Application of NtGLK1 gene in cold resistance of tobacco

Abstract

The invention discloses application of an NtGLK1 gene in cold resistance of tobacco, and belongs to the technical field of molecular biology. According to the application of the NtGLK1 gene disclosed by the invention in the cold resistance of the tobacco, the sequence of the NtGLK1 gene is as shown in SEQ ID NO. 1. The NtGLK1 gene positively regulates and controls the cold resistance of the tobacco, and gene resources and breeding materials are provided for cultivating new low-temperature-resistant varieties of the tobacco through excavation and functional identification of the gene.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and more specifically to... NtGLK1 Application of genes in tobacco cold tolerance. Background Technology

[0002] tobacco( Nicotiana tabacum L. As an important economic crop originating in tropical and subtropical regions, tobacco is highly sensitive to water and soil conditions. Its optimal growth temperature is 25℃~28℃. Low-temperature stress restricts tobacco growth, reduces its quality and yield, and temperatures as low as -2℃ to -3℃ can lead to the death of tobacco plants. Given the uncertainties brought about by global climate change, breeding highly cold-resistant tobacco varieties is of great significance. Currently, identifying key functional genes and improving new varieties through molecular breeding techniques such as molecular marker-assisted selection or gene editing is an effective and feasible approach.

[0003] The plant GLK gene, full name GOLDEN2-LIKE Its name originates from corn ( Zea mays Leaf color mutant golden2 This research focuses on the protein encoded by this gene, which belongs to the GARP superfamily, a plant-specific transcription factor superfamily. This gene can target and regulate the expression of photosynthesis-related genes, regulate chloroplast development, and participate in regulating nutrient accumulation in fruits, leaf senescence, immune responses, and abiotic stress responses. Although the GLK gene family has a small number of members in the plant genome, its highly conserved function suggests its fundamental role in plant life activities. This conservation is evident in plants ranging from mosses to rice and peanuts, where GLK plays a central role in regulating chloroplast development and serves as a key integrative hub for plant responses to various abiotic stresses and for maintaining plant survival and growth.

[0004] Studies have found that overexpression SIGLK1 or SIGLK2 This gene can significantly increase the number and size of chloroplasts in tomato fruits, enhance the accumulation of photosynthetic products such as starch and sugars, and provide more precursors for carotenoid synthesis, indicating that this gene affects the nutrition and quality of the fruit. Studies have found that in Arabidopsis thaliana... atglk1 / atglk2 The double mutant exhibits premature leaf senescence, while overexpression in the double mutant... AtGLK1 / AtGLK2 This can complement its premature aging phenotype, suggesting that GLK1 may resist the aging process by maintaining chloroplast function and photosynthetic activity. Furthermore, GLK1 plays a positive role in plant stress resistance; sustained expression of maize GLK in rice can improve stomatal conductivity and photosynthetic efficiency under field conditions, thereby enhancing the drought resistance of rice.

[0005] Therefore, providing NtGLK1The application of genes in tobacco cold tolerance is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0006] In view of this, the present invention provides NtGLK1 Application of genes in tobacco cold tolerance.

[0007] In the early stages of this invention, a comprehensive physiological, biochemical, transcriptomic, and metabolomic analysis was conducted on the low-temperature resistant variety Xiangyan 7, from which a candidate gene significantly responding to low-temperature stress was identified. NtGLK1 Based on this, the present invention conducted functional identification of the gene in order to elucidate its function and thus provide gene resources and theoretical basis for molecular breeding of tobacco with low temperature tolerance.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] NtGLK1 The application of genes in tobacco cold tolerance, the aforementioned NtGLK1 The gene sequence is shown in SEQ ID NO.1.

[0010] Furthermore, knockout NtGLK1 The application of the gene in the negative regulation of cold tolerance in tobacco, the NtGLK1 The gene sequence is shown in SEQ ID NO.1.

