Rape BnaC03g38070D gene and application thereof in promoting flowering of cruciferous plants

By screening the BnaC03g38070D gene from rapeseed using GWAS and expressing it heterologously in Arabidopsis thaliana, the problem of analyzing the flowering time of rapeseed was solved, enabling the regulation of the flowering period of cruciferous plants and promoting the breeding of short-growing rapeseed varieties.

CN122038457APending Publication Date: 2026-05-15OIL CROPS RES INST CHINESE ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
OIL CROPS RES INST CHINESE ACAD OF AGRI SCI
Filing Date
2026-03-05
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively analyze the genetic loci of rapeseed flowering time, which limits the breeding of short-growing rapeseed varieties. In particular, the direct application of Arabidopsis homologs in rapeseed is limited due to their high copy number and functional differentiation.

Method used

The BnaC03g38070D gene was screened in rapeseed using genome-wide association analysis (GWAS), and heterologously expressed in Arabidopsis thaliana. A recombinant expression vector was constructed to overexpress the gene, and Agrobacterium tumefaciens was used to infect the recipient plant to promote flowering.

Benefits of technology

The gene significantly advanced flowering and reduced leaf number in Arabidopsis thaliana, demonstrating that it can promote flowering in cruciferous plants and providing a resource for molecular breeding to regulate flowering time.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122038457A_ABST
    Figure CN122038457A_ABST
Patent Text Reader

Abstract

The invention discloses an oilseed rape BnaC03g38070D gene and an application of the oilseed rape BnaC03g38070D gene in promoting flowering of cruciferous plants. According to the invention, SNP markers of 326 rape populations are respectively used for GWAS analysis with flowering phenotypes under long-day and short-day conditions, a candidate gene BnaC03g38070D is screened at a C03 associated site, the coding region of the candidate gene BnaC03g38070D is mutated due to SNP variation (G is converted into C) in the coding region of the candidate gene BnaC03g38070D, the site is significantly associated with the flowering traits of the rape, and the gene BnaC03g38070D can be used for identifying the flowering traits of the rape. And the expression level of the gene is also highly related to the flowering traits of the rape. The BnaC03g38070D gene is heterologously expressed in arabidopsis thaliana, the flowering time of an obtained homozygous transgenic line is obviously earlier than that of a wild type, and the total number of leaves is obviously reduced, which indicates that the expression of the gene can promote the flowering of arabidopsis thaliana. Therefore, the gene can be applied to molecular breeding of the flowering period character of cruciferae and flowering period regulation and control.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant breeding, and particularly to rapeseed. BnaC03g38070D Genes and their application in promoting flowering in cruciferous plants. Background Technology

[0002] Single nucleotide polymorphisms (SNPs) are widely distributed in plant genomes, characterized by high density, large number, rich polymorphism, high stability and accuracy, and low mutation rate. With continuous innovation in sequencing technology and its decreasing cost, it has become possible to analyze the genetic factors of complex crop traits using genome-wide association studies (GWAS). SNP-GWAS is currently the most widely used method for detecting genetic variation and trait associations at the whole genome level. Rapeseed (Brassica napus) is the most widely planted oilseed crop in my country and the largest source of domestically produced edible vegetable oil. To maximize rapeseed production and address crop rotation issues, breeding short-growing-period rapeseed is a key research objective. Flowering time is closely related to the growth period; analyzing the genetic loci of rapeseed flowering time and identifying functional genes regulating flowering time provides resources for breeding short-growing-period rapeseed varieties. Flowering time is best understood in the known model plant Arabidopsis thaliana, and it can be divided into five signal regulation pathways: photoperiod pathway, vernalization pathway, autonomous pathway, gibberellin pathway, and aging pathway. Each flowering pathway has its own unique regulatory characteristics, which are both independent and overlapping, integrating various flowering signals into a complex flowering regulatory network. Integrating factors occupy key central positions, such as SOC1, LFY, and FT. They are the regulatory nodes and common target sites of different flowering pathways, thus responding to various external and internal factors in response to flowering signals. Arabidopsis thaliana and rapeseed are closely related, and early studies found that homologous genes of key flowering genes in Arabidopsis thaliana often have the same functions in rapeseed. However, further in-depth research revealed that due to the polyploid nature of rapeseed, Arabidopsis homologous genes have a high copy number in rapeseed, and these copies often exhibit functional differentiation (non-functional, subfunctional, and neofunctionalized), thus limiting the direct application of Arabidopsis flowering gene resources to rapeseed. Early population mapping identified genetic loci for rapeseed flowering time, but due to the large intervals, it was difficult to determine key candidate genes within these loci. Therefore, it is urgent to explore the major loci and genes regulating flowering time within rapeseed itself. Summary of the Invention

[0003] To address the shortcomings of existing technologies, this invention proposes a method using rapeseed... BnaC03g38070D Genes and their application in promoting flowering in cruciferous plants.

