Method for fixing heterosis of rice by using osmpf gene
By combining the OsMPF gene with the MiMe strategy, expression cassettes A and B were constructed and integrated into rice, achieving ectopic expression and genome integration of OsMPF. Plants with homozygous knockout of OsPAIR1, OsREC8, and OsOSD1 genes were screened, solving the problem of low heterosis fixation efficiency in rice in existing technologies and realizing an apomixis system with high seed setting rate.
Patent Information
- Application Number
- CN202610522390.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-20
- Publication Date
- 2026-06-26
- Estimated Expiration
- 2046-04-20
Smart Images

Figure CN122038470B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology and relates to a method for fixing heterosis in rice using the OsMPF gene. Background Technology
[0002] In the field of hybrid rice breeding, fixing heterosis to overcome the limitation of annual seed production required for traditional hybrid rice is a core objective. To this end, researchers have developed various technical approaches based on apomixis, mainly including meiotic modification (MiMe) and autonomous embryonic development. However, these existing technologies, which are closest to this invention, all have significant technical drawbacks that restrict their practical application.
[0003] Heterosis fixation systems based on the MiMe strategy, such as the Fix series technologies developed by the China National Rice Research Institute (e.g., patent CN118360330B), utilize gene editing to convert meiosis into mitosis and combine it with haploid induction to achieve apomixis. While generational evolution from Fix1 to Fix4 has gradually improved seed setting rate and clonal seed induction rate (e.g., Fix3 reached 21.7%), it has not fundamentally solved key bottlenecks. Some systems (e.g., Fix2, Fix3) are highly dependent on exogenous gene expression: heterologous expression elements (e.g., BBM4, OsWUS) are susceptible to positional effects, leading to unstable expression levels. More importantly, existing technologies struggle to balance high seed setting rate with high induction efficiency: early Fix1 experienced a significant decrease in seed setting rate due to OsMTL knockout, and while subsequent fixes improved seed setting rate (e.g., Fix4 restored it to normal levels), its clonal seed induction efficiency remained low.
[0004] In summary, existing closest-to-basics technologies for fixing heterosis in rice generally suffer from drawbacks: insufficient induction efficiency, making it difficult to meet the requirements of commercial production. This stems from the fact that the initiation of somatic embryogenesis or parthenogenesis involves complex multi-gene network synergistic regulation, hindering the practical application of heterosis fixation technology in field production. Therefore, there is an urgent need to discover new genes related to apomixis and develop new heterosis fixation systems to address the shortcomings of existing systems. This invention presents a novel solution to these deficiencies. Summary of the Invention
[0005] The main problem addressed by this invention is to overcome the shortcomings of existing technologies and provide a method for fixing heterosis in rice using the OsMPF gene. This method can achieve permanent fixation of heterosis in rice. To achieve the above objective, this invention includes the following steps:
[0006] Step 1: First, connect the OsECA1 promoter and the OsMPF gene coding sequence to construct expression cassette A. The OsECA1 promoter sequence is shown in SEQ ID NO.1, and the OsMPF gene coding sequence is shown in SEQ ID NO.2. Then, construct expression cassette B for the three-target CRISPR / Cas9 knockout of rice OsPAIR1, OsREC8, and OsOSD1. The coding sequences of the three genes OsPAIR1, OsREC8, and OsOSD1 are shown in SEQ ID NO.3-5; the target sequences of the three genes OsPAIR1, OsREC8, and OsOSD1 are shown in SEQ ID NO.6-8.
[0007] Step 2: Integrate expression cassette A and expression cassette B into the same expression vector to obtain expression cassette C. Transform expression cassette C into hybrid rice using Agrobacterium-mediated transformation to obtain T0 generation plants with expression cassette C integrated into their genome.
[0008] Step 3: Select T0 generation plants in which all three genes, OsPAIR1, OsREC8 and OsOSD1, are homozygous knocked out and the OsMPF gene is successfully expressed ectopically. Seeds are obtained through self-pollination.
[0009] Step 4: Germinate the seeds obtained from self-pollination in Step 3. Use flow cytometry and genome sequencing to detect plants in which the three genes OsPAIR1, OsREC8, and OsOSD1 have been homozygous knocked out, and screen for plants with fixed heterosis.
[0010] Furthermore, in step one, the specific method for obtaining the expression box A is as follows:
[0011] 1) Primers OsECA1pro-F and OsECA1pro-R were designed based on the promoter sequence of the OsECA1 gene. Using rice genomic DNA as a template, PCR amplification was performed to obtain amplification product 1. The sequences of OsECA1pro-F and OsECA1pro-R are shown in SEQ ID NO. 9-10.