[0011] Furthermore, knockout NtGLK1 The application of gene-expressing biomaterials in the negative regulation of cold tolerance in tobacco, NtGLK1 The gene sequence is shown in SEQ ID NO.1; The biomaterial is any one of the following: A: Enables nucleotide sequences as shown in SEQ ID NO.1 NtGLK1 Gene silencing expression cassettes; B: A recombinant vector containing the expression cassette described in A; C: Recombinant microorganisms containing the expression cassette described in A or the recombinant vector described in B.

[0012] further, NtGLK1 The application of genes in tobacco breeding, the aforementioned NtGLK1 The gene sequence is shown in SEQ ID NO.1.

[0013] further, NtGLK1 The application of genes in the breeding of cold-resistant tobacco germplasm, the aforementioned NtGLK1 The gene sequence is shown in SEQ ID NO.1.

[0014] As can be seen from the above technical solutions, compared with the prior art, the present invention discloses... NtGLK1The application of genes in tobacco cold tolerance was based on previous multi-omics analysis, which identified a gene significantly induced by low temperature. The study found that this gene has a CDS sequence length of 1086 bp, encoding 361 amino acids, and encodes a GLK-like transcription factor; therefore, it was named... NtGLK1 Using Xiangyan 7 as a background, knockout lines glk1-crispr-3 (KO#3) and glk1-crispr-12 (KO#12) of this gene were obtained using CRISPR technology. Phenotypic identification results showed that under low-temperature stress, the two knockout lines exhibited more severe wilting compared to Xiangyan 7 (WT). Biochemical results showed that under low-temperature stress, the EL and MDA levels of the two knockout lines were significantly higher than those of WT, while the OJIP curve and Fv / Fm value were significantly lower than those of WT. NtDREB1A , NtDREB1B.1 , NtDREB1B.2 , NtDREB1D The expression levels of these genes were significantly lower than those of WT. This result indicates that... NtGLK1 The gene positively regulates the cold tolerance of tobacco. The discovery and functional identification of this gene provides genetic resources and breeding materials for the cultivation of new tobacco varieties with low temperature tolerance. Attached Figure Description

[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0016] Figure 1 for NtGLK1 Phylogenetic tree analysis; where, (Nt)Nicotiana tabacum; (Nto)Nicotianatomentosiformis; (Na)Nicotiana attenuata; (Ns)Nicotiana sylvestris; (Lb)Lyciumbarbarum; (Ca)Capsicum annuum; (Rc)Ricinus communis.

[0017] Figure 2 for NtGLK1 Protein sequence homology alignment analysis.

[0018] Figure 3 For sequence alignment and peak diagram analysis near the target site.

[0019] Figure 4 To compare the NtGLK1 protein sequence in the knockout line and WT.

[0020] Figure 5 Phenotypic analysis of plants after 7 days of treatment at normal temperature (25℃) and low temperature (4℃). The three plants in each pot are: WT at the top, KO#3 at the bottom left, and KO#12 at the bottom right.

[0021] Figure 6 Analysis of changes in MDA and EL values ​​at normal and low temperatures.

[0022] Figure 7 Analysis of OJIP curves and Fv / Fm ratio changes after normal and low temperatures.

[0023] Figure 8 Within 1 hour before and after the low-temperature treatment, NtDREB1A , NtDREB1B.1 , NtDREB1B.2 , NtDREB1D Gene expression level analysis. Detailed Implementation

[0024] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0025] NtGLK1 The CDS sequence is shown in SEQ ID NO.1.

