High-throughput KASP molecular marker remarkably related to cotton fiber quality and application

Abstract

The invention discloses a high-throughput KASP molecular marker remarkably related to cotton fiber quality and application, and belongs to the technical field of cotton molecular breeding. The KASP molecular marker comprises one or two of GhMYB2-KASP and GhKNL1-KASP, and the KASP molecular marker comprises one or two of GhMYB2-KASP and GhKNL1-KASP. According to the invention, two KASP molecular markers significantly related to cotton fiber quality are identified and verified, and a new molecular marker resource is provided for screening cotton varieties with excellent fiber quality; the complete set of KASP molecular markers, the primers thereof and a developed KASP detection system provided by the invention can realize rapid and high-throughput detection of the cotton fiber quality, and are not influenced by the environment; the marker can be directly applied to screening of cotton breeding early-generation materials, the breeding selection efficiency is improved, and the breeding cost is reduced.

Description

Technical Field

[0001] This invention relates to the field of cotton molecular breeding technology, and in particular to a high-throughput KASP molecular marker that is significantly related to cotton fiber quality and its application. Background Technology

[0002] Cotton is an irreplaceable natural fiber raw material for the textile industry, with significantly superior moisture absorption, breathability, warmth retention, and softness compared to synthetic fibers. Fiber quality is determined by five key indicators: length, strength, micronaire value, uniformity, and elongation. These indicators are interrelated and directly affect spinning efficiency and yarn quality. Insufficient self-sufficiency in high-quality raw cotton, coupled with heavy reliance on imports, has become a bottleneck restricting the upgrading of the textile industry and its export competitiveness. The production of high-quality cotton promotes the standardization and refinement of agriculture, enhancing the sustainable development potential of the cotton industry. Therefore, improving cotton fiber quality and developing related molecular markers have significant research value and production implications.

[0003] Cotton fiber quality is a typical complex quantitative trait, its expression being jointly regulated by external environmental factors and internal fiber development processes. Traditional breeding methods mainly rely on hybridization combinations and phenotypic selection. This approach is not only time-consuming, but also suffers from insufficient selection accuracy and limited genetic gain due to the susceptibility of phenotypes to cultivation environment interference, resulting in overall low selection efficiency. Existing technologies are no longer sufficient to meet the urgent need for efficient and precise improvement of cotton fiber quality.

[0004] Kompetitive allele-specific PCR (KASP) is a fluorescence-based SNP genotyping technique. It achieves precise bicelestem identification of target SNP loci by combining allele-specific primers with universal fluorescent probes. This technique eliminates the need for site-specific probes, allowing detection using a conventional PCR instrument. It offers significant advantages such as accurate genotyping, low cost, flexible throughput, and the elimination of the need for gel electrophoresis. Currently, KASP is widely used in variety identification, genetic mapping, genetic diversity analysis, and marker-assisted selection.

[0005] Combining molecular marker-assisted breeding with traditional breeding can significantly shorten the cycle and improve selection efficiency. However, the current lack of reliable and effective functional markers severely restricts the development of molecular marker-assisted breeding for cotton fiber quality. With the development of cotton genomics, a large number of fiber quality-related genes, QTLs, and SNP allelic variations have been discovered and identified. However, the number of developed and validated KASP markers is still limited and insufficient to fully meet the design and selection needs of efficient molecular breeding. Summary of the Invention

[0006] The purpose of this invention is to provide a high-throughput KASP molecular marker and its application that is significantly related to cotton fiber quality, in order to solve the problems existing in the prior art. The complete set of KASP molecular markers and their primers and the developed KASP detection system provided by this invention can realize rapid and high-throughput detection of cotton fiber quality, which is not affected by the environment. The marker can be directly applied to the screening of early generation cotton breeding materials, improving the efficiency of breeding selection and reducing breeding costs.

[0007] To achieve the above objectives, the present invention provides the following solution: This invention provides a high-throughput KASP molecular marker that is significantly associated with cotton fiber quality, including one or both of GhMYB2-KASP and GhKNL1-KASP; The nucleotide sequence of the GhMYB2-KASP is shown in SEQ ID NO.1, and a T / C mutation exists at position 996 of this sequence; The nucleotide sequence of GhKNL1-KASP is shown in SEQ ID NO.2, and a C / G mutation exists at position 20 of this sequence.

