Molecular marker for identifying plum blossom early pomelo and application of molecular marker

DNA barcodes were designed using specific nucleotide fragments obtained from next-generation sequencing of the early-ripening plum blossom pomelo, solving the accuracy problem in the identification of the early-ripening plum blossom pomelo and enabling precise identification of the pomelo. This is applicable to seedling identification, cultivation raw material testing, and fruit quality traceability, supporting germplasm protection and standardized industrial development in planting areas.

CN122038631APending Publication Date: 2026-05-15FRUIT RES INST OF MEIZHOU ACAD OF AGRI & FORESTRY (MEIZHOU POMELO RES INST OF MEIZHOU ACAD OF AGRI & FORESTRY)
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
FRUIT RES INST OF MEIZHOU ACAD OF AGRI & FORESTRY (MEIZHOU POMELO RES INST OF MEIZHOU ACAD OF AGRI & FORESTRY)
Filing Date
2026-02-27
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Existing technologies cannot quickly, accurately, and specifically identify early-ripening pomelo varieties, especially since morphological identification is greatly affected by the environment and biochemical markers are not stable enough, making it difficult to distinguish closely related varieties, which hinders germplasm protection and the standardized development of the industry.

Method used

We used a second-generation sequencing-based method to obtain specific nucleotide fragments of the early-blooming pomelo, designed DNA barcode molecular markers, identified the early-blooming pomelo through high-throughput sequencing, and achieved accurate identification by comparing and determining the specific nucleotide fragments.

Benefits of technology

It enables precise and standardized identification of early-ripening pomelos, reduces the probability of false positives, and improves the accuracy of identification results. It is applicable to seedling identification, cultivation raw material testing, fruit quality traceability, and planting area surveys, ensuring the purity and consistency of germplasm.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122038631A_ABST
    Figure CN122038631A_ABST
Patent Text Reader

Abstract

The invention provides a molecular marker for identifying plum blossom early grapefruit. The molecular marker comprises two specific DNA (deoxyribonucleic acid) sequences. The invention also provides a method for identifying the early pomelo by using the molecular marker, total DNA (deoxyribonucleic acid) of a sample is extracted, then high-throughput sequencing is performed, sequencing reads are compared to the molecular marker, and if the sequencing reads can completely cover the molecular marker and a consistent sequence which is completely the same as the sequence of the molecular marker is generated, the species of the sample to be detected is judged to be the early pomelo.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a molecular marker for early-blooming pomelo and its application. Background Technology

[0002] pomelo( Citrus maxima The Meihua Early Pomelo is an important specialty fruit tree in southern my country, with a long history of cultivation and extremely high economic value. It is an early-maturing variant selected in 1990 from the Shatang Pomelo orchard in Meihua Village, Bingcun Town, Meixian County, Guangdong Province. The tree is vigorous with a rounded, relatively upright crown; the leaves are oblong-elliptic, relatively large, with blunt tips, and the winged leaves are smaller than those of the Shatang Pomelo, possessing hard, short thorns; the fruit is pear-shaped with a distinct ring at the apex, a yellow surface, small, slightly protruding oil cells, and a relatively smooth surface; it is juicy and melts in the mouth, with neatly arranged juice cells, a rich, refreshing flavor, and a sweet-sour taste, with soluble solids of 9.5%–11%; the average weight of a single fruit is 1200g, and the average number of seeds per fruit is 163. It matures from late September to early October, is relatively resistant to storage, and exhibits good yield and stability.

[0003] China is the origin center of pomelo, possessing the world's richest germplasm resources of the genus *Citrus*, encompassing multiple ecological types such as Shatang pomelo, honey pomelo, Wenzhou pomelo, and early-maturing pomelo, exhibiting extremely rich varietal diversity. However, the genetic background of *Citrus* plants is highly complex. Cross-pollination leads to widespread natural hybridization, and long-term artificial breeding and bud mutation selection have intensified gene infiltration. Furthermore, frequent gene exchange occurs with closely related species. Early-maturing pomelo varieties, represented by Meihua Early Pomelo, are extremely closely related, with genetic differences existing only at a few specific gene loci. Existing identification methods all have limitations: morphological identification is greatly affected by environment and developmental stage, and phenotypes are easily confused with other pomelo varieties; biochemical markers lack stability, making it difficult to distinguish closely related varieties; traditional molecular markers (such as SSR and RAPD) have limited polymorphism, primer specificity and sensitivity are affected by experimental environment, and there is a lack of markers specific to Meihua Early Pomelo, failing to meet the needs of accurate identification.