[0026] ATGCTTACTGTATCACCTTTGAGCTACAAAATCACCAAAAATGACATGGAAAGTTTCACGATTCGAGGAATCGATGATTTTCCAGAGTTTTGGTGATGGGAATTTGCTCGAAAGCATTGATTTTGATGACATTTTCTTGGGGATCAACGTCGTCAACGATGATGAATTACCAGATTTGGAGATGGACTCAGAGATTCTTGCTGAATTCTCAGTTAGTAGTGGCGACGAATCTGATCATATGAATATTTATAATACTACACCACCATTCCACGTAGAAGAAAACAACTCTTTCAGAAAAGAAGTGGTGGAAAAAATACCATCAGATTTGAATCAGAAGAGCGAAAAATCTAAACCCAAGTCAAAGGAAAATGATAAGTGCAAGAAATCAACGGGGCAATCCAAAAATCCAGAAGGGAAGAGAAAAGTGAAGAAATATAGAGCCCATCGGAAACATTTTCTTTGCGAGAGAAGCGGAGGCGGAAATCTGGAGCCAAAGAAAACAAATG TACGGCGGTGCAGTCGTCGT TGG AGGTGGCGGAAATAGAGAGATAAA CCCATGGACGGCAGCATCACCAACCATGGGTTTTCCACCTATGACGGCACCACCAATGGTGCCGCCTCATTTTAGACCTCTACACGTCTGGGGTCATCCACCCACCGATCAATCTATGATGCACATGTGGCCGAAACATATAACGCCTCTCCCACCAGCATGGGCATCGGTTGTTCCTCCTCATTCTTCACCACCTATAGATCCTTCCTTTTGGCATTCACACCATCAAAGATTACTAAACTCTCTTGCACCAGGCACTCCTTGCTTTCCTTCACCAATAGCGCCCACGAGATTTCCAGTTTCGGGCATCCCATCCCCTGCCATGATCAAAGTTGTCCCCACCGGAGCACGACAAGATCTGCCTAAACCTCCTCCTAATTTTCATCCCTCAAAGGAGAGCATAGATGCGGCCATTGGAGATGTTTTAGCAAAGCCATGTCTGCCACCATTTCCCCTCGGACTCAAACCTCCCTCAATTGACAGTGTGTTGAATGAATTGCAACGCCAAGGGATTAATAAAATACCTCCAACTTAA;SEQ ID NO.1。

[0027] NtGLK1 The protein sequence is shown in SEQ ID NO.2.

[0028] MLTVSPLSYKITKNDMESFTIRGIDDFPEFGDGNLLESIDFDDIFLGINVVNDDELPDLEMDSEILAEFSVSSGDESDHMNIYNTTPPFHVEENNSFRKEVVEKIPSDLNQKSEKSKPKSKENDKCKKSTGQSKNPEGKRKVKKYRAHRKHFLAREAEAEIWSQRKQMYGGAVVVGGGGNREINPWTAASPTMGFPPMTAPPMVPPHFRPLHVWGHPPTDQSMMHMWPKHITPLPPAWASVVPPHSSPPIDPSFWHSHHQRLLNSLAPGTPCFPSPIAPTRFPVSGIPSPAMIKVVPTGARQDLPKPPPNFHPSKESIDAAIGDVLAKPCLPPFPLGLKPPSIDSVLNELQRQGINKIPPT;SEQ IDNO.2。

[0029] Example 1: Gene Sequence Feature Analysis The NtGLK1 protein sequence involved in this invention (as shown in SEQ ID NO.2) was obtained from the National Center for Biotechnology Information website (http: / / www.ncbi.nlm.nih.gov / BLAST / ). Gene homology was analyzed using MEGA11.0 software and a phylogenetic tree was constructed using the neighbor-to-neighbor merging (NJ) method. Protein similarity was compared using DNAMAN software.

[0030] Phylogenetic analysis revealed that... NtGLK1 With fluffy tobacco NtoGLK1-like (XM009591305.4) Closest kinship ( Figure 1 Homology analysis of the protein sequence revealed that the protein sequence possesses a typical Myb-DBD domain and is similar to that of *Nicotiana flavescens*. NtoGLK1 Forest tobacco NsGLK1 Narrow-leaved tobacco NaGLK1 High homology ( Figure 2 ).

[0031] Example 2: Construction of gene editing vector (1) Target design Using the online analysis tool at http: / / crispor.tefor.net / , targets were designed on gene exons, and the following two specific targets were obtained through analysis: Target1: TACGGCGGTGCAGTCGTCGTTGG; SEQ ID NO.3.

[0032] Target2:TTGGGTGATGCTGCCGTCCATGGG; SEQ ID NO.4.

[0033] Then, primers for the CRSIPR vector were designed, and their sequence information is as follows: F1(+): cagtGGTCTCatgca tacggcggtgcagtcgtcgt ;SEQ ID NO.5.

