Detection primer composition, kit and detection method for anxiety medication guidance

By combining multiplex PCR and single-base extension technology with MALDI-TOF MS, the problems of limited detection sites, high cost, and long cycle time for anxiety drug-related genes have been solved, achieving high-throughput, low-cost, and rapid detection of anxiety drug-related genes, which has significant clinical application value.

CN122038558APending Publication Date: 2026-05-15英盛生物技术股份有限公司
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610318042.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-16
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Existing gene testing technologies for anxiety medication suffer from problems such as limited detection sites, high cost, long cycle time, and complex operation, making them difficult to popularize in clinical practice.

Method used

By combining multiplex PCR and single-base extension techniques with MALDI-TOF MS, 32 amplification primers and 16 extension primers were designed to detect 18 commonly used medications for anxiety disorders and their related gene loci, achieving high-throughput, low-cost, and rapid gene detection.

Benefits of technology

It achieves comprehensive, accurate, and rapid gene detection of anxiety medications, with high sensitivity, strong specificity, simple operation, and easy clinical application.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122038558A_ABST
    Figure CN122038558A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of gene detection, and discloses a detection primer composition, a kit and a detection method for anxiety medication guidance, the primer composition comprises 32 amplification primers and 16 extension primers, the sequences of the amplification primers are as shown in SEQ ID NO. 1-32, and the sequences of the extension primers are as shown in SEQ ID NO. The sequences of the extension primers are as shown in SEQ ID NO. 33 to 48. The MALDI-TOF MS detection kit is comprehensive in detection sites and accurate in result, and has the advantages of multiple detection sites, accuracy, high throughput, low cost and short report period by adopting the MALDI-TOF MS technology for detection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of gene detection technology, and in particular to a detection primer composition, kit, and detection method for guiding medication use for anxiety. Background Technology

[0002] The statements herein provide only background information in relation to this invention and do not necessarily constitute prior art.

[0003] Among the major mental disorders in my country, anxiety disorders (also known as anxiety syndromes) have the highest prevalence, but a low treatment rate. Medication for anxiety disorders should follow the principle of dose titration. If the patient can tolerate it, the medication should be started at a low dose and gradually increased to the therapeutic dose, using the minimum effective dose possible to reduce adverse reactions. If the effect is still not significant after adequate dosage (the upper limit of the effective drug dose) and a full course of treatment (4-12 weeks), another drug of the same class or a different class of drugs with a different mechanism of action can be used.

[0004] The individual differences in anti-anxiety medications are significant, and genetic variations are a major reason for these differences in efficacy. Specifically, genetic polymorphisms of drug-metabolizing enzymes, transport proteins, receptors, and other drug targets are important factors contributing to individual variations in drug effects and toxicity. Genomics of anxiety disorders primarily studies the individual genetic differences in phenotypes, efficacy of anti-anxiety medications, side effects, and prognosis at the genomic level. This research aims to predict efficacy, anticipate side effects, screen drugs and dosages, and guide physicians in providing personalized and precise medication for patients.

[0005] Currently, some gene testing technologies for anxiety medication use PCR-based methods, such as RT-PCR, ARMS-PCR, and first-generation sequencing. These methods can only detect a small number of gene loci at a time, making it difficult to provide targeted experimental evidence for clinical medication. Other high-throughput gene testing technologies, such as next-generation sequencing, are costly, time-consuming, and require high levels of expertise in experimental procedures and data analysis. They can only be used as experimental tools and are difficult to popularize and promote in actual clinical practice. Summary of the Invention

[0006] To address the shortcomings of existing technologies, the purpose of this invention is to provide a detection primer composition, kit, and detection method for guiding medication use in anxiety disorders. This invention screens 18 commonly used drugs for anxiety disorders (alprazolam, estazolam, oxazepam, benzodiazepine derivatives, diazepam, buspirone, phenacetin, lorazepam, clonazepam, midazolam, mirtazapine, triazolam, tandospirone, nitrazepam, eszopiclone, zaleplon, zopiclone, zolpidem) and their related gene loci. The detection sites are comprehensive, the results are accurate, and the MALDI-TOF MS technology is used for detection, which has the advantages of multiple detection sites, accuracy, high throughput, low cost, and short reporting cycle.