[0012] 2) Primers OsMPF-F and OsMPF-R were designed based on the coding region sequence of the OsMPF gene. Using rice leaf cDNA as a template, PCR amplification was performed to obtain amplification product 2. The sequences of OsMPF-F and OsMPF-R are shown in SEQ ID NO.11-12.
[0013] 3) Design homologous recombination adapter primers OsECA1pro-fusion-F and OsECA1pro-fusion-R for amplification product 1. Use amplification product 1 as a template to perform PCR amplification to obtain amplification product 3. The sequences of OsECA1pro-fusion-F and OsECA1pro-fusion-R are shown in SEQ ID NO.13-14.
[0014] 4) Design homologous recombination adapter primers OsMPF-fusion-F and OsMPF-fusion-R for amplification product 2. Use amplification product 2 as a template to perform PCR amplification to obtain amplification product 4. The sequences of OsMPF-fusion-F and OsMPF-fusion-R are shown in SEQ ID NO.15-16.
[0015] 5) Using homologous recombination, amplification product 3 and amplification product 4 are ligated into the expression vector to obtain expression cassette A.
[0016] Furthermore, in step one, the specific method for obtaining the expression box B is as follows:
[0017] 1) Design target sequences based on the coding regions of the three genes OsPAIR1, OsREC8, and OsOSD1;
[0018] 2) The target sequence was integrated into the SK-gRNA vector to obtain three intermediate vectors: SG1, SG2, and SG3.
[0019] 3) Using the enzyme digestion and ligation method, the three intermediate vectors SG1, SG2 and SG3 were ligated to the backbone vector pC1300-Cas9 containing CRISPR / Cas9 expression elements to obtain expression cassette B.
[0020] Furthermore, in step two, expression box A and expression box B are integrated onto the same expression carrier to obtain expression box C. The specific steps are as follows:
[0021] 1) Expression cassette A was amplified using the adapter-integrated primers OsECA1-PC-F and OsMPF-PC-R designed for expression cassette A, and amplification product 5 was obtained; the sequences of OsECA1-PC-F and OsMPF-PC-R are shown in SEQ ID NO.17-18;
[0022] 2) Expression cassette B was digested with restriction endonucleases;
[0023] 3) Expression cassette A and expression cassette B are combined into an expression vector using homologous recombination to obtain expression cassette C;
[0024] 4) Genetic transformation was carried out using Agrobacterium tumefaciens strain EHA105, with the background being the indica-japonica hybrid rice variety Chunyou 927.
[0025] Furthermore, in step three, the T0 generation plants that have all three genes (OsPAIR1, OsREC8, and OsOSD1) homozygous knocked out and have successfully expressed the OsMPF gene ectopically are selected. The specific steps are as follows:
[0026] Based on the gene sequences of OsPAIR1, OsREC8, and OsOSD1, Hi-TOM detection primers PAIR1-Hi-F, PAIR1-Hi-R, REC8-Hi-F, REC8-Hi-R, and OSD1-Hi-F, OSD1-Hi-R were designed. T0 generation transgenic plants were amplified, and transgenic plants with homozygous mutations in all three genes were screened. The sequences of PAIR1-Hi-F and PAIR1-Hi-R are shown in SEQ ID NO. 19-20, the sequences of REC8-Hi-F and REC8-Hi-R are shown in SEQ ID NO. 21-22, and the sequences of OSD1-Hi-F and OSD1-Hi-R are shown in SEQ ID NO. 23-24.
[0027] Furthermore, in step four, flow cytometry and genome sequencing are used to detect plants in which the three genes OsPAIR1, OsREC8, and OsOSD1 are all homozygous knocked out, and plants with fixed heterosis are screened. The specific steps are as follows:
[0028] 1) The ploidy of plants in which the three genes OsPAIR1, OsREC8 and OsOSD1 were homozygous knocked out was detected by flow cytometry, and plants with diploid ploidy were selected.
[0029] 2) The diploid plants were tested using genome sequencing technology, and plants with fixed genotypes were selected.