[0034] R1(-): cagtGGTCTCaaaac atggacggcagcatcaccaa ; SEQ ID NO.6.

[0035] (2) PCR amplification Total RNA was extracted from Xiangyan No. 7 using the FastPure Universal PlaNt Total RNA Isolation Kit (Novozymes, catalog number: RC411-01), following the instructions in the user manual. cDNA (Novozymes, catalog number: R312-02) was synthesized using the HiScriptIII 1st Strand cDNA Sylation Kit (+gDNA wiper), following the instructions in the user manual.

[0036] PCR system: Nuclease-free Water 20μL; Biorun Pfu PCR Mix 25μL; F1(+) 2μL; R1(-) 2μL; cDNA 1μL; Totalvolum 50μL.

[0037] PCR program: 94℃ for 5 min; 94℃ for 30 sec, 50℃ for 45 sec, 72℃ for 12 sec, 30 cycles; 72℃ for 10 min; 16℃ for 30 min.

[0038] The target fragment (approximately 200 bp) was recovered by gel extraction. The recovered DNA was dissolved in 30 μL of water. After verification, it was ligated into the vector.

[0039] (3) Enzyme digestion and ligation Enzyme digestion and ligation system: Nuclease-free Water 8 μL; 10 Buffer 2μL; BsaI / Eco31I 1μL; T4_ligase 1μL; pHSbdcas9i 4μL; recovered DNA 4μL; total 20μL.

[0040] Enzyme digestion and ligation reaction conditions: 37℃ for 20 min; 37℃ for 10 min, 20℃ for 10 min, 5 cycles; 37℃ for 20 min; 80℃ for 5 min.

[0041] (4) Transformation and identification Transform 5-10 μL of the ligation product into competent E. coli cells, following the instructions (Fast-T1 chemocompetent cells, Novizan, catalog number: C505-03). Plate the transformed cells onto 50 µg / mL kanamycin-resistant LB agar plates and incubate at 37°C for 12 hours. Perform colony PCR identification.

[0042] Primer information is as follows: F2: gtaaaacgacggccagt; SEQ ID NO.7.

[0043] R2: ccagaaattgaacgccgaag; SEQ ID NO. 8.

[0044] Ten single colonies were selected for PCR identification. The colony PCR reaction system was as follows: Nuclease-free Water 9.5 μL; Biorun Magic PCR Mix 12.5 μL; F2 1 μL; R2 1 μL; bacterial suspension 1 μL; Total volume 25 μL.

[0045] PCR reaction program: 94℃ for 5 min; 94℃ for 30 sec, 50℃ for 45 sec, 72℃ for 12 sec, 30 cycles; 72℃ for 10 min; 16℃ for 30 min.

[0046] The target band is a fragment of approximately 800bp.

[0047] Select bacterial suspensions corresponding to 1-3 positive bands, take 100μL for sequencing, and inoculate the remaining 400μL of bacterial suspensions into 5-10ml of kanamycin-resistant LB. Shake the test tubes and wait for the sequencing results. Take the tube with the correct sequencing results to extract the plasmid. After extracting the plasmid, preserve the bacterial strain and plasmid.

[0048] Example 3: Genetic transformation of tobacco (1) Preparation of Agrobacterium Add 1 µL of plasmid to 50 µL of GV3101 Agrobacterium competent cells (refer to the manufacturer's instructions for specific methods). Transform and plate onto LB agar plates containing 50 µg / mL kanamycin resistance, incubate at 28 ℃ for 48 h, and perform colony PCR identification. The amplification primers, reaction system, and reaction procedure are the same as above. Detect the PCR products by gel electrophoresis. If the electrophoretic bands of the positive control (using the correctly sequenced plasmid as a template) and the sample are clear and of the correct size, and the negative control (using water as a template) shows no band, it indicates that the sample can proceed to the next step and can be used to infect tobacco.

