SNP (Single Nucleotide Polymorphism) marker related to body size and temperature adaptability of worker bees of apis cerana and application of SNP marker

By selecting signal analysis and Foxo gene locus detection, the problems of long cycle and high cost in the identification of bee body size and temperature adaptability in traditional methods have been solved, realizing efficient and accurate identification of bee breeding targets and improving breeding efficiency and accuracy.

CN122038588APending Publication Date: 2026-05-15YILI FUWO BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
YILI FUWO BIOTECHNOLOGY CO LTD
Filing Date
2026-02-02
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Existing technologies are insufficient for efficiently and accurately identifying key genes related to the size and temperature adaptability of worker bees in the Chinese honeybee. Traditional methods are time-consuming, costly, and prone to false positives, lacking direct functional verification and failing to provide effective targets for molecular breeding.

Method used

Selective signal analysis was used to screen out SNP markers related to the body size and temperature adaptability of worker bees in the Chinese honeybee. Genotyping was performed using the 6452066 site polymorphism in the second intron region of the Foxo gene. Primer pairs Foxo-F and Foxo-R were designed for PCR amplification. Combined with whole-genome resequencing and quantitative real-time PCR analysis, the differences in gene expression were verified.

Benefits of technology

This technology enables efficient and convenient identification of key genes related to body development and temperature adaptation in bees within natural populations, reducing false positives, providing targets and tools for bee breeding, and improving breeding efficiency and accuracy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) marker related to the body size and temperature adaptability of worker bees of apis cerana and application of the SNP marker. According to the invention, 25 key SNP sites and 10 associated genes for regulating and controlling the body type and temperature adaptation of the apis cerana are screened by a selection signal analysis method. Research finds that in the second intron region (6452066th site of the chromosome 7 of the bees) of the Foxo gene, the mutation type is T / C, and the mutation type is closely related to the body size and temperature adaptability of the Chinese bees. Through verification, in Hainan apis cerana and Aba apis cerana with extremely different body sizes and living environment temperatures, mutation position genotypes are different, TT is a large-body cold-resistant dominant genotype, and CC / TC is a small-body heat-resistant dominant genotype; a gene expression quantity detection result shows that the expression quantity of the Foxo gene is in negative correlation with a large body type and cold resistance and is in positive correlation with a small body type and heat resistance. The method can be used for genetic improvement of bee body shape characters and has breeding application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to SNP markers related to the body size and temperature adaptation traits of worker bees in the Chinese honeybee and their applications. Background Technology

[0002] High productivity is a common goal in beekeeping. Larger bees have higher foraging efficiency, stronger disease resistance, and are more productive. Therefore, beekeepers prefer to raise larger bees. Bee size is closely related to the ambient temperature. Therefore, studying the key genes regulating the body size and temperature adaptability of worker bees is of great significance for revealing the molecular mechanisms of bee body size development and temperature adaptation.

[0003] The vast majority of crops in the world require bee pollination. According to data from the Food and Agriculture Organization of the United Nations, approximately 85% of flowering plants and 90% of fruit trees globally rely on bee pollination. Bee pollination contributes over 300 billion yuan to China's major crops, accounting for more than 10% of China's total agricultural output. Bee products such as honey, royal jelly, and bee pollen produced by bee colonies can enhance human immunity and have high nutritional and health benefits.

[0004] Chinese honeybee (Apis cerana) Apis cerana Honeybees (Apis cerana) are a general term for the Oriental honeybee found in China. They possess a strong adaptability to different ecological environments, and this long-term adaptation has led to the development of various local varieties. According to the "National List of Bee Genetic Resources" (2024 edition), Chinese honeybees can be divided into 10 local varieties, including the Changbai Mountain honeybee, Aba honeybee, Tibetan honeybee, Northern honeybee, Central China honeybee, Southern Yunnan honeybee, Yunnan-Guizhou Plateau honeybee, South China honeybee, Hainan honeybee, and Batang honeybee. Each local variety has different biological characteristics. For example, the Hainan honeybee is small in size and has good heat resistance, adapting well to the hot climate of Hainan; the Aba honeybee is large in size and has good cold resistance, adapting well to the long, harsh winters of Tibet.