[0030] The beneficial effects of this invention are:
[0031] Existing rice apomixis systems all have certain defects. The method of this invention provides a new method for fixing heterosis in rice through apomixis by combining the rice endogenous gene OsMPF with MiMe. This method can successfully fix heterosis in rice and obtain an apomixis system with a high seed setting rate, providing a new solution for fixing heterosis in rice through apomixis. Attached Figure Description
[0032] Figure 1 For carrier spectrum;
[0033] Figure 2Positive test for transgenic plants;
[0034] Figure 3 For the detection of mutation types in transgenic plants;
[0035] Figure 4 Data on the seed setting rate and cloning efficiency of transgenic plants;
[0036] Figure 5 Phenotypic diagram of transgenic T0 plants;
[0037] Figure 6 Screening for diploids by flow cytometry;
[0038] Figure 7 This is genome sequencing data;
[0039] Figure 8 This is a phenotypic diagram of a cloned plant. Detailed Implementation
[0040] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.
[0041] Example 1: Rice apomixis system composed of OsMPF and MiMe systems
[0042] 1. Carrier Construction
[0043] 1.1 Construction of Expression Box A
[0044] A vector (expression cassette A) specifically expressing the OsMPF gene in rice oocytes was constructed. The OsECA1 promoter and the OsMPF gene coding sequence were linked and constructed into the expression vector pUB09. The sequence of the OsECA1 promoter is shown in SEQ ID NO.1, and the coding sequence of the OsMPF gene is shown in SEQ ID NO.2. The specific construction method is as follows:
[0045] (1) Clone the relevant sequences separately, using the following primers:
[0046] OsECA1pro-F (SEQ ID NO.9): TATACATGGGAGTCTAGTGC
[0047] OsECA1pro-R (SEQ ID NO.10):GGTTTTTCTTTCTAG
[0048] OsMPF-F (SEQ ID NO.11):ATGCTGATTCACGGG
[0049] OsMPF-R (SEQ ID NO.12): TCAATCCTGACCGTTGGATG
[0050] The products were purified using a recovery kit to obtain amplification products 1 and 2, respectively.
[0051] (2) Add adapters for homologous recombination to the two sequences. The primers are as follows:
[0052] OsECA1pro-fusion-F (SEQ ID NO.13): TCTAGCCAATACGCGAGCTCAAGCTTATACATGGGAGTCTAGTGC
[0053] OsECA1pro-fusion-R (SEQ ID NO.14):GAATCAGCATGGTTTTTCTTTCTAG
[0054] OsMPF- fusion-F (SEQ ID NO.15): AAGAAAAACCATGCTGATTCACGGG
[0055] OsMPF- fusion-R (SEQ ID NO.16):ATCGGGGAAATTCGAGCTGGTCACCTCAATCCTGACCGTTGGATG
[0056] The products were purified using a recovery kit to obtain amplification products 3 and 4, respectively.
[0057] (3) The backbone vector pUB09 was digested with enzymes:
[0058] COMPONENT 50 µl REACTION
[0059] pUB09 1 µg
[0060] 10X rCutSmart Buffer 5 µl (1X)
[0061] HindIII-HF 20 units
[0062] BamHI-HF 20 units
[0063] Nuclease-free Water to 50 µl
[0064] The enzyme was digested at 37°C for 5 hours, and the product was purified using a recovery kit.
[0065] (4) Using a multi-fragment homologous recombination kit (Novizan C113), expression cassette A was obtained:
[0066] COMPONENT 20 µl REACTION
[0067] 100 ng of pUB09 enzyme digestion
[0068] Amplification product 3 20ng
[0069] Amplification product 4 10 ng
[0070] 5 × CE MultiS Buffer 4 µl
[0071] Exnase MultiS 2 µl
[0072] Nuclease-free Water to 20 µl
[0073] React at 37°C for 30 min; then cool to 4°C or immediately place on ice to cool.
[0074] (5) Transformation of recombinant products:
[0075] Thaw the chemocompetent cells used for cloning on ice; add 10 µl of recombinant product to 500 µl of competent cells, gently tap the tube wall to mix, and incubate on ice for 30 min; heat shock in a 42°C water bath for 45 sec, then immediately cool on ice for 2 min; add 900 µl of LB medium (without antibiotics), and incubate at 37°C for 1 h (200 rpm); centrifuge at 5,000 rpm for 1 min, resuspend in 100 µl, and spread on plates corresponding to the antibiotics; incubate upside down at 37°C for 12–16 h. Positive clones were detected by colony PCR and sent to the company for sequencing. Sequencing primer NOS-R (SEQ ID NO.25): agtaacatagatgacaccgc.