[0004] This invention provides rapeseed BnaC03g38070D The application of genes in promoting flowering in cruciferous plants, the aforementioned BnaC03g38070D The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0005] Furthermore, the cruciferous plant is any one of the following: Brassica napus, Arabidopsis thaliana, Capsella bursa-pastoris, Capsella bursa-pastoris, Brassica oleracea, or Rhizoma Scutellariae. The rapeseed discovered in this invention... BnaC03g38070D The gene’s genomic SNP variation is highly associated with rapeseed flowering at the population level, and the transcriptional level of the gene is also significantly associated with rapeseed flowering. Furthermore, heterologous expression of the gene in Arabidopsis thaliana can promote early flowering in Arabidopsis thaliana. Therefore, the gene has a flowering-promoting effect on all cruciferous plants.

[0006] Furthermore, when used to promote flowering in cruciferous plants, rapeseed... BnaC03g38070D Genes were linked into plant expression vectors to construct recombinant expression vectors. These vectors were then transformed into Brassicaceae plants (recipient plants) for rapeseed expression. BnaC03g38070D Overexpression of genes.

[0007] Furthermore, the vector used for overexpression was PGTV II-3FLAG.

[0008] Furthermore, the recombinant expression vector was transformed into Agrobacterium, and then the obtained recombinant Agrobacterium was used to infect the recipient plant.

[0009] This invention also provides a method for promoting early flowering of cruciferous plants, comprising the following steps: S1: Rapeseed BnaC03g38070D Genes were linked into plant expression vectors to construct recombinant expression vectors for overexpression of the target gene, including rapeseed. BnaC03g38070D The nucleotide sequence of the gene is shown in SEQ ID NO.1; S2: Transform the recombinant expression vector into cruciferous plants that serve as recipient plants.

[0010] Furthermore, the vector used for overexpression was PGTV II-3FLAG.

[0011] Furthermore, in step S2, the recombinant expression vector is transformed into Agrobacterium, and then the obtained recombinant Agrobacterium is used to infect the recipient plant.

[0012] This invention also provides information related to rapeseed flowering period. BnaC03g38070D Genes, the ones mentioned BnaC03g38070D The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0013] This invention also provides primers or probes for SNP molecular markers of major QTL sites for flowering period traits in Brassica napus, for the detection and / or prediction of flowering period in Brassica napus, or for the application of molecular marker-assisted breeding of Brassica napus. The major QTL site for the flowering period trait of Brassica napus is marked by an SNP at the 170th base of the nucleotide sequence shown in SEQ ID NO:1, where the 170th base is either G or C. When this site is C, the flowering period is shorter than when it is G.

[0014] In summary, compared with the prior art, the present invention achieves the following technical effects: This invention utilizes SNP markers from 326 rapeseed populations and performs GWAS analysis on the flowering phenotypes of the populations under long-day and short-day conditions, respectively, to screen a candidate gene at the CO3-associated locus. BnaC03g38070D A single SNP mutation (G to C) in its coding region caused a variation in the coding region, and this site was significantly associated with flowering traits in rapeseed. BnaC03g38070D Heterologous expression of the gene in Arabidopsis thaliana resulted in homozygous transgenic lines that flowered significantly earlier than the wild type and had a significantly reduced total number of leaves, indicating that gene expression can promote flowering in Arabidopsis thaliana. Therefore, this gene can be applied to molecular breeding and flowering time regulation in Brassicaceae plants. Attached Figure Description

[0015] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0016] Figure 1 This is the frequency distribution of flowering phenotypes in the GWAS population under long-day and short-day conditions in Example 4 of the present invention.

[0017] Figure 2 This is an example of constructing an evolutionary tree for the GWAS population based on SNPs in Embodiment 4 of the present invention.

[0018] Figure 3 These are the sites identified by GWAS under photoperiodic conditions in Example 5 of this invention that are significantly associated with rapeseed flowering time; a, c: Manhattan plots showing the association between flowering phenotypes and SNP markers under long-day and short-day conditions; b, d: QQ plots showing the association between flowering phenotypes and SNP markers under long-day and short-day conditions.