[0049] Single colonies were selected and cultured in liquid LB medium containing 25 µg / mL rifampicin and 100 µg / mL kanamycin (Km), and incubated at 28°C for 24 h. The culture was then centrifuged at 4000 r / min for 10 min, the supernatant was discarded, and the culture was resuspended in a humidifying buffer (containing 10 mM MgCl2, pH=5.2, 10 mM 2-(N-morpholine)ethanesulfonic acid (MES), and 0.1 mM acetylsylphenone), and incubated at room temperature for at least 3 h until OD500 reached. 600 The value is approximately 0.6, which is used as a disinfectant.

[0050] (2) Genetic transformation of tobacco Plump and uniform "Xiangyan No. 7" tobacco seeds were disinfected with 10% sodium hypochlorite solution for 15 min, rinsed 5 times with sterile water, and slightly dried with sterile absorbent paper. Four seeds per bottle were sown on MS medium containing 30 g / L sucrose and 8 g / L agar (pH=5.8). The incubator was placed at 25℃ under constant light and temperature conditions of 1600 lx light intensity and a photoperiod of 16 h (light) / 8 h (dark) for 45 days. After the sterile seedlings had developed 4 leaves, they were cut into small pieces of approximately 5 mm x 5 mm, and the veins were removed. After pre-culturing on MS medium containing 2 mg / L 6-BA and 0.2 mg / L IAA for 2 days, the explants were soaked in Agrobacterium infection solution. The infected explants were then cultured in the dark on MS medium containing 2 mg / L 6-BA and 0.2 mg / L IAA for 2 days. After co-culturing, 50 mg / L kanamycin and 500 mg / L carbenicillin were added to the culture medium for selection to induce the production of resistant callus. The culture conditions were the same as above, and subcultures were performed every 14 days. When the resistant shoots on the callus grew to 2 cm, the shoots were transferred to rooting medium (MS + 50 mg / L kanamycin + 500 mg / L carbenicillin + 0.2 mg / L IAA). Rooting occurred in about 7 days. When the seedlings grew to about 6 cm, the mouths of the culture bottles were opened for hardening off for 2 days. Then, the seedlings were transplanted into tobacco-specific substrate (Hunan Tianliang Agricultural Technology Development Co., Ltd.) that had been sterilized at high temperature, covered with plastic film to retain moisture, and cultured under light at 25-27℃.

[0051] Example 4: Sequencing Analysis of Positive Seedlings Genomic DNA was extracted from the leaves of positive seedlings using the FastPure® Plant DNA Isolation Mini Kit (catalog number: DC104-01) from Nanjing Novizan Biotechnology Co., Ltd. Detailed instructions were provided in the product manual. The knockout material was amplified by PCR using PrimeSTAR Max DNAPolymerase, a high-fidelity enzyme from Bio-Tech (Beijing) Co., Ltd.

[0052] Primer sequence information is as follows: NtGLK1-crispr-F1: CCGTTAGCTCATGCAAGTATC; SEQ ID NO.9.

[0053] NtGLK1-crispr-R1: CTCTTTGATGGTGTGAATGCC; SEQ ID NO. 10.

[0054] PCR amplification system: PrimeSTAR Max Premix (2X) 25 μL; upstream primer (10 µM) 1 μL; downstream primer (10 µM) 1 μL; template DNA 3 μL; ddH2O 20 μL; Total 50 μL.

[0055] PCR reaction program: 98℃ for 3 min; 98℃ for 10 sec, 55℃ for 15 sec, 72℃ for 60 sec, 36 cycles; 72℃ for 5 min.

[0056] The target fragment was 503 bp in length. The obtained PCR products were sequenced, and the sequencing peaks and sequence alignment were analyzed using SnapGene Viewer and DNAMAN, respectively.

[0057] NtGLK1 Screening results of homozygous knockout lines: Sequencing analysis of 15 positive seedlings revealed two successfully edited lines, glk1-3 (KO#3) and glk1-12 (KO#12). Furthermore, both KO#3 and KO#12 showed a single base insertion at target site 2, with clean single peaks near the target site, indicating that these two lines are homozygous mutants. Figure 3 Protein sequence alignment revealed that in the KO#3 and KO#12 strains... NtGLK1 Premature termination of protein translation ( Figure 4 This indicates that in these two strains NtGLK1 Gene function is disrupted.