[0005] Honeybees are poikilothermic animals, with a relatively poor ability to maintain and regulate their body temperature. Environmental temperature affects their metabolism and physiological responses, thus impacting their life activities such as growth, development, reproduction, and survival. Furthermore, temperature stress can induce oxidative stress in honeybees, ultimately leading to abnormal egg development, vestigial wings in adult bees, reduced learning ability, and increased susceptibility to disease in the colony. In addition, honeybee morphological development is influenced by environmental conditions, including temperature, oxygen, and humidity. As poikilothermic animals, the body size of honeybees is significantly correlated with the ambient temperature; honeybees in colder regions are generally larger, while those in subtropical and tropical regions are smaller. The size of worker bees is closely related to their foraging, pollination, and defense capabilities. The honey sac is located on the worker bee's abdomen; a longer abdomen allows for a larger honey sac storage space, resulting in a greater honey-collecting capacity. Larger honeybees have an advantage in pollination efficiency because they have wider wing bases, enabling them to deposit more pollen, and they visit flowers more frequently. Furthermore, larger bees are better able to fight off predators like wasps, enhancing the colony's defenses. In beekeeping, breeders prefer larger bees because they produce more honey, are healthier, and offer higher economic returns. Therefore, breeding larger worker bees is an important goal in bee breeding.

[0006] Currently, traditional QTL mapping is cumbersome, requiring the construction of specific segregating populations (such as F2 or backcross populations) and multiple generations of hybridization, a process that takes several years and is costly, making it impossible to perform directly in natural populations. Furthermore, the mapped genomic regions are typically very wide (several Mb), containing dozens or even hundreds of genes, requiring extensive subsequent fine mapping and functional validation to identify the true causal genes. Genome-wide association studies (GWAS) require statistical analysis of a large amount of precise phenotypic data from individuals, are highly susceptible to interference from population structure, and are prone to false positives, causing genes that truly affect body size development and temperature adaptation to be missed, or resulting in many genes that do not actually affect body size development and temperature adaptation. Based solely on traditional QTL mapping and GWAS, it remains difficult to reveal the genetic mechanisms of bee body size and temperature adaptation at the population genetics to molecular biology level, and there is a lack of systematic evidence for identifying key genes. In particular, the lack of direct functional validation under extreme phenotypic models fails to provide effective targets for molecular breeding.

[0007] Selection signal analysis is a powerful tool in population genetics that can directly locate genes associated with specific environmental adaptations or phenotypic variations by detecting regions of the genome affected by natural or artificial selection. While molecular breeding is already being used in livestock and poultry to accelerate genetic progress, selection signal analysis has not yet been applied to identify key genes regulating body size and temperature adaptation in bees. Therefore, there is an urgent need for a new method that can simply, efficiently, and accurately identify key genes regulating body size and temperature adaptation in bees, providing new targets and tools for molecular marker-assisted breeding and the selection of stress-resistant varieties. Summary of the Invention

[0008] The purpose of this invention is to provide SNP markers related to the body size and temperature adaptation traits of worker bees in the Chinese honeybee and their applications.

[0009] To achieve the objective of this invention, in a first aspect, this invention provides an SNP marker related to the body size and temperature adaptability traits of worker bees in the Chinese honeybee, wherein the SNP marker contains a nucleotide sequence with a polymorphism of T / C at position 6452066 of honeybee chromosome 7.

[0010] The above physical locations are based on the bee reference genome version GCF_029169275.1_AcerK_1.0_genomic.

[0011] Furthermore, worker bee individuals with the genotype CC or TC at the polymorphic locus have smaller body size and higher heat tolerance than worker bee individuals with the genotype TT; worker bee individuals with the genotype TT at the polymorphic locus have larger body size and higher cold tolerance than worker bee individuals with the genotype CC or TC.

[0012] Secondly, the present invention provides a primer pair for amplifying the SNP marker, the primer pair comprising primers Foxo-F and Foxo-R: Foxo-F: 5′-CAAAAACCTGTCGCACCTTTCAG-3′ (SEQ ID NO: 1); Foxo-R: 5′-ACTCTATTTAACCTTGCCTGGAGC-3′ (SEQ ID NO: 2).

[0013] Thirdly, the present invention provides detection reagents or kits containing the primer pairs.

[0014] Fourthly, this invention provides a method for identifying and breeding worker bees of the Chinese honeybee based on their body size and temperature adaptability, comprising the following steps: 1) Extract total DNA from worker bees to be tested; 2) Using DNA as a template, PCR amplification was performed using primers Foxo-F and Foxo-R; 3) Analyze the PCR amplification products.

[0015] Preferably, the PCR reaction system is as follows: Mix 12.5 μL, 10 μM Foxo-F 1 μL, 10 μM Foxo-R 1 μL, DNA template 2 μL, and sterile enzyme-free water 8.5 μL.

[0016] Preferably, the PCR reaction program is as follows: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ final extension for 2 min.

[0017] Further, step 3) includes: sequencing the amplification product to obtain the genotype of the site with the polymorphism, wherein worker bee individuals with genotype CC or TC have smaller body size and higher heat resistance than worker bee individuals with genotype TT; and worker bee individuals with genotype TT have larger body size and higher cold resistance than worker bee individuals with genotype CC or TC.