[0019] Figure 4 Candidate genes for the CO3 site in Examples 5 and 6 of this invention. BnaC03g38070 Screening and functional verification; a. Local Manhattan plot of GWAS loci on chromosome C03 identified under short-day conditions, one of which is significantly associated with SNP G→C (genomic location _23344351) leading to BnaC03g38070 Missense mutation; b, BnaC03g38070 Linkage maps of genomic regions (5kb upstream and downstream of genes), linkage strength (R) between SNPs. 2 Use different colors to identify; c, BnaC03g38070 Within a gene, SNPs represent haplotype allelic variations that divide a population; green arrows and red markers indicate SNPs associated with the trait; d, Analysis of flowering phenotypic differences among different haplotype materials under short-day conditions; e, BnaC03g38070 The correlation between expression and flowering time; f, in Arabidopsis thaliana BnaC03g380700 In overexpression transgenic lines BnaC03g38070 Relative expression level; g, BnaC03g38070 Identification of flowering phenotype in overexpression transgenic lines; h, BnaC03g38070 Statistical analysis of flowering phenotypes in overexpressing transgenic lines; i, BnaC03g38070 Statistics on the total number of leaves in overexpressing transgenic lines. Detailed Implementation

[0020] To enable those skilled in the art to better understand the present invention, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.

[0021] Transcriptional gene expression information, such as differences in gene expression between parents, information on gene expression regulatory loci (eQTL), and information on the correlation between gene expression and traits (Transcriptome-Wide Association Study, TWAS), can link genetic variations (SNPs), gene expression, and traits pairwise. Further integrating this information can assist in screening candidate genes for population mapping. Therefore, organically combining genetic mapping with multi-omics analysis and genetic validation is beneficial for efficiently screening optimal candidate genes and accelerating the improvement of rapeseed varieties based on flowering time / growth period.

[0022] Example 1: Identification of Time Patterns for Population Flowering The GWAS population used in this invention consisted of 326 rapeseed accessions collected globally, primarily including 219 spring varieties. These 326 natural rapeseed accessions were grown in a greenhouse using a randomized block design (three replicates per material, 30-45 individual plants per replicate). Flowering times were recorded under both long-day (16h light / 8h dark) and short-day (8h light / 16h dark) conditions, and the results are shown in Table 1. Flowering time was defined as the time from sowing to 50% of the plants in the plot opening their first flower. The 280 rapeseed accessions used for transcriptome association analysis were grown in Wuhan, Hubei Province in 2018, using the same block design. Flowering time was recorded as the time from sowing to 25% of the plants in the plot opening their first flower.

[0023] Table 1. Mean flowering phenotypes of 326 rapeseed materials under long-day and short-day conditions.

[0024] Example 2: Obtaining SNP genotypes in a population Leaves from 326 natural populations were used for RNA extraction and resequencing data. Resequencing was performed using the Illumina HiSeq XTen platform. The resulting data, after adapter removal, was aligned to the rapeseed reference genome (Darmor-) using BWA-MEM. bzh The sequencing depth was 4.69–12.19×, with an average depth of 7.63×. Then, the Sentieon DNAseq workflow and GATK were used to perform SNP genotyping and filtering on each material, resulting in 2,226,172 high-quality SNPs for GWAS analysis. Phylogenetic tree construction was performed using the Phylip software.

[0025] Example 3: GWAS and TWAS Analysis GWAS analysis was performed using EMMAX software. Population structure files calculated using admixture software and phylogenetic files calculated using emmax-kin were used as covariates in the GWAS analysis. A mixed linear model was selected, and the threshold was set to error rate (FDR) < 0.05. Manhattan plots, quantile plots, linkage disequilibrium heatmaps, and haplotype plots were generated using R packages. For the 280 materials used in transcriptome resequencing, shoot apical meristems were collected from each material 60 days after sowing and cryopreserved in liquid nitrogen for RNA extraction and sequencing. The sequencing platform and methods were the same as above. The obtained adapter-removed short sequences were aligned to the reference genome using HISAT2 software. After filtering, the 11 Gb high-quality aligned short sequences were used to calculate gene expression levels (FPKM) using StringTie, and then the expression of each gene was normalized using qqnorm in R software. Correlation analysis between gene expression levels and flowering traits was performed using EMMAX software.