[0076] 1.2 Construction of expression box B;
[0077] A vector (expression cassette B) was constructed to co-knock out three endogenous genes from rice: OsPAIR1, OsREC8, and OsOSD1. The target sites of these three endogenous genes were ligated into the backbone vector pC1300-Cas9 containing CRISPR / Cas9 expression elements to obtain expression cassette B. The specific construction method is as follows:
[0078] (1) Target sequences were designed based on the coding regions of the three genes OsPAIR1, OsREC8, and OsOSD1. The primers are as follows:
[0079] OsPAIR1++ (SEQ ID NO.26):GGCAAAGCAACCCAGTGCACCGC
[0080] OsPAIR1--(SEQ ID NO.27):AAACGCGGTGCACTGGGTTGCTT
[0081] OsREC8++ (SEQ ID NO.28): GGCACGGAGAGCCTTAGTGCCAT
[0082] OsREC8--(SEQ ID NO.29):AAACATGGCACTAAGGCTCTCCG
[0083] OsOSD1++ (SEQ ID NO.30): GGCACTGCCGCCGACGAGCAACA
[0084] OsOSD1--(SEQ ID NO.31):AAACTGTTGCTCGTCGGCGGCAG
[0085] (2) The backbone vector SK-gRNA was digested with enzymes:
[0086] COMPONENT 50 µl REACTION
[0087] SK-gRNA 2 µg
[0088] 10 x Buffer Aar I 5 µl
[0089] Aar I 1 µl
[0090] 50 x oligonucleotide 1 µl
[0091] Nuclease-free Water to 50 µl
[0092] The enzyme was digested at 37°C for 5 hours, and the product was purified using a recovery kit to obtain SK-gRNA digest.
[0093] (3) Primer annealing to form double strands
[0094] The synthesized primers (g++ and g--) were diluted with water to a concentration of 100 µM. 20 µL of g++ and g--g were mixed together and incubated at 100°C for 5 min. After incubation, the mixture was allowed to cool naturally to room temperature.
[0095] (4) The target sequence was integrated into the SK-gRNA vector to obtain three intermediate vectors: SG1, SG2, and SG3.
[0096] COMPONENT 10 µl REACTION
[0097] SK-gRNA cleavage 30 ng
[0098] 10 x T4 ligase Buffer 1 µl
[0099] T4 ligase 0.5 µl
[0100] 7 µl of primer annealing product
[0101] Nuclease-free Water to 10 µl
[0102] Connect at 25°C for 1 hour to allow for conversion.
[0103] (5) Transformation of recombinant products:
[0104] Thaw the chemocompetent cells used for cloning on ice; add 10 µl of recombinant product to 500 µl of competent cells, gently tap the tube wall to mix, and incubate on ice for 30 min; heat shock in a 42°C water bath for 45 sec, then immediately cool on ice for 2 min; add 900 µl of LB medium (without antibiotics), and incubate at 37°C for 1 h (200 rpm); centrifuge at 5,000 rpm for 1 min, resuspend in 100 µl, and spread on plates corresponding to the appropriate antibiotics; incubate upside down at 37°C for 12–16 h. Positive clones were detected by colony PCR and sent to the company for sequencing. Sequencing primer T3 (SEQ ID NO. 32): ATTAACCCTCACTAAAGGGA.
[0105] (6) The three intermediate vectors SG1, SG2, and SG3 were digested with enzymes:
[0106] COMPONENT 50 µl REACTION
[0107] SK1 1 µg
[0108] 10X rCutSmart Buffer 5 µl (1X)
[0109] KpnI-HF 20 units
[0110] SalI-HF 20 units
[0111] Nuclease-free Water to 50 µl
[0112] The enzyme was digested at 37°C for 5 hours, and the product was purified using a recovery kit to obtain SK1 digest.
[0113] COMPONENT 50 µl REACTION
[0114] SK2 1 µg
[0115] 10X rCutSmart Buffer 5 µl (1X)
[0116] XhoI-HF 20 units
[0117] NheI-HF 20 units
[0118] Nuclease-free Water to 50 µl
[0119] The enzyme was digested at 37°C for 5 hours, and the product was purified using a recovery kit to obtain SK2 digest.
[0120] COMPONENT 50 µl REACTION
[0121] SK3 1 µg
[0122] 10X rCutSmart Buffer 5 µl (1X)
[0123] XbaI-HF 20 units
[0124] BglII-HF 20 units
[0125] Nuclease-free Water to 50 µl
[0126] The enzyme was digested at 37°C for 5 hours, and the product was purified using a recovery kit to obtain SK3 digest.