[0007] To achieve the above objectives, the present invention is implemented through the following technical solution: In a first aspect, the present invention provides a detection primer composition for guidance on medication use for anxiety, the primer composition comprising 32 amplification primers and 16 extension primers, the sequences of the amplification primers being shown in SEQ ID NO. 1-32; and the sequences of the extension primers being shown in SEQ ID NO. 33-48.

[0008] The amplification primers for the CYP2C19 gene rs4244285 site are SEQ ID No. 1-2, and the extension primers are SEQ ID No. 33; the amplification primers for the CYP2C19 gene rs4986893 site are SEQ ID No. 3-4, and the extension primers are SEQ ID No. 34; the amplification primers for the CYP2C19 gene rs12248560 site are SEQ ID No. 5-6, and the extension primers are SEQ ID No. 35; the amplification primers for the CYP3A4 gene rs12721627 site are SEQ ID No. 7-8, and the extension primers are SEQ ID No. 36; the amplification primers for the CYP3A4 gene rs35599367 site are SEQ ID No. 9-10, and the extension primers are SEQ ID No. 37; CYP3A5 gene rs4263535 site, the amplification primer sequence is SEQ ID No. 11~12, the extension primer sequence is SEQ ID No. 38; GABRA1 gene rs4263535 site, the amplification primer sequence is SEQ ID No. 13~14, the extension primer sequence is SEQ ID No. 39; GAL gene rs948854 site, the amplification primer sequence is SEQ ID No. 15~16, the extension primer sequence is SEQ ID No. 40; HTR1A gene rs6295 site, the amplification primer sequence is SEQ ID No. 17~18, the extension primer sequence is SEQ ID No. 41; NAT2 gene rs1041983 site, the amplification primer sequence is SEQ ID No. 19~20, the extension primer sequence is SEQ ID No. 42; NAT2 gene rs1799930 site, the amplification primer sequence is SEQ ID No. The sequences of the extension primers for primers 20-22 are SEQ ID No. 43; the sequences of the amplification primers for the OPRM1 gene rs1799971 site are SEQ ID No. 23-24, and the sequences of the extension primers are SEQ ID No. 44; the sequences of the amplification primers for the POR gene rs1057868 site are SEQ ID No. 25-26, and the sequences of the extension primers are SEQ ID No. 45; the sequences of the amplification primers for the UGT1A1 gene rs1976391 site are SEQ ID No. 27-28, and the sequences of the extension primers are SEQ ID No. 46; the sequences of the amplification primers for the UGT2B7 gene rs7439366 site are SEQ ID No. 29-30, and the sequences of the extension primers are SEQ ID No.47; The amplification primer sequences for the UGT2B15 gene rs1902023 site are SEQ ID No. 31-32, and the extension primer sequences are SEQ ID No. 48.

[0009] In a second aspect, the present invention provides a kit for guiding medication use for anxiety, comprising multiplex PCR reaction reagents, single base extension reaction reagents, and dNTP removal mixture reaction reagents; The multiplex PCR reaction reagent includes a PCR amplification primer mixture, which includes amplification primers with nucleotide sequences as shown in SEQ ID NO. 1-32; the single-base extension reaction reagent includes a single-base extension reaction primer premix, which includes extension primers with nucleotide sequences as shown in SEQ ID NO. 33-48.

[0010] Thirdly, the present invention provides a kit for detecting anxiety drug genes, comprising multiplex PCR reaction reagents, single base extension reaction reagents and dNTP removal mixture reaction reagents; The multiplex PCR reaction reagent includes a PCR amplification primer mixture, which includes amplification primers with nucleotide sequences as shown in SEQ ID NO. 1-32; the single-base extension reaction reagent includes a single-base extension reaction primer premix, which includes extension primers with nucleotide sequences as shown in SEQ ID NO. 33-48.

[0011] In some embodiments, the concentration of each amplification primer in the PCR reaction amplification primer mixture is 0.3-1 μM, preferably 0.3-0.7 μM, specifically 0.5 μM.

[0012] In some embodiments, the concentration of each extension primer in the single-base extension reaction primer premix is: SEQ ID NO. 337-8μM; SEQ ID NO. 347-8μM; SEQ ID NO. 3520-21μM; SEQ ID NO. 365-6μM; SEQ ID NO. 3711-13μM; SEQ ID NO. 384-5μM; SEQ ID NO. 3912-13μM; SEQ ID NO. 406-7μM; SEQ ID NO. 414-5μM; SEQ ID NO. 428-9μM; SEQ ID NO. 4314-15μM; SEQ ID NO. 4412-13μM; SEQ ID NO. 4519-20μM; SEQ ID NO. 464-5μM; SEQ ID NO. 479-11 μM; SEQ ID NO. 4818-19 μM.