[0004] In summary, the germplasm diversity and genetic complexity of pomelos make it difficult for existing methods to quickly, accurately, and specifically identify the Meihua Early Pomelo, and to distinguish closely related varieties, seriously hindering its germplasm conservation and standardized industrial development. By conducting comparative analysis of the genomes of the Meihua Early Pomelo and its closely related varieties using high-throughput sequencing technology, and developing a unique nucleotide sequence for the Meihua Early Pomelo as a specific molecular marker, this approach can address the shortcomings of existing technologies in the identification of the Meihua Early Pomelo, and also meet the urgent industrial demand for authenticity verification of the Meihua Early Pomelo. This has significant practical application value and technological innovation significance. Summary of the Invention

[0005] To overcome the aforementioned difficulties in existing early-blooming pomelo identification techniques, this invention employs a next-generation sequencing-based method to obtain early-blooming pomelo (… Citrus maximaTwo specific nucleotide fragments of 'Meihuazao' were verified by genome-wide database alignment analysis. These two fragments showed no high homology with the genomes of other existing species or varieties of the genus 'Meihuazao', making them suitable as reference sequences (DNA barcodes) for the identification of Meihuazao. This invention further utilizes these specific fragments to design a reliable and efficient method for identifying Meihuazao, achieving accurate and standardized identification. The technical solution adopted in this invention is as follows:

[0006] On the one hand, the present invention provides a molecular marker for identifying or assisting in the identification of early-blooming pomelo, the molecular marker being a DNA barcode, the nucleic acid sequence of which is shown in SEQ ID NO:1 and / or SEQ ID NO:2.

[0007] Preferably, the DNA barcode can be used alone or in combination with SEQ ID NO.1 or SEQ ID NO.2; when used in combination, the alignment criteria of the two sequences must be met simultaneously, which can significantly reduce the probability of false positives and improve the accuracy of the identification results.

[0008] On the other hand, the present invention provides the application of the above-mentioned DNA barcode in the identification or auxiliary identification of early-blooming pomelo, specifically including but not limited to:

[0009] 1. Authenticity identification of early-blooming plum seedlings: Used for early identification of early-blooming plum seedlings, solving the problem that traditional morphological identification requires waiting for the reproductive stage of the plant, realizing early screening and identification, and reducing the risk of germplasm mixing in the seedling industry;

[0010] 2. Purity testing of raw materials for early-ripening pomelo cultivation: Used for screening for contamination in the planting of early-ripening pomelo seedlings, ensuring the germplasm uniformity of raw materials for fruit tree cultivation;

[0011] 3. Quality traceability and identification of early-ripening pomelo fruit: Germplasm traceability can be performed on early-ripening pomelo fruit (even if the sample DNA is partially degraded), effectively eliminating the possibility of closely related species of the genus Pomelo being passed off as early-ripening pomelo.

[0012] 4. Germplasm distribution survey of early-ripening pomelo planting areas: Rapidly detect the mixing ratio of early-ripening pomelo in large-scale planting areas, providing accurate data support for germplasm purification and standardized orchard construction.

[0013] On the other hand, the present invention provides a first method for identifying or assisting in the identification of early-blooming pomelo, characterized by comprising the following steps:

[0014] 1) Collect pomelo tissue to be tested as the sample;

[0015] 2) Extract total DNA from the sample to be tested;

[0016] 3) Perform high-throughput sequencing on the total DNA to obtain sequencing reads;

[0017] 4) Assemble the sequencing data and perform BLAST alignment of the assembled contigs with the aforementioned DNA barcodes;

[0018] 5) Perform multiple sequence alignment between the contig that can completely cover the aforementioned DNA barcode and has the highest sequence consistency and the DNA barcode. Determine whether the sample contains early-blooming pomelo based on the alignment results. If the sequence consistency between the contigs and the target DNA barcode is 100% (no base mismatches, insertions, or deletions), the sample is determined to contain early-blooming pomelo. If there is only partial coverage or the sequence consistency is <100%, it is determined to be non-early-blooming pomelo.

