declined significantly.

[0087] (2) Light and dark stimulus test: ( Figure 10 Under alternating dark / light environment stimulation for four consecutive cycles (5 min each), the juvenile fish in the edited group still moved a significantly shorter distance in the dark environment than the control group (P = 0.0003). This confirms that 9 dpf is the most sensitive time point for assessing the muscular deficit phenotypes such as muscle weakness in this model.

[0088] like Figure 9 As shown, 9 dpf zebrafish juveniles were selected and placed in a 96-well plate at a ratio of one fish per well. After acclimatizing to the dark environment for 30 min under the DanioVision system, spontaneous behavioral trajectory data were collected for 45 min in the dark environment. The results showed that in the spontaneous behavior test, the movement distance (P < 0.0001) and maximum movement speed (P < 0.0001) of the agla&b editing group (experimental group) were significantly lower than those of the cas9 control group.

[0089] like Figure 10As shown, 9 dpf zebrafish juveniles were selected, and light and dark stimulation tests were conducted continuously after the spontaneous behavior test, with four cycles of light and dark stimulation (5 min each in darkness and light). The results showed that in the light and dark stimulation test, the movement distance of the agla&b editing group was significantly lower than that of the cas9 control group in the dark environment (P = 0.0003).

[0090] Example 4: High-throughput drug screening method for glycogen storage disease type 3 (GSD III) based on the above-mentioned F0 generation model

[0091] This embodiment provides an efficient evaluation strategy for early drug efficacy screening based on the above model:

[0092] 1. Drug administration intervention phase: Collect F0 generation agla&b edited group embryos that have completed co-injection. When the embryos develop to 3 dpf, the test compound (or small molecule library) is added to the 96-well plate or culture water at a gradient concentration for continuous drug bath treatment until 8 dpf or 9 dpf.

[0093] 2. Initial Screening Evaluation Criteria (Targeting Early Muscle Injury): At 8 days post-exposure (dpf), samples were collected from some juvenile fish, with a focus on detecting whole-fish creatine kinase (CK) activity. If the CK activity in the drug-treated group showed a statistically significant decrease compared to the untreated model group (P < 0.05), the compound was considered a positive initial screening result indicating its potential to inhibit early muscle injury and improve GSD III myopathy.

[0094] 3. Rescreening and Multidimensional Comprehensive Evaluation Criteria: For compounds that initially showed positive results, the remaining live samples were cultured to 9 days post-flop (dpf) and retested using an automated zebrafish behavioral analysis system. The focus was on evaluating the recovery of spontaneous behavior (total movement distance, maximum movement speed) in juvenile fish after drug administration. Simultaneously, liver fluorescence area measurement at 8 dpf and whole-fish glucose content determination were combined to comprehensively evaluate the drug's precise efficacy in improving overall metabolic disorders and myopathy-related movement defects.

[0095] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A combination of sgRNAs for simultaneous targeted knockout of agla and a glb genes in zebrafish, characterized in that: The sgRNA combination includes a first and a second targeting sequence for the agla gene, and a third and a fourth targeting sequence for the aglb gene. The nucleotide sequence of the first target sequence is shown in SEQ ID NO. 1, the nucleotide sequence of the second target sequence is shown in SEQ ID NO. 2, the nucleotide sequence of the third target sequence is shown in SEQ ID NO. 3, and the nucleotide sequence of the fourth target sequence is shown in SEQ ID NO.

4.

2. A method for constructing a zebrafish F0 model of glycogen storage disease type 3, characterized by: Includes the following steps: The sgRNA combination described in claim 1 was mixed with Cas9 protein and injected into single-cell embryos of wild-type zebrafish to obtain an F0 generation zebrafish model with biallelic mutations.

3. The method of claim 2, wherein: The final concentration of the Cas9 protein is 200 ng / µL to 300 ng / µL, and the total final concentration of the sgRNA combination is 300 ng / µL to 400 ng / µL.

4. The method of claim 2, wherein: The final concentration of the Cas9 protein was 250 ng / µL, and the concentration of each individual sgRNA in the sgRNA combination was 90 ng / µL, with a total concentration of 360 ng / µL.

5. The method of claim 2, wherein: The injection volume for co-injection is 0.5 nL / embryo to 2 nL / embryo.

6. The method of construction according to claim 2, wherein: The total injection volume is 1 nL per embryo.

Images