[0008] Optionally, in GhMYB2-KASP, cotton carrying the CC genotype has higher fiber quality than cotton carrying the TT genotype. In GhKNL1-KASP, cotton carrying the GG genotype has higher fiber quality than cotton carrying the CC genotype. When both GhMYB2-KASP and GhKNL1-KASP are present, the fiber quality of cotton carrying the CC and GG genotypes is higher than that of cotton carrying the TT and CC genotypes.

[0009] Optionally, the fiber quality includes fiber length and fiber strength.

[0010] The present invention also provides KASP primers for specifically detecting the KASP molecular marker. The KASP primers for detecting GhMYB2-KASP consist of an upstream competing primer 1 with a nucleotide sequence as shown in SEQ ID NO.3, an upstream competing primer 2 with a nucleotide sequence as shown in SEQ ID NO.4, and a universal downstream primer with a nucleotide sequence as shown in SEQ ID NO.5. The KASP primers for detecting GhKNL1-KASP consist of an upstream competing primer 1 with a nucleotide sequence as shown in SEQ ID NO.6, an upstream competing primer 2 with a nucleotide sequence as shown in SEQ ID NO.7, and a universal downstream primer with a nucleotide sequence as shown in SEQ ID NO.8.

[0011] The present invention also provides reagents or kits containing the KASP primers.

[0012] This invention also provides the use of the KASP primers or the reagents or kits described herein in any of the following: (1) To detect or assist in the detection of cotton fiber quality; (2) To prepare products for testing or assisting in the testing of cotton fiber quality; (3) Select cotton varieties with high fiber quality; (4) Prepare cotton germplasm with high fiber quality.

[0013] The present invention also provides a method for detecting the quality of cotton fibers, comprising the following steps: Using the genome of the sample to be tested as a template, the template is amplified by PCR using the KASP primers to obtain the genotyping results, and the genotyping results are used for judgment. In GhMYB2-KASP, cotton carrying the CC genotype has higher fiber quality than cotton carrying the TT genotype. In GhKNL1-KASP, cotton carrying the GG genotype has higher fiber quality than cotton carrying the CC genotype. When both GhMYB2-KASP and GhKNL1-KASP are present, the fiber quality of cotton carrying the CC and GG genotypes is higher than that of cotton carrying the TT and CC genotypes.

[0014] Optionally, the fiber quality includes fiber length and fiber strength.

[0015] Optionally, the PCR amplification reaction system consists of: 2 μL DNA template, 3 μL 1×Master Mix, and 0.04 μL KASP primers; The KASP primers are a mixture of upstream competing primer 1, upstream competing primer 2, and universal downstream primer in a volume ratio of 1:1:1.

[0016] Optionally, the PCR amplification reaction program is as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 65℃~57℃ annealing and extension for 60 s, 10 cycles; 94℃ denaturation for 20 s, 55℃ annealing and extension for 60 s, 30 cycles.

[0017] The present invention discloses the following technical effects: This invention employs maximum likelihood estimation to perform meta-analysis on collected QTLs and spectral information related to fiber quality traits, constructing a cotton fiber quality QTL consistency map and obtaining MQTLs related to fiber quality traits. Using the TM-1 genome assembled by Nanjing Agricultural University as a reference genome, the physical locations of MQTLs are determined as candidate regions. Combined with genes related to cotton fiber quality traits collected from online databases and reported in the literature, key candidate genes related to cotton fiber quality are identified. Based on SNP variations in gene sequences, specific KASP molecular markers are developed, providing a reliable molecular breeding tool for screening cotton germplasm with superior fiber quality.

[0018] This invention identifies and verifies two KASP molecular markers that are significantly associated with cotton fiber quality, providing new molecular marker resources for screening cotton varieties with superior fiber quality. The complete set of KASP molecular markers and their primers provided by this invention, along with the developed KASP detection system, enables rapid and high-throughput detection of cotton fiber quality, unaffected by the environment. These markers can be directly applied to the screening of early-generation cotton breeding materials, improving breeding selection efficiency and reducing breeding costs. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 Phenotypic distribution of fiber quality traits (length FL and strength FS) for 236 cotton varieties under three environmental conditions; Figure 2 Genotyping results for GhMYB2-KASP and GhKNL1-KASP markers; Figure 3 Significance analysis of fiber quality for different genotypes; Left: GhMYB2-KASP analysis; Right: GhKNL1-KASP analysis; Figure 4 This is a significance analysis plot of fiber quality (length FL and strength FS) when two variations exist simultaneously. Detailed Implementation