[0019] Preferably, in step 4), software such as SPAdes, Velvet, and SOAPdenovo2 can be used to assemble the sequencing data, and in step 5), software such as MAFFT, MUSCLE, MEGA, and DNAMAN can be used to perform multiple sequence alignment.

[0020] On the other hand, the present invention provides a second method for identifying or assisting in the identification of early-blooming pomelo, characterized by comprising the following steps:

[0021] 1) Collect pomelo tissue to be tested as the sample;

[0022] 2) Extract total DNA from the sample to be tested;

[0023] 3) Perform high-throughput sequencing on the total DNA of the above samples to obtain sequencing reads;

[0024] 4) Use bioinformatics software to align the above sequencing reads to the DNA barcode described in this invention;

[0025] 5) Determine whether the sample contains early-maturing pomelo based on the coverage of sequencing reads on the DNA barcode; calculate the coverage of sequencing reads on the target DNA barcode and generate a consistency sequence using software; if the coverage is 100% and the consistency sequence is completely identical to SEQ ID NO.1 and / or SEQ ID NO.2 (without any base differences), the sample is determined to contain early-maturing pomelo; if the coverage is <100% or the consistency sequence differs from SEQ ID NO:1 and / or SEQ ID NO:2 by bases, the sample is determined not to contain early-maturing pomelo.

[0026] Furthermore, for a large number of samples (such as tissues and seedlings from multiple pomelo germplasms), a group screening strategy can be adopted to improve identification efficiency and reduce testing costs. Specifically: a) Divide n samples to be tested into 2 groups, mix them separately to extract total DNA and sequence them; b) Detect whether each group contains Meihua Early Pomelo according to steps 4)-5) above, and locate the positive group; c) Repeat the dichotomy method for the positive group samples, mix and sequence and test until a single sample containing Meihua Early Pomelo is identified. This strategy is suitable for large-scale sample screening in nurseries and planting bases and can significantly reduce sequencing costs.

[0027] In one embodiment of the present invention, in step 3) of the above two identification methods, the high-throughput sequencing is second-generation sequencing or third-generation sequencing, preferably with a sequencing data depth greater than 10×.

[0028] In one embodiment of the present invention, step 4) can use any of the software Minimap2, Geneious, Bowtie, Tophat, or HISAT to compare the sequencing reads with the DNA barcode.

[0029] In one embodiment of the present invention, the identification of the early-blooming pomelo can be completed by using any one of SEQ ID NO.1 ~ SEQ ID NO.2 alone, or the identification can be completed by using SEQ ID NO.1 ~ SEQ ID NO.2 in combination.

[0030] Preferably, in any of the foregoing schemes, the identification or auxiliary identification of Meihua Early Pomelo means that Meihua Early Pomelo can be identified from at least one or more of the following pomelo varieties: .

[0031] The beneficial effects of this invention are:

[0032] This invention is the first to obtain a specific DNA barcode molecular marker for early-blooming pomelo and designs a high-throughput sequencing identification method based on this molecular marker, effectively solving many problems in the identification of early-blooming pomelo using existing technologies. Compared with existing technologies, it has the following core beneficial effects:

[0033] High specificity: The specific nucleotide fragments of Pomelo fraga var. mala ...

[0034] Wide applicability: Based on high-throughput sequencing, this invention can directly detect mixed samples (such as mixed seedlings, tissues, and processed products) without the need for individual plant isolation, making it suitable for industrial applications such as batch screening of seedlings and germplasm resource surveys.

[0035] Simple to operate: This invention does not require the design of specific PCR primers, avoiding the problems of strong primer dependence, sensitivity to reaction conditions and poor repeatability in traditional PCR technology. The detection process is highly standardized and facilitates stable reproducibility between different laboratories.