[0018] Fifthly, the present invention provides any of the following applications of the SNP marker or its detection reagent: (1) Used for early prediction of worker bee size and temperature adaptability; (2) Molecular marker-assisted breeding for worker bee body size and temperature adaptability traits.

[0019] Furthermore, the bee in question is a Chinese honeybee.

[0020] Sixthly, the present invention provides a method for accurately identifying key genes related to body size development and temperature adaptation in bees.

[0021] The method for identifying key genes for bee body size and temperature adaptation provided by this invention is as follows: (1) Collect worker bee samples from the large-body-size low-temperature group and the small-body-size high-temperature group; (2) Extract DNA from worker bee tissues; (3) Resequencing the whole genome; (4) Calculate the Fst value and nucleotide diversity (π) of each locus in the two groups of worker bees. Loci appearing in the first 1% of the Fst sliding window analysis and the first 1% of the θπRatio analysis are considered to be genes related to body size development and temperature adaptation; (5) Obtain the key gene forkhead box, sub-group O (LOC107993192, Fox ), forkhead box protein O. (6) In natural populations of Chinese honeybees Fox Gene expression level verification.

[0022] This method can accurately and efficiently detect key genes related to body development and temperature adaptation in bees without the need to construct specific segregating populations. It can also collect a large amount of precise phenotypic measurement data from individuals, thus reducing false positive results.

[0023] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects: (I) This invention screened 25 key SNP sites and 10 associated genes that regulate the body size and temperature adaptation of the Chinese honeybee using signal analysis methods. The study found that... Fox The second intron region of the gene (6452066 bp on honeybee chromosome 7) has a mutation type of T / C, which is closely related to the body size and temperature adaptability of honeybees. Experiments have verified that in honeybees from Hainan and Aba, which have extreme differences in body size and living environment temperature, the genotypes at the mutation site are different: TT indicates a large body size and cold resistance, while CC / TC indicates a small body size and heat resistance. Fox Significant differences were observed in gene expression levels, and the identified genes... Fox The gene plays a negative regulatory role in regulating the body length and heat and cold resistance of bees, that is... Fox The reduced expression of genes leads to increased body length and greater cold resistance in bees.

[0024] (ii) This invention can be used for genetic improvement of bee body shape traits and has breeding application value.

[0025] (III) The method of this invention is simple and easy to operate. The selection signal analysis method of this invention accurately and efficiently identifies causal relationships: it directly detects the genomic footprint left by natural selection (such as temperature), without needing to associate with unknown environmental factors or mixed population background structures, and does not rely on subjectively defined significance thresholds for differential expression, thus reducing false positive results. Experimental analysis is simple and clear, saving time and cost: it only requires genotype data and grouping information of the sample population, eliminating the need for manual statistical analysis of a large number of individuals' precise phenotypic measurement data, saving the huge time and financial costs of constructing a population. The screened genes cover a systematic and broad range: the selection signal acts on genomic regions, simultaneously revealing multiple selected genes, which may collectively constitute a metabolic pathway or regulatory network. Compared to the scattered sites discovered by existing technologies, it more systematically reveals the genetic basis of traits.

[0026] (iv) The method of this invention can accurately and quickly identify key genes for the body development and temperature adaptation of honeybees, thereby enabling molecular breeding work on body size selection and temperature adaptation of honeybees. In addition to Hainan honeybees and Aba honeybees, other representative varieties can be selected for selection signal analysis and experimental verification. For example, analysis using Hainan honeybees and Changbai Mountain honeybees can also achieve the purpose of this invention. Attached Figure Description

[0027] Figure 1 In a preferred embodiment of the present invention, SNP sites selected by signal analysis are used.

[0028] Figure 2 This document verifies the mutation at chromosome 6452066 of *Apis hainanensis* and *Apis abaensis* in a preferred embodiment of the present invention. A: Alignment of the PCR template with the reference genome sequence; B: Sequencing peak diagram of *Apis abaensis*; C: Sequencing peak diagram of *Apis hainanensis*.

[0029] Figure 3 In a preferred embodiment of the present invention, the body of a worker bee of the Chinese honeybee Fox Dynamic changes during gene development. A: Aba honeybee; B: Hainan honeybee. Significant differences are indicated by a, b, c, d, with different letters indicating significant differences (P<0.05).

[0030] Figure 4 In a preferred embodiment of the present invention, the body of a worker bee of the Chinese honeybee Fox Gene tissue specificity. A: Aba honeybee; B: Hainan honeybee. Significance of difference is indicated by a, b, c, d. The same letter indicates no significant difference (P>0.05), otherwise the difference is significant (P<0.05).