[0127] (7) The vector backbone pC1300-Cas9 was digested with enzymes:
[0128] COMPONENT 50 µl REACTION
[0129] pC1300-Cas9 1 µg
[0130] 10X rCutSmart Buffer 5 µl (1X)
[0131] KpnI-HF 20 units
[0132] BamHI-HF 20 units
[0133] Nuclease-free Water to 50 µl
[0134] The enzyme was digested at 37°C for 5 hours, and the product was purified using a recovery kit to obtain pC1300-Cas9 digest.
[0135] (8) Construction of expression box B:
[0136] COMPONENT 10 µl REACTION
[0137] pC1300-Cas9 cut 100 ng
[0138] SK1 cut 8 ng
[0139] SK2 cut 8 ng
[0140] SK3 cut 8 ng
[0141] 10 x T4 ligase Buffer 1 µl
[0142] T4 ligase 0.5 µl
[0143] Nuclease-free Water to 50 µl
[0144] Connect at 25°C for 1 hour to allow for conversion.
[0145] (9) Transformation of recombinant products:
[0146] Thaw the chemocompetent cells used for cloning on ice; add 10 µl of recombinant product to 500 µl of competent cells, gently tap the tube wall to mix, and incubate on ice for 30 min; heat shock in a 42°C water bath for 45 sec, then immediately cool on ice for 2 min; add 900 µl of LB medium (without antibiotics), and incubate at 37°C for 1 h (200 rpm); centrifuge at 5,000 rpm for 1 min, resuspend 100 µl, and spread on plates corresponding to the antibiotics; incubate upside down at 37°C for 12–16 h. Positive clones were detected by colony PCR and sent to the company for sequencing. Sequencing primer pC1300-F (SEQ ID NO. 33): acactttatgcttccggctc.
[0147] 1.3 Construction of Expression Box C
[0148] Expression cassette A and expression cassette B are integrated onto the same expression vector to obtain expression cassette C. The specific construction method is as follows:
[0149] (1) Expression cassette A was amplified using the adapter-integrated primers OsECA1-PC-F and OsMPF-PC-R designed for expression cassette A, and amplification product 5 was obtained. The primers are as follows:
[0150] OsECA1-PC-F (SEQ ID NO.17): tatatcctgtcaaacactgatagttTATACATGGGAGTCTAGTGC
[0151] OsMPF-PC-R (SEQ ID NO.18): gattgtcgtttcccgccttcagtttcccgatctagtaacatagat
[0152] (2) Digest expression cassette B with enzymes:
[0153] COMPONENT 50 µl REACTION
[0154] Expression cassette B 1 µg
[0155] 10X rCutSmart Buffer 5 µl (1X)
[0156] KpnI-HF 20 units
[0157] BamHI-HF 20 units
[0158] Nuclease-free Water to 50 µl
[0159] The enzyme was digested at 37°C for 5 hours, and the product was purified using a recovery kit to obtain expression cassette B digestion.
[0160] (3) Construction of expression box C:
[0161] COMPONENT 20 µl REACTION
[0162] Expression box B cut 100ng
[0163] Amplification product 5 20 ng
[0164] 5 × CE MultiS Buffer 4 µl
[0165] Exnase MultiS 2 µl
[0166] Nuclease-free Water to 20 µl
[0167] React at 37°C for 30 min; then cool to 4°C or immediately place on ice to cool.
[0168] (4) Transformation of recombinant products:
[0169] Thaw the chemocompetent cells used for cloning on ice; add 10 µl of recombinant product to 500 µl of competent cells, gently tap the tube wall to mix, and incubate on ice for 30 min; heat shock in a 42°C water bath for 45 sec, then immediately cool on ice for 2 min; add 900 µl of LB medium (without antibiotics), and incubate at 37°C for 1 h (200 rpm); centrifuge at 5,000 rpm for 1 min, resuspend in 100 µl, and spread on plates corresponding to the antibiotics; incubate upside down at 37°C for 12–16 h. Positive clones were detected by colony PCR and sent to the company for sequencing. Sequencing primer NB-R (SEQ ID NO. 34): catgcacatacaaatggacg.
[0170] 2. Genetic transformation
[0171] The cloning vector was correctly sequenced. Figure 1 The next step, Agrobacterium transformation experiment, was conducted. The indica-japonica hybrid rice variety Chunyou 927 (CY927) was transformed using the Agrobacterium EHA105 strain-mediated genetic transformation method to obtain transgenic material. The seeds were dehulled, disinfected with 75% ethanol for 1 min, the ethanol was discarded, and 2% sodium hypochlorite solution was added for disinfection for 20 min, during which time the seeds were placed on a shaker. The sodium hypochlorite solution was discarded in a clean bench, and the seeds were rinsed 4-5 times with sterile water. The seeds were then placed on sterilized filter paper to absorb excess moisture. Subsequently, the seeds were inoculated onto N6 mature embryo callus induction medium and cultured in the dark at 28℃ for approximately one month. Well-formed embryogenic callus was selected and subcultured 2-3 times. Embryogenic callus from the second subculture, 3-5 days after the second subculture, was selected for transformation.