[0013] Preferably, the concentration of each extension primer in the premixed solution of the single-base extension reaction primers is: SEQ ID NO. 337.93μM; SEQ ID NO. 347.60μM; SEQ ID NO. 3520.33μM; SEQ ID NO. 365.53μM; SEQ ID NO. 3712.00μM; SEQ ID NO. 384.47μM; SEQ ID NO. 3912.13μM; SEQ ID NO. 406.67μM; SEQ ID NO. 414.67μM; SEQ ID NO. 428.33μM; SEQ ID NO. 4314.67μM; SEQ ID NO. 4412.07μM; SEQ ID NO. 4519.33μM; SEQ ID NO. 464.73μM; SEQ ID NO. 4710.00 μM; SEQ ID NO. 4818.67 μM.

[0014] In some embodiments, the genes are the CYP2C19 gene rs4244285 locus, the CYP2C19 gene rs4986893 locus, the CYP2C19 gene rs12248560 locus, the CYP3A4 gene rs12721627 locus, the CYP3A4 gene rs35599367 locus, the CYP3A5 gene rs4263535 locus, the GABRA1 gene rs4263535 locus, and the GAL gene r At least one of the following: s948854 locus, HTR1A gene rs6295 locus, NAT2 gene rs1041983 locus, NAT2 gene rs1799930 locus, OPRM1 gene rs1799971 locus, POR gene rs1057868 locus, UGT1A1 gene rs1976391 locus, UGT2B7 gene rs7439366 locus, or UGT2B15 gene rs1902023 locus.

[0015] Fourthly, the present invention provides a method for detecting anxiety medication genes based on the aforementioned kit, comprising the following steps: Using amplification primers with sequences as shown in SEQ ID NO. 1~32, the DNA region containing the gene polymorphism site of the anxiety drug was simultaneously amplified to obtain PCR products containing the gene polymorphism site; After amplification, shrimp alkaline phosphatase was used to digest and remove the remaining dNTPs in the reaction system. Add extension primers with sequences as shown in SEQ ID NO. 33~48 to the reaction system to perform a single-base extension reaction, so that the extension primers extend one base at the set single nucleotide site and then terminate the reaction; The reaction system was desalted and purified using a cation exchange resin. The purified product was then tested.

[0016] In some embodiments, the annealing temperature during PCR amplification is 58-62°C, preferably 60°C.

[0017] Preferred PCR reaction procedure: heated to 102-107℃; Stay at 92-97℃ for 12-17 minutes; Hold at 92-97℃ for 12-17 seconds, at 55-60℃ for 25-35 seconds, and at 7-75℃ for 25-35 seconds; repeat for a total of 35-45 cycles. Hold at 58-62℃ for 8-12 minutes; Maintain at 3-5℃.

[0018] A further preferred PCR reaction procedure: heated to 105°C; Hold at 95℃ for 15 minutes; Hold at 95℃ for 15 seconds, at 59℃ for 30 seconds, at 72℃ for 30 seconds; repeat for a total of 40 cycles. Hold at 60℃ for 10 minutes; Maintain at 4℃.

[0019] The beneficial effects achieved by one or more embodiments of the present invention described above are as follows: This invention provides a method for detecting gene polymorphisms that guide medication use for anxiety, utilizing a combination of multiplex PCR, single-base extension, and mass spectrometry. This method encompasses the most comprehensive range of pediatric drug-related gene loci, including 16 pairs of amplification primers designed for 16 loci corresponding to 12 genes of 18 drugs, which can specifically amplify 16 common locus regions of anxiety-related drug genes; it also includes 16 single-base extension primers.