[0031] Figure 5 In the preferred embodiments of the present invention, Aba honeybee and Hainan honeybee are used. Fox Genetic differences between varieties. A: Different periods Fox Genetic differences between varieties; B: Differences between different tissues Fox Differences in genes between varieties. The difference was significant, P<0.05; The difference was significant, P<0.01; : The difference is significant, P<0.001; ns: The difference is not significant. Detailed Implementation

[0032] The present invention adopts the following technical solution: Traditional QTL mapping is cumbersome, requiring the construction of specific segregating populations (such as F2 or backcross populations) for multiple generations of hybridization or the collection of large amounts of precise phenotypic data from individuals, a process that can take years and is costly, making it impossible to perform directly in natural populations. Accuracy is also low; the mapped genomic regions are typically very wide (several Mb), containing hundreds of genes, and are highly susceptible to interference from population structure and environmental factors, requiring extensive subsequent fine mapping and functional validation to identify the true causal genes. Furthermore, existing methods for identifying single loci significantly associated with traits rely on subjective threshold settings for association significance, leading to false positives or false negatives.

[0033] This invention provides a method for identifying key genes regulating body size and temperature adaptation in worker bees of the honeybee species *Apis cerana*. The method involves selection signal analysis of worker bees in large-bodied, low-temperature groups and small-bodied, high-temperature groups to identify SNPs (single-cell nuclei) molecular markers related to body size or temperature adaptation and their corresponding genes. Subsequently, experimental verification is conducted on samples of *Apis cerana* from Hainan and Aba regions, which exhibit extreme differences in body size and environmental temperature, to explore the selected candidate genes. Fox Differences in expression levels between Hainan honeybee and Aba honeybee. Quantitative real-time PCR analysis showed that Hainan honeybee... Fox Gene expression levels were higher in the larval, late pupal, and adult stages than in the Aba honeybee. This indicates that... Fox The gene is highly expressed in small-bodied, heat-adapted Hainan honeybees and can serve as a molecular marker gene for size and temperature adaptation in honeybees. Further research revealed that it is located in... Fox The mutation type is T / C in the second intron region of the gene, at position 6452066 on chromosome 7, and is closely related to the body size and temperature adaptability of honeybees.

[0034] This method can accurately identify key genes regulating the body length and temperature adaptability of worker bees in the Chinese honeybee. The method is simple and easy to operate, and has significant application and promotion value for Chinese honeybee breeding.

[0035] The terminology involved in this invention: Fst, or interpopulation genetic differentiation index, measures the degree of differentiation between populations. A value of 0 indicates random mating and completely similar genotypes between two populations; a value of 1 indicates complete isolation and dissimilarity. When a gene or genomic region is subjected to strong natural selection related to a specific environment (such as temperature), a particular allele may become very common in one population but rare in another. This leads to extreme differentiation in allele frequencies of that region between the two populations. These peak regions with abnormally high Fst values ​​are likely areas that have undergone selection.

[0036] θπ, or nucleic acid diversity, refers to the mean number of base differences (SNPs) between any two different sequences (individuals) in a population. The greater the genetic diversity within a single population, the larger the θπ value. Populations subjected to selection have relatively uniform genetic diversity, and their θπ values ​​are usually small, indicating that they have likely undergone selective elimination.

[0037] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0038] The examples used signal selection analysis to screen for SNP molecular markers and genes associated with body size and temperature adaptation. This invention uses signal analysis to screen SNP molecular markers and genes related to body size and temperature adaptation, and directly verifies gene expression levels in target populations with extreme differences, thereby identifying effective targets for increasing worker bee body length and improving environmental adaptability. The specific method includes the following steps: 1. Experimental Materials Ten local varieties of Chinese honeybees were sampled, including the Changbai Mountain honeybee, Aba honeybee, Tibetan honeybee, Northern honeybee, Central China honeybee, Southern Yunnan honeybee, Yunnan-Guizhou Plateau honeybee, South China honeybee, Hainan honeybee, and Batang honeybee. Twenty colonies of worker bees, with 50 worker bees per colony, were collected from each variety. The samples were preserved by immersing them in anhydrous ethanol.

[0039] 2. Experimental Methods 2.1 Selective signal analysis to screen key SNP molecular markers and genes 2.1.1 Size and Temperature Adaptation Experiment: Bee Colony and Group Design Based on the body size characteristics of bees and the average annual temperature of their natural distribution areas, samples were selected and divided into two groups: a large-bodied low-temperature group (Aba Chinese honeybee, Changbai Mountain Chinese honeybee, Batang Chinese honeybee, and Tibetan Chinese honeybee) and a small-bodied high-temperature group (Hainan Chinese honeybee, Yunnan-Guizhou Plateau Chinese honeybee, Southern Yunnan Chinese honeybee, and South China Chinese honeybee). Twenty individuals were selected from each variety.