[0036] High accuracy: The molecular markers of this invention support two modes: single marker detection and dual marker joint verification. When dual markers are used together, the comparison and judgment conditions of two specific sequences must be met simultaneously, which can further reduce the false positive error of identification. The accuracy and reliability of the identification results are greatly improved, meeting the needs of precise identification and traceability of germplasm. Attached Figure Description

[0037] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments.

[0038] Figure 1 This is the alignment result of the molecular marker SEQ ID NO.1 of Pomelo 'Meihuazao' in the NCBI nr / nt library.

[0039] Figure 2 It is the sequence with the highest overall alignment score of the molecular marker SEQ ID NO.1 of Pomelo 'Meihuazao' in the NCBI nr / nt library.

[0040] Figure 3 This is the alignment result of the molecular marker SEQ ID NO.2 of Pomelo 'Meihuazao' in the NCBI nr / nt library.

[0041] Figure 4 It is the sequence with the highest overall alignment score of the molecular marker SEQ ID NO.2 of Pomelo 'Meihuazao' in the NCBI nr / nt library.

[0042] Figure 5 This is the first group of samples containing early-ripening pomelo to show coverage results on the SEQ ID NO.1 sequence.

[0043] Figure 6 This is the first group of samples containing early-ripening pomelo to show coverage results on the SEQ ID NO.2 sequence.

[0044] Figure 7 This is the coverage result of the second group of samples containing early-ripening pomelo on the SEQ ID NO.1 sequence.

[0045] Figure 8This is the coverage result of the second group of samples containing early-ripening pomelo on the SEQ ID NO.2 sequence.

[0046] Figure 9 This is the first group of samples that do not contain early-ripening pomelo to cover the sequence of SEQ ID NO.1.

[0047] Figure 10 This is the first group of samples that do not contain early-ripening pomelo, and the result of the coverage of the SEQ ID NO.2 sequence.

[0048] Figure 11 This is the coverage result of the second group of samples that do not contain early-ripening pomelo on the SEQ ID NO.1 sequence.

[0049] Figure 12 This is the coverage result of the second group of samples that do not contain early-ripening pomelo on the SEQ ID NO.2 sequence.

[0050] Figure 13 This is the comparison result of the contig assembled from two groups of samples containing early-ripening pomelo with SEQ ID NO.1.

[0051] Figure 14 This is the comparison result of the contig assembled from two groups of samples containing early-ripening pomelo with SEQ ID NO.2. Detailed Implementation

[0052] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, specific experimental methods can be used in the following examples.

[0053] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0054] Example 1: Molecular markers for early-blooming pomelo

[0055] This invention, through high-throughput sequencing assembly and comparative analysis, determined the standard detection sequence for the molecular marker of early-blooming pomelo, specifically the following sequence:

[0056] SEQ ID NO.1:

[0057] CGAAGGCTGGGGCGCCAAGTTCGTCCAGCGGAAAAAGGCCACAAAAACGGGTGGGCTATAGCCTTGGGGGGTGGGGCTGGCCACCTTCGTCCGCTGGACTCGGAATGGTTGCGAGGCGTCTCTGTGTGCCAAAAATAGGCCACGGGCACAGCCGCGCCCAAAAATAACCGCCCGAAGGCCGGGGCGCCAAGTTCGTCCGGCGGAAAAAGGCCACAAAAACGGGTGGGCTATAGCCTTGGGGGGTGGGGCTGCCCACCTTCGACTACCGGACTCGGAATGGCGCGAGACTTTGCGAGGTTCCTCCGTGTGCCAAAAATACGCCGCGGGGACAGCCGCGTCCAAAAAAAACGCCCGAAGGCCGGGGCGCCAAGTTCGTCCAGCGGAAAAAGGCCACAAAAACGGGTGGGCTATAGCCTTGGGGGGTGGGGCTGGCCAACTTCTTCCGCCGGACTCGGAATGGTGCGAGACTTTGCGAGGCGCCTCCTTGTGCAAAAAATAGG