[0021] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0022] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0023] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0024] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0025] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0026] Example 1: Acquisition of SNP sites First, QTL data and their mapping information related to fiber length and strength were collected from the cotton QTL database and the cotton genome database, and organized according to the format required by Biomercator 4.2 software. The QTL information included at least the QTL name, chromosome location, peak position and confidence interval, flanking markers, LOD value, and phenotypic explained variance; when the peak position was missing, the midpoint of the two flanking markers was used as the peak. After selecting a reference map, QTLs from different sources were mapped to this map, and only QTLs corresponding to markers common to the reference map and in the same order were retained. Furthermore, using the high-density genetic map containing 8254 marker loci constructed by Blenda et al. (Blenda A, Fang DD, Rami JF, et al. A High Density Consensus Genetic Map of Tetraploid Cotton That Integrates Multiple Component Maps through Molecular Marker Redundancy Check[J]. PLoS ONE, 2012, 7(9) 45739.) as a reference map, the QTL map and the reference map were loaded using Biomercator 4.2 software. Common molecular markers were used for mapping and integration to construct a consistency map. Subsequently, the software was used to perform meta-analysis on multiple fiber quality trait-related QTLs within the same chromosomal region. The optimal QTL model, i.e., Meta-QTL, was determined based on the minimum Akaike information criterion through model comparison, and its most probable location and confidence interval were given. For QTLs lacking confidence intervals, they could be estimated using corresponding formulas based on population type and genetic contribution rate. Finally, reliable meta-QTLs with confidence intervals less than 2 cM, phenotypic explained variance greater than 20%, and LOD values ​​higher than 14 were selected.

[0027] We collected genes related to cotton fiber quality reported over the past decade from academic websites such as Web of Science (https: / / www.webofscience.com / ) and NCBI PubMed (https: / / pubmed.ncbi.nlm.nih.gov / ), and compiled the collected information, obtaining 159 genes.

[0028] Using the SSR database in Cottongen, the physical locations of the linkage markers at both ends of MQTL can be obtained, or the linkage marker sequences at both ends of MQTL can be obtained and aligned with the TM-1 genome assembled by Nanjing Agricultural University (https: / / yanglab.hzau.edu.cn / CottonMD / download.1) to determine the physical location of MQTL.

[0029] Using the physical location of MQTL as a candidate region, and combining it with previously reported candidate genes related to fiber development within this region, two key genes on chromosome A08 in the MQTL.73 region were ultimately identified: GhMYB2 and GhKNL1.

[0030] Using resequencing data, SNP mutation sites were obtained in the upstream 2000 bp region and within the body region of the gene. A T / C mutation (SNP1) was found 19 bp upstream of the GhMYB2 promoter, and a C / G mutation (SNP2) was found 20 bp in the GhKNL1 coding region. Based on these mutations, KASP markers were developed: 200 bp sequences upstream and downstream of the two SNPs were extracted according to their physical locations. Original KASP primers were designed using SNPway, and specific KASP markers for the two SNPs were obtained through ePCR and BLAST screening. The nucleotide sequences of molecular markers SNP1 (GhMYB2-KASP) and SNP2 (GhKNL1-KASP) are as follows: SEQ ID NO.1 (nucleotide sequence of SNP1): In this context, Y in 996bp represents T / C.

[0031] SEQ ID NO.2 (nucleotide sequence of SNP2): In this case, S in 20bp represents C / G.

[0032] The two specific marker primers are as follows: GhMYB2-KASP (SNP1) primer set: consists of 3 primers: upstream competing primer 1 (primer1): GAAGGTG ACCAAGTTCATGCT CTGCTTCATTAACCGCCAAACTCT (SEQ ID NO.3), upstream competing primer 2: G AAGGTCGGAGTCAACGGATT CTGCTTCATTAACCGCCAAACTCC (SEQ ID NO.4), universal downstream primer (primer3): CAAGGGAAGGGAAGTGAATGAGTA (SEQ ID NO.5).