[0040] 2.1.2 Screening of key SNP sites related to body size and temperature adaptation (1) Sample DNA extraction and genotyping detection This invention is based on 160 samples of Chinese honeybees, measuring body size-related indicators and statistically analyzing the temperature of their living environment. After dissection, genomic DNA was extracted from the head and thorax tissues of worker bees. This DNA library was obtained through steps including end repair, addition of a polyA tail, addition of sequencing adapters, amplification, and purification. The insert size of the library was quality checked using an Agilent 2100, and the effective concentration of the library was accurately quantified using qPCR. Once the quality met the standards, the DNA library was constructed.

[0041] After successful sample library construction, whole-genome sequencing was performed on the sample library using the DNBSEQ-T7 high-throughput sequencing platform to ensure a sequencing depth ≥10×. FastQC was used for data quality control during sequencing, removing low-quality reads to ensure result quality. Quality control standards included: removing reads containing more than 1% unknown nucleotides, removing reads containing adapter sequences, and removing low-quality (phred quality <5) reads with a base count exceeding 50% of the total length. Finally, each bee sample generated over 5G of high-quality, clean, paired-end reads, with Q20 and Q30 values ​​exceeding 95% and 90%, respectively. The obtained high-quality, clean, paired-end reads were aligned to the reference genome using BWA 0.7.8 software. Bee cerana (Login ID: GCF_029169275.1_AcerK_1.0_genomic) to obtain high-quality SNP data.

[0042] (2) Selective signal analysis The HaplotypeCaller module of GATK software was used to perform variant detection on multiple samples of the processed alignment files. Detected variants were filtered and quality-controlled using tools such as VariantFiltration. Quality control criteria were: QD < 2.0, FS > 60.0, MQ < 40.0, SOR > 3.0. Sites with two SNPs within 5 bp, SNPs within 5 bp of an indel, sites with a distance of less than 10 bp between two indels, or a GQ (Genotype Quality) less than 20.0 were filtered. VCFtools was used to calculate the Fst value for each site across different populations and to calculate the nucleotide diversity (π) for each population. Combining Fst and θπ: sites appearing simultaneously in the top 1% of both the Fst sliding window analysis and the top 1% of the θπRatio analysis were selected as candidate target sites to improve the accuracy of the identification results.

[0043] (3) Gene annotation The ANNAVAR software was used to annotate the selected SNPs in the chosen signal regions, identifying exon regions, intron regions, alternative splicing sites, upstream and downstream gene regions, and intergenic regions. Synonymous and non-synonymous SNPs were distinguished, and potential adaptive evolutionary genes were identified. The role of these genes in body size and temperature adaptation was explored, considering both the physiological functions of bees and the functions of known genes.

[0044] 2.2 Candidate Genes Fox Large-scale validation of gene SNP sites 2.2.1 DNA Extraction Aba honeybees and Hainan honeybees, exhibiting extreme differences in body size and environmental temperature, were selected as validation populations. Ten colonies of each species were randomly selected, with 10 worker bees from each colony. DNA extraction was performed using the Omega Micro DNA Extraction Kit (catalog number: D3096-02). The steps are as follows: (1) Chop 10 mg of tissue sample and transfer it to a 1.5 mL centrifuge tube; (2) Add 200 μL of tissue lysis buffer (TL Buffer); (3) Add 20 μL of protease solution (OB Protease Solution) and vortex to mix; (4) Incubate in a water bath at 55°C; (5) Centrifuge at room temperature at the maximum speed (>13,000 rpm) for 2 min to remove insoluble impurities; (6) Transfer the supernatant to a new 1.5 mL centrifuge tube, being careful not to break up any precipitate; (7) Add 220 μL of binding buffer (BL Buffer) and vortex to mix; (8) Incubate at 70℃ for 10 min; (9) Add 220 mL of anhydrous ethanol and vortex to mix thoroughly; (10) Insert the MicroEluteDNA Mini Columns into the collection tube; (11) Transfer the mixture obtained in step 9 to the binding column (700 μL of mixture transferred each time), centrifuge at 12,000 rpm for 1 min at room temperature, and discard the filtrate and collection tube; (12) Insert the MicroEluteDNA Mini Columns into a new collection tube, add 500 μL of high salt binding buffer (HBC Buffer) (diluted with isopropanol) to the binding column, centrifuge at 12,000 rpm for 30 s, and discard the filtrate; (13) Put the MicroElute DNA Mini Columns back into the collection tube, add 700 μL of DNA Wash Buffer (diluted with anhydrous ethanol) to the binding column, centrifuge at 12,000 rpm for 1 min, and discard the filtrate; (14) Repeat step 13; (15) Put the MicroEluteDNA MiniColumns back into the collection tube and centrifuge at 12,000 rpm for 2 min. (16) Insert the MicroElute DNA Mini Columns into a new 1.5 mL centrifuge tube, add 10-50 μL of elution buffer (preheated at 70°C) to the binding column, incubate at room temperature for 3 min, and then centrifuge at 12,000 rpm for 1 min to elute the DNA. (17) DNA is stored at -20℃.