[0058] SEQ ID NO.2:

[0059] CGGGACGGGCTATAGCCTTGGGGGGTGGGGCTGGCCCACTTCGTCCGCCGGACTCGGAATGGCGCGAGACTTTGCGAGTGGCCTCCGTATGCCAAAAATAGGCCGCGGGCACAGCCGCGCCCAAAAATAACCGCCCGAAGGCCGGGGCGCCAAGTTCGTCCAGCGGAAAAAGGCCACAAAAACGGGTGGGCTTTAGCCTTGGGGGGTGGGGCTGGCCAACTTCGCCCGCCGGACTCAGAATGGCGCAAGA CTATGCGAAGGCCTTCGTGTGCCGAAAATAGACTGCGGGCACAGCCGCGCCCAAAAATAACCGCCCGAAGGCCAGGGCGCCAAGTTCGTCCAGCGGAAAATAGCCACAAAAACGGGTGGGCTATAGCCTTGGGGGGTGGGCTGGCCAACTTCATCCGCCGGACTCGGAATGGCGCGAGACTTTGCGAGGCGCCTCCGTGAGCCAAAAGTAGGCCGCGGGCACAGCCGCGCCCAAAAACCGCCCGA

[0060] Example 2: Molecular markers of early-ripening pomelo and sequence alignment with closely related species

[0061] To determine the species specificity of the molecular markers described in this invention, they were submitted to NCBI for online BLAST alignment. The nr / nt library was selected, with no species limitation, and the "More dissimilar sequences" parameter was chosen. Figures 1-4 As shown, the molecular marker described in this invention was found to be closely related to plants of the genus *Citrus* in the NCBI nr / nt library. Figure 1 The top 100 sequences showing high similarity to SEQ ID NO.1 do not include any sequences from Citrus maxima. The highest similarity is to sequence XR_008051163.1 from Citrus sinensis, but the similarity is only 81.82%. Figure 2 The sequence SEQ ID NO.1 and XR_008051163.1 show a large number of indels, and there are 4 matching similar intervals between SEQ ID NO.1 and XR_008051163.1. Figure 3Only 17 sequences were found to be similar to SEQ ID NO.2. No sequences were found from Citrus maxima. The highest similarity was from Citrus cavaleriei, sequence Z77677.1, but the similarity was only 95.58%, and the coverage of SEQ ID NO.2 was only 97%. Figure 4 The sequence SEQ ID NO.2 shows a similarity match with the Z77677.1 sequence in 3 regions.

[0062] As can be seen from the above analysis, the two molecular marker sequences of this application are highly specific for early-maturing pomelo.

[0063] Example 3: Validating the specificity of markers using assembled genomes

[0064] Forty-one citrus genomes were downloaded from the citrus pangenome database. Using the minimap2 software with default parameters, the sequences SEQ ID NO.1 and SEQ ID NO.2 were aligned to these 41 genomes. The results showed that no sequences could be aligned to any of the 41 genomes. This further demonstrates that SEQ ID NO.1 and SEQ ID NO.2 are highly specific molecular markers for the early-blooming pomelo.