[0020] The kit described in this invention can detect different genotypes at 16 common loci related to clinical anxiety medication genes in a single well. It boasts high sensitivity, specificity, and accuracy, and is simple to operate, low-cost, high-throughput, and rapid, with automatic result interpretation, making it easy to promote and apply in clinical practice. This invention can be applied to anxiety medication gene detection, providing a reliable detection system and kit for anxiety medication, and has significant clinical application value and promising market prospects. Attached Figure Description

[0021] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0022] Figure 1 This is a mass spectrometry detection result diagram of Example 4 of the present invention; Figure 2 This is a representative Sanger sequencing result diagram of Example 5 of the present invention; Figure 3 This is a representative mass spectrometry detection result diagram of Embodiment 5 of the present invention. Detailed Implementation

[0023] It should be noted that the following detailed description is illustrative and intended to provide further explanation of the invention. Unless otherwise specified, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0024] The technical solution of the present invention will be further described below with reference to specific embodiments.

[0025] Example 1 The design and optimization of primers, and the establishment of the reaction system.

[0026] Using Primer5 primer design software, relevant parameters were adjusted to design PCR amplification primers for 16 SNP sites. Extension primers for the same 16 SNP sites were designed using the primer design software included with the YS EXT 7900MD time-of-flight mass spectrometry system. The designed PCR amplification primers, extension primers, and parameter files were exported, and the primers were synthesized. The PCR amplification primer mixture and the single-base extension primer mixture were prepared according to the primer configuration table, and the primer mixtures were fine-tuned until they met the requirements. Then, primer testing and optimization were performed. The specific steps are as follows: Taking PCR reaction condition optimization as an example (adjustment of PCR annealing temperature): Initially, the amplification conditions used included an annealing temperature of 65℃. However, amplification at this temperature resulted in low amplification efficiency at several loci. Specifically, the rs776746, rs1041983, and rs1057868 loci failed to reliably report genotypes. Increasing the amount of PCR primers for these three loci improved amplification efficiency, but the results were unstable. After optimizing the PCR reaction conditions and changing the annealing temperature to 60℃, and through multiple rounds of testing, the new system showed better amplification efficiency, with all loci correctly and stably reporting genotypes.

[0027] Taking the optimization of single-base extension primers at rs35599367 and rs7439366 sites as an example (adjusting the direction of the extension primers and changing the length of the extension primers): The low target peak response at rs35599367 is mainly related to the design efficiency of the extension primers. The direction of the extension primers was changed (the original extension sequence was: AGTGATGCAGCTGGCCCTAC).

[0028] The low target peak response at rs7439366 is mainly related to the design efficiency of the extension primers. The length of the extension primer sequence was changed (the original extension sequence was: TTGGTAAGAGTGGAT).

[0029] With the redesign of primers and optimization of the reaction system, all loci can correctly and stably report genotypes.

[0030] Example 2 This embodiment screened 18 commonly used drugs for anxiety disorders (alprazolam, estazolam, oxazepam, benzodiazepine derivatives, diazepam, buspirone, phenacetin, lorazepam, clonazepam, midazolam, mirtazapine, triazolam, tandospirone, nitrazepam, eszopiclone, zaleplon, zopiclone, zolpidem) and their related gene loci (12 genes and 16 loci). The primers used for gene detection of anxiety medications are provided, as shown in Table 1, all of which were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0031] Table 1. Loci and corresponding amplification and extension primer sequences

[0032] Example 3 This embodiment provides a kit for gene detection of anxiety medication.

[0033] (1) PCR reaction amplification primer mixture: 1 μL of each of the 100 μM specific primers as shown in SEQ ID NO. 1~32, 144 μL of ddH2O, for a total of 200 μL.

[0034] (2) PCR reaction system: 2 μL PCR premix; 1 μL deionized water; 1 μL PCR amplification primer mixture; 1 μL DNA template; total 5 μL. The PCR premix contains PCR enzyme, PCR buffer, and dNTP mixture.