[0172] Embryogenic callus was immersed in activated Agrobacterium tumefaciens EHA105 bacterial suspension (containing acetylsyleugenol) with the target plasmid for 30 min. The callus tissue was washed several times with sterile water, dried in a laminar flow hood to remove residual liquid, and then co-cultured at 19°C for 2-3 days. It was then transferred to selection medium supplemented with antibiotics containing selection markers for selection. Each selection process lasted 2 weeks, and after 2-3 rounds of selection, newly grown callus tissue was obtained. The newly grown callus tissue was then transferred to pre-differentiation medium and cultured for 7 days, followed by differentiation medium. It was cultured at 25°C under a 16 h / d light intensity for approximately 10 days, until green spots appeared, at which point regenerated plantlets were obtained. The differentiated transgenic seedlings had their roots cut off and were placed in rooting medium for 2-3 weeks. Then, the sealing film was removed, water was added, and the seedlings were hardened off for 1 week before transplanting.
[0173] 3. Detection of mutant expression in transgenic T0 plants
[0174] The method for screening T0 generation plants that exhibit homozygous mutations in the OsPAIR1, OsREC8, and OsOSD1 genes and successfully express transgenes is as follows:
[0175] (1) Hi-TOM detection primers were designed based on the gene sequences of OsPAIR1, OsREC8, and OsOSD1. The primer sequences are as follows:
[0176] PAIR1-Hi-F (SEQ ID NO.19): ggagtgagtacggtgtgccttcttgcgcgcgagaagagtctc
[0177] PAIR1-Hi-R (SEQ ID NO.20):gagttggatgctgagtggggagatgtagtgcgtgggtcttg
[0178] REC8-Hi-F (SEQ ID NO.21):ggagtgagtacggtgtgcttgggttagtgaggagat
[0179] REC8-Hi-R (SEQ ID NO.22): gagttggatgctgagtggtgcgatcggaactatggagac
[0180] OSD1-Hi-F (SEQ ID NO. 23): ggagtgagtacggtgtgctatcaggaggacgacgtcgccg
[0181] OSD1-Hi-R (SEQ ID NO.24):gagttggatgctgagtggctcctcctcttgggtgtagc
[0182] The above three primer pairs were used to perform PCR amplification on T0 generation transgenic plants. The mutation types of the three genes in all plants were detected using the Hi-TOM system, and transgenic plants with homozygous mutations in all three genes were screened.
[0183] (2) Primers HYG-TF and HYG-TR were designed based on hygromycin. The primer sequences are as follows:
[0184] HYG-TF (SEQ ID NO.35): GAACTCACCGCGACGTCTGTCGAG
[0185] HYG-TR (SEQ ID NO.36): GCTGTTATGCGGCCATTGTCCGTC
[0186] Using the primers described above, the T0 generation transgenic plants that were detected as homozygous mutants of the three genes OsPAIR1, OsREC8, and OsOSD1 in (1) were amplified, and positive transgenic plants that successfully amplified expression cassette A were screened. The positive three-mutant plants were obtained as experimental materials for subsequent experiments.
[0187] 4. Plant ploidy and genotype identification:
[0188] Flow cytometry and genome sequencing were used to analyze the progeny of T0-positive three-mutant materials and screen for plants with fixed heterosis. Specifically:
[0189] (1) Flow cytometry was used to identify the ploidy of progeny plants from positive three-particle materials. The specific experimental procedure was as follows:
[0190] Fresh rice leaves, 4-5 cm long and grown for 10 days, were cut and placed in a glass dish. 1 ml of plant lysis buffer LB01 was added, and the tissue was quickly minced vertically downwards with a blade. The lysis buffer was aspirated from the dish and filtered through a 50 µm nylon mesh into centrifuge tubes. The tube caps were labeled with the sample name. The tubes were centrifuged at 1,200 rpm for 5 min at 4°C in a benchtop refrigerated centrifuge. The centrifuge tubes were gently removed, and the supernatant was slowly aspirated. 450 µl of LB01, 25 µl of pre-chilled PI, and 25 µl of RNase A were added. The tubes were stained at 4°C in the dark for 10 min. Detection was performed using BD Accuri C6 assay. If the tissue was diploid, the peak value should be consistent with the wild-type peak.