[0058] Example 5: Identification of Low Temperature Tolerance in Knockout Lines Seeds from transgenic pure-line plants and wild-type plants with plump and uniform grain size were selected, sterilized, and then subjected to low-temperature treatment at 4 ℃ for 48 h. They were then sown in small square boxes pre-filled with tobacco-specific organic matter and fully absorbent, covered to maintain warmth and humidity, and incubated in a greenhouse (temperature 25℃, humidity 75%, 16 h light, 8 h darkness) for germination. Two weeks after sowing, seedlings with uniform growth were selected and placed in a 4 ℃ incubator for low-temperature treatment. Phenotypic observation and photographic recording were conducted. The 25 ℃ treatment served as the control (CK).

[0059] like Figure 5 As shown, after 7 days of low-temperature treatment, the two knockout lines KO#3 and KO#12 exhibited complete plant death and wilting, while the WT plants showed partial leaf wilting but the plants as a whole remained alive. This result indicates that the cold tolerance of the KO#3 and KO#12 lines was significantly reduced compared to the WT lines.

[0060] On day 7, the third leaf (counting from the top down) was taken as a plant sample for physiological and biochemical analysis, with five biological replicates for each treatment. After sampling, the samples were quickly wrapped in aluminum foil and placed in liquid nitrogen for storage at -80°C.

[0061] Example 6: Determination of physiological and biochemical indicators of knockout strains Malondialdehyde (MDA) content was determined using a plant-based MDA test kit (Nanjing Jiancheng, catalog number: A003-3-1); specific method: refer to the kit instructions. Relative conductivity: 0.2 g of fresh tissue leaf was taken from the fourth true leaf of the seedling (counting from the top leaf downwards) using a round punch, placed in a centrifuge tube containing 25 ml of ddH2O, and treated on a shaker at 37 ℃ for 24 h. The conductivity value L1 of the first extravasation was measured. The EP tube was then placed in an autoclave at 120 ℃ for 15 minutes. After cooling to room temperature, the conductivity value L2 of the second extravasation was measured. The relative conductivity EL was calculated as EL = L1 / L2. 100%.

[0062] Physiological and biochemical results showed that, under control conditions, the MDA content and relative conductivity of the knockout lines KO#3 and KO#12 were not significantly different from those of the WT line. However, after low-temperature stress treatment, the MDA content and relative conductivity of the knockout lines were significantly higher than those of the WT line. Figure 6 ).

[0063] Photosynthetic parameters were measured in eight biological replicates for each treatment. Chlorophyll fluorescence kinetics were primarily determined using a portable modulated chlorophyll fluorometer (PAM-2500, Germany). The procedure was as follows: the leaf was clamped with a dark-adaptation leaf clip, a metal plate was inserted, and the sample was dark-adapted for 30 min. Then, an optical fiber was inserted into the dark-adaptation clip, the metal plate was pulled out, and the data were immediately measured and recorded. Detailed data analysis of the fluorescence kinetics curves was based on Yusuf et al., 2010.

[0064] Under normal growth conditions, there were no significant differences in OJIP curves and Fv / Fm values ​​between the WT and knockout lines. After low-temperature treatment, the OJIP curves and Fv / Fm values ​​of the knockout lines were lower than those of the WT lines. Figure 7 ).

[0065] Example 7 Gene Expression Analysis To further verify NtGLK1 The function of tobacco in responding to low temperature stress was investigated. NtDREB1A , NtDREB1B.1 , NtDREB1B.2 , NtDREB1D Gene expression levels.

[0066] Detection NtDREB1A , NtDREB1B.1 , NtDREB1B.2 , NtDREB1D Gene expression levels: WT, KO#3, and KO#12 seedlings subjected to low-temperature stress for 0 h and 1 h were collected, RNA was extracted and reverse transcribed into cDNA, and the expression levels were detected using real-time quantitative PCR. NtDREB1A , NtDREB1B.1 , NtDREB1B.2 , NtDREB1D The expression levels of genes such as [missing information].