[0033] GhKNL1-KASP (SNP2) primer set: consists of 3 primers: upstream competing primer 1 (primer1): GAAGGTG ACCAAGTTCATGCT GAAATGCAAGAACCAGGGTTAGC (SEQ ID NO.6), upstream competing primer 2: GA AGGTCGGAGTCAACGGATT GAAATGCAAGAACCAGGGTTAGG (SEQ ID NO.7), universal downstream primer (primer3): CTTAACCCTCCAATTCCACCACTC (SEQ ID NO.8).

[0034] In this context, the underlined part of upstream competing primer 1 is the FAM fluorescent tag, and the underlined part of upstream competing primer 2 is the HEX fluorescent tag.

[0035] Example 2: Validation and Application of KASP Tags Table 2 shows the information for 236 cotton germplasm accessions. All samples were provided by the Cotton Research Institute of the Chinese Academy of Agricultural Sciences, including 32 foreign varieties and 204 domestic varieties. Of the 204 domestic varieties, 54 were from the Yellow River cotton-growing region, 49 from the Northwest inland cotton-growing region, 45 from the northern extra-early maturing cotton-growing region, 30 from the Yangtze River cotton-growing region, and 26 local varieties. The effectiveness of the KASP marker was further validated using these 236 germplasm resources.

[0036] All experimental materials were planted in the Dongchang Experimental Field of the Cotton Research Institute of the Chinese Academy of Agricultural Sciences in Anyang City, Henan Province in 2020, 2021 and 2022. A randomized block design was adopted, with a row length of 5 m, a row spacing of 0.8 m and a plant spacing of 0.25 m, and 3 replicates. Field management was carried out in accordance with local field production management.

[0037] The fiber quality phenotypic analysis of 236 cotton varieties over three consecutive years was conducted using the same Uster HVI1000 high-capacity fiber analyzer at the Cotton Quality Supervision and Testing Center of the Ministry of Agriculture and Rural Affairs. Before testing, the instrument was calibrated using HVICC standard cotton samples, and the lint fiber samples obtained from roller ginning were equilibrated for 48 hours in a constant temperature and humidity laboratory environment at 20℃ and 65% relative humidity. During testing, to ensure the reliability of the test data, each sample was measured four times, and the average value was taken.

[0038] The average fiber length of the 236 tested cotton varieties under three environmental conditions in 2020, 2021, and 2022 was 27.69 mm, 28.70 mm, and 28.38 mm, respectively, with coefficients of variation of 5.71%, 5.81%, and 5.92%. The average fiber strength was 27.61 cN / tex, 26.38 cN / tex, and 31.39 cN / tex, respectively, with coefficients of variation of 11.33%, 10.24%, and 8.92% (Table 1). Figure 1 ).

[0039] Table 1. Statistical analysis of five fiber quality traits in 236 cotton varieties under three different environmental conditions. DNA was extracted using a modified CTAB method, and the diluted DNA was transferred from a 96-well plate to a 384-well plate using the Backman high-throughput molecular detection platform.

[0040] Centrifuge the 384-well plate containing DNA at low speed in a plate centrifuge at room temperature, and then dry it in a 55°C oven for 1 hour.

[0041] The dried DNA was used to construct the PCR system using the Meridian PCR system separator. A 5.04 μL KASP reaction system was prepared: 2 μL 30 ng / μL DNA, 3 μL 1×Master mix, and 0.04 μL 100 μmol / L KASP primers (the three primers were dissolved and mixed in a volume ratio of 1:1:1.2).

[0042] The 384-well plate containing the reaction system was sealed using a plate sealing device and then centrifuged at low speed using a plate centrifuge at room temperature.

[0043] After centrifugation, water bath PCR was performed in a Hydrocycler PCR instrument. The reaction program was as follows: pre-denaturation at 94℃ for 15 min. Step 1 amplification reaction: denaturation at 94℃ for 20 s, annealing and extension at 65℃~57℃ for 60 s, 10 cycles. Step 2 amplification reaction: denaturation at 94℃ for 20 s, annealing and extension at 55℃ for 60 s, 30 cycles.

[0044] After the reaction was completed, the 384-well plate was centrifuged again at low speed and then dried using a plate centrifuge at room temperature. The plate was then read on a Pherastar plate to obtain the genotyping results. Figure 2 ).