[0191] The specific reagent formula is as follows:
[0192] Lysis buffer LB01: Tris 363.4 mg, Na2EDTA 148.9 mg, Sperminetetrahydrochloride 34.8 mg, KCl 1.193 g, NaCl 233.8 mg, Triton X-100 200 µl, bring to a final volume of 200 mL, adjust pH to 7.5 with 1M HCl, and add 220 µl of β-mercaptoethanol in a fume hood. Sterilize and dispense via vacuum filtration using a 0.22 µm filter in a clean bench, and store at -20°C.
[0193] Propidium iodide (PI) stock solution (1 mg / ml): Weigh 50 mg of powder and dissolve it in 50 mL of ddH2O; sterilize and dispense the solution by filtration through a 0.22 μm filter in a clean bench and store at -20℃.
[0194] RNase stock solution (1 mg / ml): Weigh 25 mg RNase (IIA Sigma) and dissolve it in 25 ml ddH2O; sterilize and dispense by filtration using a 0.22 µm filter in a clean bench; heat at 90℃ for 15 min to inactivate DNase; store at -20℃.
[0195] (2) Genotyping of diploid plants was performed using genome sequencing technology, specifically:
[0196] For the plants identified as diploid, DNA was extracted and a library constructed. Paired-end sequencing was performed using the Illumina Hiseq 2500 sequencing platform, with an average sequencing depth of 10-15 times for each sample. The raw data was first filtered using NGSQCtoolkit v2.3.3, and then aligned to a reference genome to obtain SNP data. Finally, the SNP data was compared with the wild-type Chunyou 927 genome to determine the genotype of the diploid plant. If the diploid plant exhibits fixed heterosis, its genome should theoretically be a heterozygous genotype identical to Chunyou 927.
[0197] 5. Test Results:
[0198] A total of 11 positive lines were obtained through genetic transformation. Figure 2 Using Hi-TOM detection technology, the mutation types of three genes, PAIR1, REC8, and OSD1, in the MiMe system were detected. The results showed that homozygous mutations occurred in all three genes in the apo-MPF-1, apo-MPF-4, and apo-MPF-9 lines. Figure 3 These three strains exhibited growth patterns consistent with the wild type, with seed setting rates of (69.71%), (74.20%), and (76.02%), respectively. Figure 4 , Figure 5 Once the seeds matured, seeds from these three lines were harvested, and the germinated seeds were used for diploid identification. Flow cytometry was used to identify their ploidy, revealing that apo-MPF-1, apo-MPF-4, and apo-MPF-9 all produced diploid offspring, but the cloning efficiency ranged from 0.83% to 32.20%. Figure 4 , Figure 6 Subsequently, genome sequencing technology was used to detect the genotypes of diploid plants, and the results showed that all diploid genotypes were consistent with the Chunyou 927 genotype. Figure 7 All of these were apomixis clones, and their growth and development were consistent with the wild type. Figure 8 ).
Claims
1. A method for fixing heterosis in rice using the OsMPF gene, characterized in that, Includes the following steps: Step 1: First, connect the OsECA1 promoter and the OsMPF gene coding sequence to construct expression cassette A. The OsECA1 promoter sequence is shown in SEQ ID NO.1, and the OsMPF gene coding sequence is shown in SEQ ID NO.
2. Then, construct expression cassette B for the three-target CRISPR / Cas9 knockout of rice OsPAIR1, OsREC8, and OsOSD1. The coding sequences of the three genes OsPAIR1, OsREC8, and OsOSD1 are shown in SEQ ID NO.3-5; the target sequences of the three genes OsPAIR1, OsREC8, and OsOSD1 are shown in SEQ ID NO.6-8. Step 2: Integrate expression cassette A and expression cassette B into the same expression vector to obtain expression cassette C. Transform expression cassette C into hybrid rice using Agrobacterium-mediated transformation to obtain T0 generation plants with expression cassette C integrated into their genome. Step 3: Select T0 generation plants in which all three genes, OsPAIR1, OsREC8 and OsOSD1, are homozygous knocked out and the OsMPF gene is successfully expressed ectopically. Seeds are obtained through self-pollination. Step 4: Germinate the seeds obtained from self-pollination in Step 3. Use flow cytometry and genome sequencing to detect plants in which the three genes OsPAIR1, OsREC8, and OsOSD1 have been homozygous knocked out, and screen for plants with fixed heterosis.