[0065] The gene versions for comparison are as follows: Citrus grandis (L.) Osbeck.cv. 'Wanbaiyou' v1.0, Citrus sinensis v1.0, Citrus sinensis v2.0, Citrus sinensis v3.0, Atalantia buxfoliata v1.0, Atalantia buxfoliata v2.0, Fortunella hindsiiv1.0, Fortunella hindsii v2.0, Citrus reticulata v1.0, Citrus medica v1.0, Citrus ichangensis v1.0, Citrus ichangensis v2.0, Poncirus trifoliata v1.0, Citrus clementina v1.0, Citrus grandis (L.) Osbeck.cv.'Cupi Majiayou' v1.0, Clausena lansium v1.0, Citropsis gilletiana v1.0, Aegle marmelos v1.0, Luvungascandens v1.0, Murraya paniculata v1.0, Citrus mangshanensis v1.0, Citruslinwuensis v1.0, Citrus australasica v1.0, Citrus hongheensis v1.0, Citrusmaxima 'Xipi Majia' v1.0, Citrus maxima 'Huazhouyou-tomentosa' v1.0 (HZY-T), Citrus sinensis 'Jinhong Bingtang' (BTC.v1.0), Citrus reticulata 'Mangshan', Citrus reticulata 'Ponkan', Mandarin haplotype of Citrus sinensis 'Valencia'(T2T genome), Pummelo haplotype of Citrus sinensis 'Valencia' (T2T genome), Natural hybrid orange 'TJH2', Mandarin haplotype of Citrus aurantium 'ZGSC'(T2T genome), Pummelo haplotype of Citrus aurantium 'ZGSC' (T2T genome), Citrus maxima 'Zipi', Citrus reticulata 'Nanfengmiju', Citrus maxima 'Pingshan' (T2Tgenome), Citrus maxima 'Shatian', Citrus reticulata 'Unshiu' (updateannotation), Citrus reticulata 'Ponkan' (old version), C. reticulata 'Chachiensis'. .

[0066] Example 4: Method 1 for identifying early-ripening pomelos

[0067] 1) Collect pomelo tissue as the sample to be tested;

[0068] 2) Extract total DNA from the sample to be tested;

[0069] 3) Perform second-generation high-throughput sequencing on the total DNA of the above samples to obtain sequencing reads (sequencing depth ≥10×).

[0070] 4) Using Geneious software, the sequencing reads were aligned to the molecular markers described in Example 1, with base mismatches set to <=1%, and only reads with both ends aligned were aligned.

[0071] 5) Determine whether the sample contains Pomelo 'Meihua' based on the coverage of sequencing reads on the molecular markers; if the molecular markers are completely covered and a consistent sequence that is completely identical to the molecular markers can be generated, then the species of the sample to be tested is determined to include Pomelo 'Meihua'.

[0072] 6) If multiple sample sequencing reads are grouped and mixed in step 4), then step 6) further includes dividing the samples containing early-blooming pomelo into two groups, mixing the sequencing reads separately, and repeating step 5) until individual samples of early-blooming pomelo are identified.

[0073] The information for the first group of samples that did not contain early-blooming pomelo is shown in Table 1. The second group of samples that did not contain early-blooming pomelo consisted of second-generation sequencing data downloaded from NCBI, specifically from PRJNA318855 and PRJNA993172. The samples that contained early-blooming pomelo were obtained by mixing the sequencing data of one early-blooming pomelo sample from each of the two groups of samples that did not contain early-blooming pomelo.

[0074] Test results as follows Figures 5-12 As shown (red background bases represent A, green background bases represent T, yellow background bases represent G, and blue background bases represent C), where... Figures 5-8 The sample contains early-ripening pomelo. The figure shows that the sequencing reads completely cover the reference sequence (i.e., the molecular marker SEQ ID NO.1~2 described in this invention) and generate a consistent sequence that is exactly the same as the molecular marker sequence. Figures 9-12 Samples without early-ripening pomelo (Prunus mume) Figures 9-12 (For illustrative purposes only, base symbols are not specifically shown.) The figure shows that read coverage on the reference sequence is incomplete, and a consensus sequence that is completely identical to the molecular marker sequence cannot be generated (the black horizontal line within the red box in the consensus sequence indicates that the site is a gap; the absence of lines within the red box indicates that no reads were aligned at the end of the sequence; the colored sites in the consensus sequence within the red box are polymorphic base sites). The above results indicate that the method of the present invention can accurately identify early-ripening pomelo.

[0075] Table 1. Information on samples from the first group that do not contain early-ripening pomelos.