[0035] Table 2 Composition of PCR amplification primer mixture Extend primer sequence Volume (μL) Concentration (μM) Extend primer sequence Volume (μL) Concentration (μM) SEQ ID NO.1 1 0.5 SEQ ID NO. 17 1 0.5 SEQ ID NO. 2 1 0.5 SEQ ID NO. 18 1 0.5 SEQ ID NO. 3 1 0.5 SEQ ID NO. 19 1.5 0.75 SEQ ID NO. 4 1 0.5 SEQ ID NO. 20 1.5 0.75 SEQ ID NO. 5 1 0.5 SEQ ID NO. 21 1 0.5 SEQ ID NO. 6 1 0.5 SEQ ID NO. 22 1 0.5 SEQ ID NO. 7 1 0.5 SEQ ID NO. 23 1 0.5 SEQ ID NO. 8 1 0.5 SEQ ID NO. 24 1 0.5 SEQ ID NO. 9 0.8 0.4 SEQ ID NO. 25 1.6 0.8 SEQ ID NO. 10 0.8 0.4 SEQ ID NO. 26 1.6 0.8 SEQ ID NO. 11 2 1 SEQ ID NO. 27 1 0.5 SEQ ID NO. 12 2 1 SEQ ID NO. 28 1 0.5 SEQ ID NO. 13 1 0.5 SEQ ID NO. 29 1 0.5 SEQ ID NO. 14 1 0.5 SEQ ID NO. 30 1 0.5 SEQ ID NO. 15 1 0.5 SEQ ID NO. 31 1 0.5 SEQ ID NO. 16 1 0.5 SEQ ID NO. 32 1 0.5 Add water ddH2O 164.2 Total 200 - (3) Shrimp alkaline phosphatase (SAP) digestion reaction system: 0.3 μL SAP enzyme, 0.17 μL SAP buffer, 1.53 μL deionized water, total 2 μL. Among them, SAP enzyme includes shrimp alkaline phosphatase and glycerol; SAP buffer includes water, Tris-HCl, and MgCl2.

[0036] (4) Primer premix solution for single-base extension reaction: The initial concentration of the extension primers used in the primer mixture for the single-base extension reaction was 250 μM.

[0037] Table 3 Composition of primer mixture for single-base extension reaction Extend primer sequence Volume (μL) Concentration (μM) Extend primer sequence Volume (μL) Concentration (μM) SEQ ID NO. 33 2.38 7.93 SEQ ID NO. 41 1.4 4.67 SEQ ID NO. 34 2.28 7.60 SEQ ID NO. 42 2.5 8.33 SEQ ID NO. 35 6.1 20.33 SEQ ID NO. 43 4.4 14.67 SEQ ID NO. 36 1.66 5.53 SEQ ID NO. 44 3.62 12.07 SEQ ID NO. 37 3.6 12.00 SEQ ID NO. 45 5.8 19.33 SEQ ID NO. 38 1.34 4.47 SEQ ID NO. 46 1.42 4.73 SEQ ID NO. 39 3.64 12.13 SEQ ID NO. 47 3 10.00 SEQ ID NO. 40 2 6.67 SEQ ID NO. 48 5.6 18.67 <![CDATA[Add ddH2O]]> 24.26 Total 75 - (5) Single base extension reaction system: E-ddNTP mix 1 μL; MPE buffer 1.4 μL; MPE enzyme 0.6 μL; single base extension reaction primer premix 1 μL; total 4 μL. Among them, E-ddNTP mix contains ddATP, ddTTP, ddGTP, and ddCTP; MPE enzyme contains highly specific amplification polymerase, water, and Tris-HCl; MPE buffer contains water, Tris-HCl, and MgCl2.

[0038] (6) Desalination resin: including cation exchange resin powder for removing salt ions from extended reaction liquid.

[0039] Example 4 This embodiment provides a method for detecting anxiety medication genes based on the kit of Example 3, including the following steps: 1. Preparation of human gDNA nucleic acid template: Extract DNA from whole blood samples using a nucleic acid extraction or purification kit (Tiangen DP348). Extraction must be performed strictly in accordance with the kit instructions. The extracted DNA samples can be stored at -18℃ or below for 12 months or at -70℃ or below for 2 years.

[0040] 2. Detection of common sites in anxiety drug use genes using one set of optimized amplification primers and one set of optimized single-base extension primers, specifically including the following steps: (1) Multiplex PCR: Aliquot 4 μL of PCR mix (2 μL of PCR premix; 1 μL of deionized water; 1 μL of PCR amplification primer mixture) into each PCR reaction tube, and add 1 μL of extracted DNA template (total 10 ng). Gently vortex to mix, and centrifuge at 1000 rpm for 1 min.

[0041] PCR reaction procedure: heated to 105°C; 95℃ for 15 minutes; 95℃ for 15s, 59℃ for 30s, 72℃ for 30s; a total of 40 cycles; 60℃ for 10 minutes; Hold at 4℃.

[0042] (2) SAP digestion: Shrimp alkaline phosphatase (SAP) is used to digest and remove the remaining dNTPs in the reaction system to prevent interference with the next base extension reaction.