[0045] 2.2.2 Fox PCR amplification of gene SNP sites exist Fox Primers were designed upstream and downstream of the SNP locus for PCR amplification. Upstream primer (Foxo-F): CAAAAACCTGTCGCACCTTTCAG; Downstream primer (Foxo-R): ACTCTATTTACCTTGCCTGGAGC. PCR reaction mixture: Mix 12.5 μL, Foxo-F 1 μL (10 μM), Foxo-R 1 μL (10 μM), DNA template 2 μL, sterile enzyme-free water 8.5 μL. PCR amplification program: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; final extension at 72℃ for 2 min. PCR products were subjected to agarose gel electrophoresis to detect the PCR results. Qualified PCR products were mixed according to species, and the PCR products from Aba honeybees and Hainan honeybees were sequenced separately to detect alleles at mutation sites.

[0046] 2.3 Fox Gene expression level verification 2.3.1 Experimental bee colony and grouping settings Samples of worker bees from different developmental stages of *Apis cerana* (Aba honeybee) and *Apis hainanensis* (Hainan honeybee) with extreme differences in body size and environmental temperature were collected. All samples were sourced from the Aba Honeybee Conservation Farm in Malkang City, Sichuan Province (102°7'12"E, 31°54'4"N) and the Hainan Honeybee Conservation Farm in Hainan Province (109°41'27"E, 19°19'35"N). For each species, worker bee samples were collected from the same hive at five developmental stages: 5-day-old mature larvae, pink-eyed pupae, light-brown-eyed thoracic pupae, dark-brown-eyed thoracic pupae, newly emerged bees, and mature foraging bees, with three biological replicates for each stage. The collected worker bee samples were preserved in RNA preservation solution and incubated overnight at 4°C. Newly emerged bees and mature foraging bees from both *Apis hainanensis* and *Apis cerana* were dissected, with three groups (head, thorax, and legs) sampled, with five samples pooled per group and three biological replicates per group for multidimensional systematic validation. Fox Genetic differences between varieties, dynamic changes during development, and tissue specificity.

[0047] 2.3.2 RNA Extraction High-quality RNA was extracted from the samples primarily using the TranaZol Up Plus RNA Kit (Beijing TransGen Biotech Co., Ltd. ER501-01-V2). Extraction was performed according to the kit instructions, with the following specific steps: (1) Add two zirconium beads to the sample and use a high-throughput tissue homogenizer to homogenize the sample thoroughly.

[0048] (2) Add 1 mL TransZol and 0.2 mL RNA Extraction Agent to every 50-100 mg of sample and vortex at room temperature for 5 min.

[0049] (3) Centrifuge at 4 ℃ and 10000 rpm for 15 min.

[0050] (4) Take the colorless aqueous phase from the top of the tube into a new centrifuge tube, add anhydrous ethanol of the same volume as the colorless aqueous phase, and gently invert to mix.

[0051] (5) Add all the mixed solution into the centrifuge column, centrifuge at 12000 rpm at 4℃ for 30 s, and then discard the effluent.

[0052] (6) Add 500 μL of Clean Buffer 9 to the centrifuge column, centrifuge at 12000 rpm at 4℃ for 30 s, and discard the effluent.

[0053] (7) Repeat the steps once.

[0054] (8) Add 500 μL Wash Buffer 9 to the centrifuge column (add 96 mL of anhydrous ethanol before use), centrifuge at 12000 rpm at 4℃ for 30 s, and discard the effluent.

[0055] (9) Repeat the steps once.

[0056] (10) Centrifuge at 4℃ and 12000 rpm for 2 min to completely remove residual ethanol.

[0057] (11) Place the centrifuge column in an RNase-free tube, add 150 μL of RNase-free water to the center of the centrifuge column, let it stand at room temperature for 1 min, and then add another 150 μL of RNase-free water to the center of the centrifuge column and let it stand at room temperature for 1 min.

[0058] (12) Centrifuge at 4℃ and 12000 rpm for 1 min to extract high-quality RNA.

[0059] (13) The RNA purity was tested with a spectrophotometer. Once the RNA quality was qualified, it was stored at -80℃.

[0060] 2.3.3 cDNA Synthesis RNA was reverse transcribed into cDNA using the PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) kit (TaKaRa RR047A); the specific steps are as follows: (1) Add 1 μL of gDNA Eraser and 2 μL of 5×gDNA Eraser Buffer to a 0.2ml PCR tube. Then, according to the measured RNA purity, perform normalization (1000 divided by RNA concentration) and add the corresponding RNA solution. The remainder is filled with ddH2O to make up the difference, for a total of 10 μL.