[0026] Example 4: Phenotypic Variation and Population Structure Analysis of Natural Rapeseed Populations The GWAS population used in this invention was planted in a greenhouse under long-day and short-day conditions, and the flowering phenotypes were statistically analyzed. The results showed that the frequency distribution of rapeseed flowering traits followed an approximately normal distribution. Figure 1 This indicates that the flowering time of rapeseed is a quantitative trait controlled by multiple genes. Figure 1 Furthermore, the flowering time of the population varied significantly under different photoperiod conditions (Table 2): under long-day conditions, the flowering time was significantly shortened (30-101 days), with an average flowering time of 47 days; while under short-day conditions, the flowering time was significantly delayed (54-131 days), with an average flowering time of 126 days.

[0027] Table 2. Analysis of flowering phenotypic variation in the population

[0028] To obtain the SNP molecular markers of this population, this invention utilizes next-generation sequencing. Resequencing was performed on 326 reads from the population. The filtered high-quality reads were then aligned to the rapeseed reference genome (…). Darmor-bzh Afterwards, a total of 8,789,769 high-quality SNP molecular markers were obtained. Phylogenetic trees were constructed using these SNPs, and the results showed that materials from different sources and strains clustered into different subgroups: 219 spring-type materials from Australia clustered into subgroup I, while materials from Europe, Asia, and other regions clustered into subgroups (II-IV). Figure 2 ).

[0029] Example 5: Identification of major genetic loci and screening and verification of candidate genes for rapeseed flowering time This invention utilizes population SNP markers to perform GWAS analysis on flowering phenotypes under long-day and short-day conditions, respectively. Figure 3 Loci significantly associated with traits identified under long-day conditions were more dispersed, while those associated under short-day conditions were more concentrated. Figure 3 Furthermore, a stable site (chrC03:23127225-23560881) was identified under short-day conditions, supported by multiple significant SNPs. Figure 3 (and Table 3).

[0030] Table 3. SNP sites significantly associated with rapeseed flowering time identified by SNP-GWAS under photoperiodic conditions.

[0031] To further screen potential candidate genes at the C03 site, firstly, candidate genes were narrowed down at the genomic level: (1) the physical extent of candidate genes in the genome was defined by linkage intervals of the site; (2) candidate genes with functional variations were screened based on genomic annotation; (3) haplotype classification was performed using SNP molecular markers in the coding regions of candidate genes to assess the differences in flowering phenotypes among different haplotypes. Secondly, candidate genes were further screened using transcriptome data: (1) based on transcriptome data from 280 rapeseed interstem meristems and field flowering phenotype data, this invention identified genes (TWAS) that significantly correlated with the expression level of regulatory genes and flowering traits.

[0032] A candidate gene was screened at the C03 associated site. BnaC03g38070D Its functional annotation is a disease resistance response gene. A SNP variation in its coding region (the G at position 170 is changed to C, see the underlined position in the sequence listing) causes a variation in its coding region, and this site is significantly associated with rapeseed flowering traits. Figure 4 (a, b); This SNP locus divided the population materials into two haplotypes. The 21 materials in haplotype I (base C at position 170) had an average flowering time of 113.6 days, while the 242 materials in haplotype II (base G at position 170) had an average flowering time of 126.5 days. The difference was statistically significant (two-tailed t-test). P =0.008)( Figure 4 c, d and Table 4); at the same time BnaC03g38070D Gene expression levels are significantly correlated with rapeseed flowering time. Figure 4 e).

[0033] Table 4. BnaC03g38070DHaplotype analysis of population segmentation using gene SNPs

[0034] Example 6: Functional validation of the candidate genes obtained from screening in Arabidopsis thaliana through heterologous expression. candidate genes BnaC03g38070D The coding region sequence (the sequence shown in SEQ ID NO.1) was amplified from the double 11 material using primer pairs F-ATGGCAAACCTCATCCTCAT, R-TCAATAATGCAAGACGTAAC and ligated into the pMT-19T vector for sequencing; clones with complete sequences and no base errors were ligated into the pMT-19T vector via homologous recombination. Kpn I and Sal I The expression vector PGTV II-3FLAG, after enzyme digestion, formed an expression vector carrying the target gene. The recombinant expression vector was transformed into Agrobacterium strain GV3101 using electroporation, and then Arabidopsis thaliana was transformed using the flower-drop method. After identifying homozygous T2 transgenic lines, RNA was extracted from leaves and reverse transcribed into cDNA as a template. The target gene was then detected by quantitative real-time fluorescence detection. BnaC03g38070D The expression level was determined using primer pairs F-CTCACTTTCTTCCGTGTCTACT and R-CGAGATCGTACTCCCGTTATAC. The Arabidopsis actin gene (AT3G17870) was used as an internal control, with quantitative primers F-CCCGCTATGTATGTCGCCA and R-AACCCTCGTAGATTGGCACA. Quantitative fluorescence experiments included three biological replicates and three technical replicates. The flowering time typology of the transgenic lines was determined by counting the flowering time (from sowing to the opening of the first flower) and the total number of leaves after flowering (the total number of whorled and stem leaves after the opening of the first flower) for each plant. Statistical analysis of the experimental data was performed using the Student's... (a function in SAS software). t -test.