[0043] Heat cap 105℃; 37℃ for 40 minutes; 85℃ for 5 minutes; Hold at 4℃.

[0044] (3) Single base extension reaction: The reaction is terminated after the extension primer extends by one base at a specific single nucleotide site. The reaction system is shown in Example 3.

[0045] The reaction procedure is as follows: .

[0046] (4) Resin desalting and purification: Add 14 μL of ultrapure water to each reaction well. Gently invert the eight-tube pack containing resin and place it on the sample plate, ensuring that the resin wells are aligned with each sample well. Then gently tap the resin tube to allow the resin to fall into the wells of the sample plate. Use a hand centrifuge for brief centrifugation to avoid resin adhering to the tube wall. Place the sample plate with resin in a vortex mixer and mix at 20 rpm for 30 min. After mixing, centrifuge the sample at 2000 rpm for 1 min, and use the supernatant for analysis.

[0047] (5) Mass spectrometry detection: Remove the target plate, add 0.5-1 μL of the supernatant after purification in step (4), allow it to dry naturally to crystallize, and then perform the analysis on the instrument (YS EXT 7900MD time-of-flight mass spectrometry detection system). The results are analyzed using MALDI-TOF MS technology. The detection results are as follows: Figure 1As shown in the figure, all sites showed stable peaks with relatively high signal values.

[0048] Example 5 This embodiment provides an accuracy test for anxiety medication gene detection using the method described in Example 4.

[0049] Test protocol: Using 10 clinical samples, a comparative study was conducted using the method of this invention and Sanger sequencing.

[0050] The specific testing process is as follows: The reaction system was prepared according to Example 2 of this invention. Then, following the operating steps in Example 4, multiplex PCR amplification, shrimp alkaline phosphatase digestion, single-base extension, resin desalting purification, and mass spectrometry detection were performed, followed by result analysis. Accuracy results are shown in Table 3, and representative Sanger sequencing results are as follows: Figure 2 As shown in the figure, the representative mass spectrometry detection result is as follows: Figure 3 As shown.

[0051] Table 3 Accuracy Test Results site Sanger sequencing results MALDI-TOF mass spectrometry results site Sanger sequencing results MALDI-TOF mass spectrometry results rs4244285 G / A G / A rs6295 C / G C / G rs4986893 G G rs1041983 C / T C / T rs12248560 C C rs1799930 G / A G / A rs12721627 G G rs1799971 A / G A / G rs35599367 G G rs1057868 C / T C / T rs776746 T T rs1976391 A A rs4263535 A / G A / G rs7439366 T / C T / C rs948854 T T rs1902023 A / C A / C Comparison of nucleic acid mass spectrometry results with Sanger sequencing results from 10 samples demonstrates that the accuracy of the system validation experiment of this invention is 100%. Sanger sequencing is the gold standard for SNP genotyping, but due to its low energy, each reaction can only detect one site; to detect 16 sites in a single sample, 16 reactions are required. This example also illustrates that nucleic acid mass spectrometry technology has significant advantages over Sanger sequencing in terms of throughput, time consumption, and cost per site.

[0052] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A detection primer composition for guiding medication use in anxiety, characterized in that: The primer composition comprises 32 amplification primers and 16 extension primers, the sequences of which are shown in SEQ ID NO. 1-32; and the sequences of which are shown in SEQ ID NO. 33-48.

2. A reagent kit for guiding medication use for anxiety, characterized in that: This includes multiplex PCR reaction reagents, single base extension reaction reagents, and dNTP removal mixture reaction reagents; The multiplex PCR reaction reagent includes a PCR amplification primer mixture, which includes amplification primers with nucleotide sequences as shown in SEQ ID NO. 1-32 of claim 1; the single-base extension reaction reagent includes a single-base extension reaction primer premix, which includes extension primers with nucleotide sequences as shown in SEQ ID NO. 33-48 of claim 1.

3. A kit for detecting genes related to anxiety medication, characterized in that: This includes multiplex PCR reaction reagents, single base extension reaction reagents, and dNTP removal mixture reaction reagents; The multiplex PCR reaction reagent includes a PCR amplification primer mixture, which includes amplification primers with nucleotide sequences as shown in SEQ ID NO. 1-32 of claim 1; the single-base extension reaction reagent includes a single-base extension reaction primer premix, which includes extension primers with nucleotide sequences as shown in SEQ ID NO. 33-48 of claim 1.