[0076]

[0077] Example 5: Method 2 for identifying early-ripening pomelos

[0078] 1) Collect pomelo tissue to be tested as the sample;

[0079] 2) Extract total DNA from the sample to be tested;

[0080] 3) Perform high-throughput sequencing on the total DNA to obtain sequencing reads;

[0081] 4) Assemble the sequencing data and perform BLAST alignment of the assembled contigs with the molecular markers described in Example 1;

[0082] 5) Perform multiple sequence alignment (using software such as MAFFT, MUSCLE, MEGA, DNAMAN, etc.) on the contigs that can completely cover the molecular markers described in SEQ ID NO.1 or SEQ ID NO.2 and have the highest sequence identity with the corresponding molecular markers. Determine whether the sample is a Meihua Early Pomelo based on the alignment results. If the contigs are consistent with the molecular marker sequences, the sample to be tested is determined to be a Meihua Early Pomelo sample.

[0083] Test results as follows Figures 13-14 As shown (red text indicates A, green text indicates T, yellow text indicates G, and blue text indicates C), both sets of early-blooming pomelo samples (S1 and S2) can generate contigs that are completely identical to the molecular marker (DNA barcode) sequence. However, the second-generation sequencing data from non-early-blooming pomelo samples in Example 4 could not assemble into homologous sequences with SEQ ID NO.1 and SEQ ID NO.2 (or were too short and scattered across different contigs, making it impossible to define homologous sequences), and therefore are not shown.

[0084] Based on the disclosure and teachings of the foregoing specification, those skilled in the art can make appropriate changes and modifications to the above embodiments. Therefore, the present invention is not limited to the specific embodiments disclosed and described above, and some modifications and changes to the present invention should also fall within the protection scope of the claims of the present invention. Furthermore, although some specific terms are used in this specification, these terms are only for convenience of explanation and do not constitute any limitation on the present invention.

Claims

1. A molecular marker for identifying or assisting in the identification of early-blooming pomelo, characterized in that, The molecular marker is a DNA barcode, and the nucleotide sequence of the DNA barcode is shown in SEQ ID NO.1 and / or SEQ ID NO.

2.

2. A method for identifying or assisting in the identification of early-blooming pomelo, characterized in that... Includes the following steps: 1) Collect the plant tissue to be tested as the sample; 2) Extract total DNA from the sample to be tested; 3) Perform high-throughput sequencing on the total DNA to obtain sequencing reads; 4) Assemble the sequencing data and perform BLAST alignment of the assembled contigs with the molecular markers described in claim 1; 5) Perform multiple sequence alignment between the contig that can completely cover the molecular marker of claim 1 and has the highest sequence consistency with the molecular marker, and the molecular marker of claim 1. Determine whether the sample contains early-blooming pomelo based on the alignment results. If it can completely match the sequence of the molecular marker of claim 1, it is determined that the sample to be tested contains early-blooming pomelo.

3. A method for identifying or assisting in the identification of early-blooming pomelo, characterized in that... Includes the following steps: 1) Collect the plant tissue to be tested as the sample; 2) Extract total DNA from the sample to be tested; 3) Perform high-throughput sequencing on the total DNA of the above samples to obtain sequencing reads; 4) Align the above sequencing reads to the molecular marker described in claim 1; 5) Determine whether the sample contains Pomelo 'Meihua' based on the coverage of sequencing reads on the molecular marker; if the molecular marker is completely covered and a consistent sequence identical to the molecular marker is generated, it is determined that the species of the sample to be tested contains Pomelo 'Meihua'.

4. The method for identifying or assisting in the identification of early-blooming pomelo as described in claim 3, characterized in that, In step 4), multiple sample sequencing reads are grouped and mixed. This further includes step 6), where samples containing early-blooming pomelo are further divided into two groups, and sequencing reads are mixed separately. Step 5) is repeated until a single sample containing early-blooming pomelo is identified.

5. The method for identifying or assisting in the identification of early-blooming pomelo as described in any one of claims 2 to 4, characterized in that, The high-throughput sequencing mentioned in step 3) is either second-generation sequencing or third-generation sequencing.

6. The method for identifying or assisting in the identification of early-blooming pomelo as described in any one of claims 3 to 4, characterized in that, Step 4) Use any one of the following software, Geneious, Minimap2, Bowtie, Tophat, or HISAT, to compare the reads.

7. The application of the molecular marker as a reference sequence in the identification or auxiliary identification of early-ripening pomelo as described in claim 1.