[0067] (1) RNA extraction This experiment mainly used the FastPure Universal PlaNt Total RNA Isolation Kit to extract total RNA from plants (Novozymes, catalog number: RC411-01). The specific steps were as described in the instruction manual.

[0068] (2) Reverse transcription This experiment used the HiScript III 1st Strand cDNA SyNthesis Kit (+gDNAwiper) to synthesize cDNA (Novozymes, catalog number: R312-02). The specific steps were described in the instruction manual.

[0069] (3) Primer information The following internal control and target gene fluorescence quantitative primers were synthesized: NtACTIN-q-F1: CCACACTGGTGTTATGGTTG; SEQ ID NO. 11.

[0070] NtACTIN-q-R1:AATACCGTGCTCAATTGGG; SEQ ID NO. 12.

[0071] NtDREB1A-q-F1: AGGGGAGTGAGGAAGAGGAA; SEQ ID NO. 13.

[0072] NtDREB1A-q-R1: GGCAACTTCCAAGCAGAGTC; SEQ ID NO. 14.

[0073] NtDREB1B.1-q-F1: AGGGGAGTGAGGAAGAGGAA; SEQ ID NO. 15.

[0074] NtDREB1B.1-q-R1: GGCAACTTCCAAGCAGAGTC; SEQ ID NO. 16.

[0075] NtDREB1B.2-q-F1:TTTTACTCGGACCCACTTGC; SEQ ID NO. 17.

[0076] NtDREB1B.2-q-R1: CGCTTCTTGGGGTTATTTGA; SEQ ID NO. 18.

[0077] NtDREB1D-q-F1: AGGGGAGTGAGGAAGAGGAA; SEQ ID NO. 19.

[0078] NtDREB1D-q-R1: GGCAACTTCCAAGCAGAGTC; SEQ ID NO. 20.

[0079] (4) Real-time quantitative PCR Real-time quantitative PCR (Thermo Fisher Scientific kit, catalog number: A25742) reaction system: 2×SYBGreen Mixture (Thermo Fisher) 5 μL; upstream primer (10 µM) 0.2 μL; downstream primer (10 µM) 0.2 μL; cDNA 1 μL; ddH2O 3.6 μL; Total 10 μL. Real-time quantitative PCR reaction program: 95℃ for 30 sec; 95℃ for 5 sec, 56℃ for 30 sec, 40 cycles; 95℃ for 15 sec, 30 cycles; 60℃ for 1 min; 95℃ for 15 sec. NtACTIN was used as an internal control.

[0080] See results Figure 8 During low-temperature treatment for 0h and 1h, the knockout of strains KO#3 and KO#12 was performed. NtDREB1A , NtDREB1B.1 , NtDREB1B.2 , NtDREB1D The expression levels were all lower than WT.

[0081] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. NtGLK1 The application of genes in tobacco cold tolerance is characterized by, The NtGLK1 The gene sequence is shown in SEQ ID NO.

1.

2. Knockout NtGLK1 The application of genes in the negative regulation of cold tolerance in tobacco is characterized by, The NtGLK1 The gene sequence is shown in SEQ ID NO.

1.

3. Knockout NtGLK1 The application of gene-expressing biomaterials in the negative regulation of cold tolerance in tobacco is characterized by, The NtGLK1 The gene sequence is shown in SEQ ID NO.1; The biomaterial is any one of the following: A: Enables nucleotide sequences as shown in SEQ ID NO.1 NtGLK1 Gene silencing expression cassettes; B: A recombinant vector containing the expression cassette described in A; C: Recombinant microorganisms containing the expression cassette described in A or the recombinant vector described in B.

4. NtGLK1 The application of genes in tobacco breeding is characterized by, The NtGLK1 The gene sequence is shown in SEQ ID NO.

1.

5. NtGLK1 The application of genes in the breeding of cold-resistant tobacco germplasm is characterized by, The NtGLK1 The gene sequence is shown in SEQ ID NO.1.

Images