4. The kit for guiding anxiety medication use according to claim 2, or the kit for detecting anxiety medication genes according to claim 3, characterized in that: In the PCR amplification primer mixture, the concentration of each amplification primer is 0.3-1 μM.

5. The kit for guiding medication use for anxiety according to claim 4, characterized in that: In the PCR reaction amplification primer mixture, the concentration of each amplification primer is 0.3-0.7 μM.

6. The kit for guiding medication use for anxiety according to claim 4, characterized in that: The concentration of each extension primer in the premixed solution of the single-base extension reaction primers is as follows: SEQ ID NO. 337-8μM; SEQ ID NO. 347-8μM; SEQ ID NO. 3520-21μM; SEQ ID NO. 365-6μM; SEQ ID NO. 3711-13μM; SEQ ID NO. 384-5μM; SEQ ID NO. 3912-13μM; SEQ ID NO. 406-7μM; SEQ ID NO. 414-5μM; SEQ ID NO. 428-9μM; SEQ ID NO. 4314-15μM; SEQ ID NO. 4412-13μM; SEQ ID NO. 4519-20μM; SEQ ID NO. 464-5μM; SEQ ID NO. 479-11 μM; SEQ ID NO. 4818-19 μM.

7. The kit for guiding medication use for anxiety according to claim 6, characterized in that: The concentration of each extension primer in the premixed solution of the single-base extension reaction primers is as follows: SEQ ID NO. 337.93μM; SEQ ID NO. 347.60μM; SEQ ID NO. 3520.33μM; SEQ ID NO. 365.53μM; SEQ ID NO. 3712.00μM; SEQ ID NO. 384.47μM; SEQ ID NO. 3912.13μM; SEQ ID NO. 406.67μM; SEQ ID NO. 414.67μM; SEQ ID NO. 428.33μM; SEQ ID NO. 4314.67μM; SEQ ID NO. 4412.07μM; SEQ ID NO. 4519.33μM; SEQ ID NO. 464.73μM; SEQ ID NO. 4710.00 μM; SEQ ID NO. 4818.67 μM.

8. The kit for guiding medication use for anxiety according to claim 3, characterized in that: The genes mentioned are the CYP2C19 gene rs4244285, CYP2C19 gene rs4986893, CYP2C19 gene rs12248560, CYP3A4 gene rs12721627, CYP3A4 gene rs35599367, CYP3A5 gene rs4263535, GABRA1 gene rs4263535, and GAL gene rs948. At least one of the following: 854 site, HTR1A gene rs6295 site, NAT2 gene rs1041983 site, NAT2 gene rs1799930 site, OPRM1 gene rs1799971 site, POR gene rs1057868 site, UGT1A1 gene rs1976391 site, UGT2B7 gene rs7439366 site, or UGT2B15 gene rs1902023 site.

9. A method for detecting anxiety medication genes based on the aforementioned kit, characterized in that: Includes the following steps: Using the amplification primers shown in SEQ ID NO. 1~32 of claim 1, the DNA region containing the gene polymorphism site of the anxiety drug is simultaneously amplified to obtain a PCR product containing the gene polymorphism site; After amplification, shrimp alkaline phosphatase was used to digest and remove the remaining dNTPs in the reaction system. Add the extension primers shown in SEQ ID NO. 33~48 of claim 1 to the reaction system to perform a single-base extension reaction, so that the extension primers extend one base at the set single nucleotide site and then terminate the reaction; The reaction system was desalted and purified using a cation exchange resin. The purified product was then tested.

10. The method for detecting anxiety medication genes based on the kit according to claim 9, characterized in that: The annealing temperature for PCR amplification is 58-62℃, preferably 60℃; Preferred PCR reaction procedure: heated to 102-107℃; Stay at 92-97℃ for 12-17 minutes; Hold at 92-97℃ for 12-17 seconds, at 55-60℃ for 25-35 seconds, and at 7-75℃ for 25-35 seconds; repeat for a total of 35-45 cycles. Hold at 58-62℃ for 8-12 minutes; Maintain at 3-5℃; Preferred PCR reaction procedure: heated to 105°C; Hold at 95℃ for 15 minutes; Hold at 95℃ for 15 seconds, at 59℃ for 30 seconds, at 72℃ for 30 seconds; repeat for a total of 40 cycles. Hold at 60℃ for 10 minutes; Maintain at 4℃.