[0061] (2) Processed with PCR instrument, 42 ℃ for 2 min, and stored at 4 ℃.

[0062] (3) Add 1 μL of PrimeScript RT Enzyme MixⅠ, 4 μL of 5×PrimeScriptBuffer2, 1 μL of RT Primer Mix, and 4 μL of RNase Free dH2O to the PCR product, for a total of 20 μL.

[0063] (4) Place in a PCR instrument and incubate at 37 ℃ for 15 min; 85 ℃ for 5 s; store at 4 ℃. 20 μL of cDNA product is then obtained and stored at -20 ℃.

[0064] 2.3.4 Real-time quantitative PCR Using the TB Green® Premix Ex Taq™ II (Tli RNaseH Plus) kit (TaKaRaRR820A), the presence of RNaseH in worker bees of Hainan and Aba honeybees was detected by qRT-PCR. Fox Gene expression status. The specific steps are as follows: (1) Validation of the design Fox To determine if the primers were usable, Shanghai Sangon Biotech Co., Ltd. was commissioned to synthesize the primers (primer base sequences are shown in Table 1).

[0065] (2) The original cDNA solution and 5-fold dilution of the sample were tested on the instrument. The cycling conditions were: 45 cycles of 95℃ for 30 s, 95℃ for 5 s, and 60℃ for 30 s to obtain fluorescence, amplification curve and melting curve, so as to determine the optimal dilution factor of the sample and verify the specificity of the designed primers.

[0066] (3) Prepare a 20 μL RT-qPCR reaction mixture by taking 1 μL cDNA (200 ng), 0.8 μL upstream primer (10 μM), 0.8 μL downstream primer (10 μM), 10 μL TB Green Premix Ex Taq II, and 7.4 μL H2O. The cycling conditions are 95℃ for 30 s, 95℃ for 5 s, and 60℃ for 30 s. Fluorescence is obtained on the 45th cycle.

[0067] Table 1 Fox Quantitative PCR primer sequences

[0068] 3. Results 3.1 Select SNP loci and genes related to body size and temperature adaptation identified through signal screening. Fst & θπ analysis revealed 25 SNP sites that simultaneously appeared in the top 0.01 windows of both the Fst sliding window analysis and the top 0.01 windows of the θπ ratio analysis, indicating potential selection signal regions. Statistical analysis identified 10 SNP sites associated with specific genes. Figure 1 ).

[0069] 3.2 SNP locus gene annotation and enrichment analysis Table 2 shows the gene annotation results, revealing that the 25 significantly selected SNP sites belong to functional regions distributed across exons (1), introns (17), intergenic regions (4), downstream regions (2), and the 5' end of the untranslated region (UTR5, 1). GO enrichment analysis indicates that these genes are primarily involved in cell communication, signal transduction, and enzyme activity regulation. KEGG pathway analysis reveals that these genes play roles in glycolysis / glucose biosynthesis, longevity regulation pathways, Toll and Imd, and FOXO signaling pathways.

[0070] Table 2. SNP loci and associated genes related to body size and temperature adaptation identified by repeated screening.

[0071] 3.3 Hainan Chinese honeybee and Aba Chinese honeybee Fox Verification of mutations in intron 2 of the gene and at position 6452066 on chromosome 7. By analyzing the base type at position 6452066 of chromosome 7 in large populations of Hainan honeybees (small-sized) and Aba honeybees (large-sized), we were able to... Fox The mutation at intron 2 of the gene and position 6452066 on chromosome 7 was verified. The verification results are as follows: Figure 2 As shown, the sequences containing the mutation sites in Aba and Hainan honeybees showed 92.55% homology with the reference genome template sequence, indicating that the PCR-amplified sequences were the target sequences. The PCR sequencing peak diagrams show that the mutation sites in the Aba honeybee validation population exhibited a single peak, with the allele being T and the genotype being wild-type TT; while the mutation sites in the Hainan honeybee validation population showed overlapping peaks, with the allele being C or T and the genotype being mutant CC or TC. These results are consistent with those obtained through selection signal screening. Fox The genes have the same SNP sites.

[0072] 3.4 Hainan honeybee and Aba honeybee Fox Dynamic changes in genes during developmental stages RT-PCR results as follows Figure 3 As shown, the body of the Aba honeybee Fox Gene expression levels in honeybees initially increased and then decreased from larva to pupa, but significantly increased after emergence (P<0.05). (This refers to the expression of genes in Hainan honeybees.) Fox Gene expression levels show a trend of first decreasing and then increasing as development time gradually lengthens from larva to pupa, while after the honeybee emerges from the cell... Fox Gene expression levels were significantly increased (P<0.05). The results suggest that... Fox Genes may be related to the external environmental stimuli that bees experience after emerging from their cells.