[0045] Association analysis between genotype data and three-year average phenotypic data confirmed that, in the GhMYB2-KASP marker, the fibers carrying the "CC" allele had an average increase in fiber length of 1.19 mm and an average increase in fiber strength of 2.88 cN / tex compared to the fibers carrying the corresponding "TT" allele; in the GhKNL1-KASP marker, the fibers carrying the "GG" allele had an average increase in fiber length of 0.89 mm and an average increase in fiber strength of 2.36 cN / tex compared to the fibers carrying the corresponding "CC" allele. Figure 3 When carrying two allelic variations simultaneously, the fibers of materials carrying the "CC" and "GG" allelic variations have an average increase in fiber length of 1.28 mm and an average increase in fiber strength of 3.22 cN / tex compared to materials carrying their corresponding allelic variations "TT" and "CC". Figure 4 Both are significantly correlated with cotton fiber quality, providing technical support for molecular marker-assisted upland cotton breeding.

[0046] Table 2. Names and typographic information of 236 cotton germplasm accessions Note: NA indicates no classification results.

[0047] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A high-throughput KASP molecular marker significantly correlated with cotton fiber quality, characterized in that, Including one or both of GhMYB2-KASP and GhKNL1-KASP; The nucleotide sequence of the GhMYB2-KASP is shown in SEQ ID NO.1, and a T / C mutation exists at position 996 of this sequence; The nucleotide sequence of GhKNL1-KASP is shown in SEQ ID NO.2, and a C / G mutation exists at position 20 of this sequence.

2. The KASP molecular marker as described in claim 1, characterized in that, In GhMYB2-KASP, cotton carrying the CC genotype has higher fiber quality than cotton carrying the TT genotype. In GhKNL1-KASP, cotton carrying the GG genotype has higher fiber quality than cotton carrying the CC genotype. When both GhMYB2-KASP and GhKNL1-KASP are present, the fiber quality of cotton carrying the CC and GG genotypes is higher than that of cotton carrying the TT and CC genotypes.

3. The KASP molecular marker as described in claim 1, characterized in that, The fiber quality includes fiber length and fiber strength.

4. A KASP primer for specific detection of the KASP molecular marker according to any one of claims 1-3, characterized in that, The KASP primers for detecting GhMYB2-KASP consist of upstream competing primer 1 with the nucleotide sequence shown in SEQ ID NO.3, upstream competing primer 2 with the nucleotide sequence shown in SEQ ID NO.4, and a universal downstream primer with the nucleotide sequence shown in SEQ ID NO.

5. The KASP primers for detecting GhKNL1-KASP consist of an upstream competing primer 1 with a nucleotide sequence as shown in SEQ ID NO.6, an upstream competing primer 2 with a nucleotide sequence as shown in SEQ ID NO.7, and a universal downstream primer with a nucleotide sequence as shown in SEQ ID NO.

8.

5. A reagent or kit containing the KASP primers of claim 4.

6. The use of the KASP primer as described in claim 4 or the reagent or kit as described in claim 5 in any of the following: (1) To detect or assist in the detection of cotton fiber quality; (2) To prepare products for testing or assisting in the testing of cotton fiber quality; (3) Select cotton varieties with high fiber quality; (4) Prepare cotton germplasm with high fiber quality.

7. A method for detecting the quality of cotton fibers, characterized in that, Includes the following steps: Using the genome of the sample to be tested as a template, PCR amplification of the template is performed using the KASP primers described in claim 4 to obtain genotyping results, and judgment is made based on the obtained genotyping results; In GhMYB2-KASP, cotton carrying the CC genotype has higher fiber quality than cotton carrying the TT genotype. In GhKNL1-KASP, cotton carrying the GG genotype has higher fiber quality than cotton carrying the CC genotype. When both GhMYB2-KASP and GhKNL1-KASP are present, the fiber quality of cotton carrying the CC and GG genotypes is higher than that of cotton carrying the TT and CC genotypes.

8. The method as described in claim 7, characterized in that, The fiber quality includes fiber length and fiber strength.

9. The method as described in claim 7, characterized in that, The PCR amplification reaction system consisted of: 2 μL DNA template, 3 μL 1×Master Mix, and 0.04 μL KASP primers; The KASP primers are a mixture of upstream competing primer 1, upstream competing primer 2, and universal downstream primer in a volume ratio of 1:1:

1.

10. The method as described in claim 7, characterized in that, The PCR amplification reaction program was as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 65℃~57℃ annealing and extension for 60 s, 10 cycles; 94℃ denaturation for 20 s, 55℃ annealing and extension for 60 s, 30 cycles.

Images