[0035] From China's Double 11 BnaC03g38070D Heterologous expression of the gene in Arabidopsis thaliana resulted in two homozygous transgenic lines that, compared to the wild type, flowered 3-5 days earlier and had 3-5 fewer leaves. Statistical analysis showed these differences to be highly significant, indicating that gene expression can promote flowering in Arabidopsis thaliana. Figure 4 fi; Table 5).

[0036] Table 5. Overexpression BnaC03g38070D Flowering phenotype identification of transgenic Arabidopsis thaliana lines

[0037] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

[0038] sequence list SEQ ID NO.1 ( BnaC03g38070D (nucleotide sequence) ATGGCAAACCTCATCCTCATCATCACCTCCCATATCCTCCTTCTCGCAGCTATTGTCTCCGCCGGAAAGGGTGAAAACTTTGCAAAAAACATTAACCGGAAACACTTCGGGCTCCGTAAAGAGAAACTCACTTTCTTCCGTGTCTACTGGCACGACATTCAAAGCGGCA G AGACCCTAGCTCGGTCGTGCTCAGACCTCCTCTCCAACTCCTCTTTCTTCGGAGCAGTCACTATGATCGATAACCGTTTAACTACGGAGGTCTCGGTTAACTCGACTTTGGTAGGCCAGGCTCAAGGGATGTACGCTGGTGCGGGCCAACACGATGCGTCTGCGCTTATGGTGATGAACTTCGCGTTCAAGACA GGTAAGTATAACGGGAGTACGATCTCGATTCTTGGTCGAAACGCGGTGATGACTAAGGTTAGGGAGATGCCGGTGATTGGAGGAAGTGGACTGTTCCGGTTCGCTAGAGGTTATGTCGAGGCTAGAACTAAGTGGTTGAATGTAAAGACAGGAGATGCTACTGTTGAGTACAGCTGTTACGTCTTGCATTATTGA.

Claims

1. Rapeseed BnaC03g38070D The application of genes in promoting flowering in cruciferous plants is characterized by, The BnaA03g38070 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The cruciferous plants mentioned are any one of the following: Brassica napus, Arabidopsis thaliana, Capsella bursa-pastoris, Capsella bursa-pastoris, Brassica oleracea, or Rhizoma Scutellariae.

3. The application according to claim 1, characterized in that, When used to promote flowering in cruciferous plants, rapeseed... BnaC03g38070D Genes were linked into plant expression vectors to construct recombinant expression vectors. These vectors were then transformed into Brassicaceae plants (recipient plants) for rapeseed cultivation. BnaC03g38070D Overexpression of genes.

4. The application according to claim 3, characterized in that, The vector used for overexpression was PGTV II-3FLAG.

5. The application according to claim 3, characterized in that, The recombinant expression vector was transformed into Agrobacterium, and then the resulting recombinant Agrobacterium was used to infect the recipient plant.

6. A method for promoting early flowering of cruciferous plants, characterized in that, Includes the following steps: S1: Rapeseed BnaC03g38070D Genes were linked into plant expression vectors to construct recombinant expression vectors for overexpression of the target gene, including rapeseed. BnaC03g38070D The nucleotide sequence of the gene is shown in SEQ ID NO.1; S2: Transform the recombinant expression vector into cruciferous plants that serve as recipient plants.

7. The application according to claim 6, characterized in that, The vector used for overexpression was PGTV II-3FLAG.

8. The method according to claim 6, characterized in that, In step S2, the recombinant expression vector is transformed into Agrobacterium, and then the obtained recombinant Agrobacterium is used to infect the recipient plant.

9. Related to rapeseed flowering period BnaC03g38070D Genes, characterized by, The BnaC03g38070D The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

10. The application of primers or probes for SNP molecular markers of major QTL sites for flowering period traits in Brassica napus in detecting and / or predicting flowering period of Brassica napus, or in marker-assisted breeding of Brassica napus, characterized in that... The major QTL site for the flowering period trait of Brassica napus is marked by an SNP at the 170th base of the nucleotide sequence shown in SEQ ID NO:1, where the 170th base is either G or C. When this site is C, the flowering period is shorter than when it is G.