[0073] 3.5 Hainan honeybee and Aba honeybee Fox Tissue specificity of genes RT-PCR results as follows Figure 4 As shown, the body of a newly emerged bee Fox Gene expression in the head was significantly lower than in the thorax and leg tissues (P<0.05). After emergence, the gene expression level in the legs of the Aba honeybee was significantly higher than that in the head and thorax (P<0.05), while that in the Hainan honeybee... Fox The gene head was significantly lower (P<0.05), while there were no significant differences in chest and leg size. The results suggest that... Fox Genes may be related to the amount or width of muscles in the bee's thorax and legs. More muscles allow it to fly farther and carry more pollen, and also generate more heat to withstand the cold.

[0074] 3.6 Hainan honeybee and Aba honeybee Fox Differences between gene varieties RT-PCR results as follows Figure 5As shown, comparisons at various stages, excluding the early pupal stage, revealed that in the small, heat-resistant Hainan honeybee... Fox Gene expression levels were significantly higher than those of the large, cold-resistant Aba honeybee, indicating that... Fox The genes are negatively regulated by large body size and cold resistance, and positively regulated by small body size and heat resistance.

[0075] In summary, through selective signal analysis of the large-body-size, low-temperature group and the small-body-size, high-temperature group, a total of 25 SNP loci and 10 associated genes were identified that are related to the body size and temperature adaptability of honeybees. Fox A T / C mutation at the SNP site in the second intron region of a gene (6452066 bp on chromosome 7 of honeybees) may be related to the regulation of body size and temperature adaptation in honeybees. Validation experiments on the SNP site in Hainan honeybees and Aba honeybees showed that the genotype at the mutation location differed between the two species. Gene expression level validation results also indicated... Fox The gene is a negative regulator of the large body size and cold resistance trait, possibly related to the external environmental stimuli experienced by bees after they emerge from the cell and the muscle content of their thorax and legs. This invention successfully identified a key gene regulating the body length and temperature adaptability of worker bees using a selection signal analysis method.

[0076] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A SNP marker associated with the body size and temperature adaptation traits of worker bees in the Chinese honeybee, characterized in that, The SNP marker contains a nucleotide sequence with a T / C polymorphism at position 6452066 of honeybee chromosome 7; The above physical locations are based on the bee reference genome version GCF_029169275.1_AcerK_1.0_genomic.

2. The SNP marker according to claim 1, characterized in that, Worker bee individuals with the genotype CC or TC at the site exhibiting the aforementioned polymorphism have smaller body size and higher heat tolerance than worker bee individuals with the genotype TT. Worker bee individuals with the TT genotype at the aforementioned polymorphic locus have larger body size and greater cold resistance than worker bee individuals with the CC or TC genotypes.

3. A primer pair for amplifying the SNP marker of claim 1 or 2, characterized in that, The primer pair includes primers Foxo-F and Foxo-R: Foxo-F: 5′-CAAAAACCTGTCGCACCTTTCAG-3′; Foxo-R: 5′-ACTCTATTTAACCTTGCCTGGAGC-3′.

4. A detection reagent or kit containing the primer pair described in claim 3.

5. A method for identifying and breeding worker bees of the Chinese honeybee based on their body size and temperature adaptability, characterized in that... Includes the following steps: 1) Extract total DNA from worker bees to be tested; 2) Using DNA as a template, perform PCR amplification using the primer pair described in claim 3; 3) Analyze the PCR amplification products.

6. The method according to claim 5, characterized in that, The PCR reaction system consisted of: 12.5 μL Mix, 1 μL 10 μM Foxo-F, 1 μL 10 μM Foxo-R, 2 μL DNA template, and 8.5 μL sterile enzyme-free water.

7. The method according to claim 5, characterized in that, The PCR reaction program was as follows: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ final extension for 2 min.

8. The method according to claim 5 or 6, characterized in that, Step 3) includes: sequencing the amplification products to obtain the genotypes of the sites with the polymorphisms, wherein worker bee individuals with the genotype CC or TC have smaller body size and higher heat resistance than worker bee individuals with the genotype TT. Worker bees with the TT genotype have larger body size and greater cold resistance than worker bees with the CC or TC genotypes.

9. Any of the following applications of the SNP marker or its detection reagent as described in claim 1 or 2: (1) Used for early prediction of worker bee size and temperature adaptability; (2) Molecular marker-assisted breeding for worker bee body size and temperature adaptability traits.

10. The application according to claim 9, characterized in that, The bees mentioned are Chinese honeybees.