2. The method according to claim 1, characterized in that, In step one, the specific method for obtaining the expression box A is as follows: 1) Primers OsECA1pro-F and OsECA1pro-R were designed based on the promoter sequence of the OsECA1 gene. Using rice genomic DNA as a template, PCR amplification was performed to obtain amplification product 1. The sequences of OsECA1pro-F and OsECA1pro-R are shown in SEQ ID NO. 9-10. 2) Primers OsMPF-F and OsMPF-R were designed based on the coding region sequence of the OsMPF gene. Using rice leaf cDNA as a template, PCR amplification was performed to obtain amplification product 2. The sequences of OsMPF-F and OsMPF-R are shown in SEQ ID NO.11-12. 3) Design homologous recombination adapter primers OsECA1pro-fusion-F and OsECA1pro-fusion-R for amplification product 1. Use amplification product 1 as a template to perform PCR amplification to obtain amplification product 3. The sequences of OsECA1pro-fusion-F and OsECA1pro-fusion-R are shown in SEQ ID NO.13-14. 4) Design homologous recombination adapter primers OsMPF-fusion-F and OsMPF-fusion-R for amplification product 2. Use amplification product 2 as a template to perform PCR amplification to obtain amplification product 4. The sequences of OsMPF-fusion-F and OsMPF-fusion-R are shown in SEQ ID NO.15-16. 5) Using homologous recombination, amplification product 3 and amplification product 4 are ligated into the expression vector to obtain expression cassette A.
3. The method according to claim 1, characterized in that, In step one, the specific method for obtaining the expression box B is as follows: 1) Design target sequences based on the coding regions of the three genes OsPAIR1, OsREC8, and OsOSD1; 2) The target sequence was integrated into the SK-gRNA vector to obtain three intermediate vectors: SG1, SG2, and SG3. 3) Using the enzyme digestion and ligation method, the three intermediate vectors SG1, SG2 and SG3 were ligated to the backbone vector pC1300-Cas9 containing CRISPR / Cas9 expression elements to obtain expression cassette B.
4. The method according to claim 1, characterized in that, In step two, expression box A and expression box B are integrated onto the same expression carrier to obtain expression box C. The specific steps are as follows: 1) Expression cassette A was amplified using the adapter-integrated primers OsECA1-PC-F and OsMPF-PC-R designed for expression cassette A, and amplification product 5 was obtained; the sequences of OsECA1-PC-F and OsMPF-PC-R are shown in SEQ ID NO.17-18; 2) Expression cassette B was digested with restriction endonucleases; 3) Expression cassette A and expression cassette B are combined into an expression vector using homologous recombination to obtain expression cassette C; 4) Genetic transformation was carried out using Agrobacterium tumefaciens strain EHA105, with the background being the indica-japonica hybrid rice variety Chunyou 927.
5. The method according to claim 1, characterized in that, In step three, the T0 generation plants that have all three genes (OsPAIR1, OsREC8, and OsOSD1) homozygous knocked out and have successfully expressed the OsMPF gene ectopically are selected. The specific steps are as follows: Based on the gene sequences of OsPAIR1, OsREC8, and OsOSD1, Hi-TOM detection primers PAIR1-Hi-F, PAIR1-Hi-R, REC8-Hi-F, REC8-Hi-R, and OSD1-Hi-F, OSD1-Hi-R were designed. T0 generation transgenic plants were amplified, and transgenic plants with homozygous mutations in all three genes were screened. The sequences of PAIR1-Hi-F and PAIR1-Hi-R are shown in SEQ ID NO. 19-20, the sequences of REC8-Hi-F and REC8-Hi-R are shown in SEQ ID NO. 21-22, and the sequences of OSD1-Hi-F and OSD1-Hi-R are shown in SEQ ID NO. 23-24.
6. The method according to claim 1, characterized in that, In step four, flow cytometry and genome sequencing are used to detect plants in which the three genes OsPAIR1, OsREC8, and OsOSD1 are all homozygous knocked out, and plants with fixed heterosis are screened. The specific steps are as follows: 1) The ploidy of plants in which the three genes OsPAIR1, OsREC8 and OsOSD1 were homozygous knocked out was detected by flow cytometry, and plants with diploid ploidy were selected. 2) The diploid plants were tested using genome sequencing technology, and plants with fixed genotypes were selected.
Citation Information
Patent Citations
Method for fixing rice heterosis by using DMP gene
CN120485274A
Method for fixing rice heterosis by using OsZFPP gene
CN120608098A