Method for assisting in identifying salt and alkali tolerance of wheat in germination period, molecular marker and application

By developing the SNP site Chr2D_603604313 molecular marker on wheat chromosome 2D and combining it with KASP marker technology, the problem of identifying wheat salt and alkali tolerance was solved, enabling rapid and accurate breeding screening and improving breeding and selection efficiency.

CN122038646APending Publication Date: 2026-05-15NORTHWEST A & F UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610510960.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-17
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Salt and alkali tolerance in wheat is a complex quantitative trait. Traditional breeding methods have long breeding cycles and low selection efficiency, making it difficult to effectively aggregate minor genes. Modern molecular breeding techniques, such as KASP marker technology, are not widely used in the identification of salt and alkali tolerance in wheat.

Method used

A molecular marker, Chr2D_603604313, an SNP site on wheat chromosome 2D associated with salt tolerance during germination, was developed. Competitive allele-specific PCR amplification was performed using KASP marker technology, combined with fluorescence detection, to rapidly identify the salt tolerance of wheat germplasm.

Benefits of technology

This method enables rapid and accurate identification of salt tolerance during wheat germination, improves breeding efficiency, simplifies marker-assisted selection, and reduces costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122038646A_ABST
    Figure CN122038646A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biology, and discloses a method for assisting in identifying salt and alkali tolerance in a wheat germination period, a molecular marker and application. According to the invention, a character locus (QTL) for controlling the relative germination rate of wheat is found, and the QTL is named as QGR-2D. 1 and is positioned in an interval of 601.635-603.605 Mb of a 2D chromosome of wheat. According to the method, QTL positioning analysis is combined with KASP marker development, the salt and alkali tolerance of wheat germplasm is analyzed, and a stable and reliable KASP marker Chr2Damp which is closely linked and related to germination is obtained; the molecular marker is a KASP molecular marker Chr2Damp, and the KASP molecular marker Chr2Damp is designed at the 603604313 site on a chromosome 2 of a wheat D subgenome; and the primer group is corresponding to the primer group 603604313. The invention further provides a method for rapidly identifying the salt and alkali tolerance in the wheat germination period by using the primer group of the KASP, and the method is simple, convenient and rapid, accurate in identification result and good in popularization and application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a method, molecular marker, and application for identifying salt tolerance during wheat germination. Background Technology

[0002] Wheat (Triticum aestivum L.) is one of the world's most important food crops, playing a crucial role in ensuring national food security and promoting sustainable agricultural development. Salt tolerance is an important agronomic trait for wheat to adapt to saline-alkali stress, stabilize yields, and improve the utilization efficiency of saline-alkali land. Especially in the saline-alkali areas of northern and northwestern my country, the strength of salt tolerance is directly related to the stability of wheat yields and the further expansion of planting areas.

[0003] A salt-alkali tolerance-related linkage segment located on wheat chromosome 2D has been confirmed by multiple studies to have a significant effect on the response to salt-alkali stress in different wheat materials. Its genetic analysis and molecular utilization are of great significance for revealing the mechanism of wheat salt-alkali tolerance and for breeding new salt-alkali tolerant varieties.

[0004] However, wheat salt tolerance is a typical complex quantitative trait, controlled by multiple genes and significantly influenced by environmental conditions, with complex genetic patterns. Traditional breeding methods mainly rely on field phenotypic screening, which, while able to obtain some salt-tolerant materials, suffers from drawbacks such as long breeding cycles, low selection efficiency, and difficulty in effectively aggregating minor genes.

[0005] To address the aforementioned issues, modern molecular breeding techniques have been widely adopted, providing an effective means for the precise improvement of wheat's salt and alkali tolerance. Among these, KASP (Kompetitive Allele Specific PCR) marker technology, due to its advantages of high sensitivity, high stability, low cost, and high throughput, has become one of the most widely used SNP genotyping techniques in molecular-assisted breeding. This technology, through allele-specific amplification combined with fluorescence detection, enables rapid and accurate genotyping of target SNP loci, making it highly suitable for early screening of large-scale breeding populations. In salt-tolerant wheat breeding, developing specific KASP markers targeting identified salt-tolerant linkage segments on chromosome 2D allows for efficient selection of target genotypes in the early stages of breeding, thereby significantly improving the breeding efficiency of salt-tolerant materials.

[0006] Furthermore, genome-wide association studies (GWAS) have played a crucial role in elucidating the genetic basis of salt tolerance in wheat. By integrating high-density genotypic data from multiple populations with multi-environmental phenotypic data, researchers identified linkage segments significantly associated with salt tolerance.

[0007] In summary, functional KASP markers developed based on 2D chromosome salt-alkali tolerance linkage segments can achieve precise early selection of complex salt-alkali tolerance traits at the genotype level. This can not only accelerate the breeding process of new salt-alkali tolerant wheat varieties, but also provide an efficient and operable molecular breeding strategy for synergistically improving multiple adaptive traits by utilizing the genetic associations between traits. Summary of the Invention

[0008] One of the objectives of this invention is to provide a trait locus (QTL) on wheat chromosome 2D that is associated with salt tolerance during germination and its molecular marker.

[0009] The second objective of this invention is to provide the application of the aforementioned molecular markers related to salt tolerance during wheat germination.

[0010] The third objective of this invention is to provide a method for identifying the salt tolerance of wheat during its germination period.

[0011] To achieve the above objectives, the present invention adopts the following technical solution: This invention discloses a molecular marker related to salt tolerance during wheat germination. Through QTL mapping analysis of relative germination rate in wheat, the inventors located a linkage region containing a SNP locus named Chr2D&603604313. This locus is located at position 603604313 on chromosome 2D of the wheat reference genome IWGSCRefSeqCSv1.0. This locus contains an A / T base mutation. The nucleotide sequence of this SNP locus is shown in SEQ ID NO.1. When the base at this locus is A (AA genotype, hereinafter referred to as 0 / 0 genotype), the wheat material exhibits high salt tolerance. When the base at this locus is T (TT genotype, hereinafter referred to as 1 / 1 genotype), the wheat material exhibits low salt tolerance (salt-sensitive type). There is also a heterozygous case, the AT genotype, also known as 0 / 1 genotype; this type of wheat material is also salt-sensitive. Population validation results showed that the germination salt tolerance of wheat materials with genotype 1 / 1 was significantly lower than that of wheat materials with genotype 0 / 0, with a highly significant difference between the two.

[0012] Specifically, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein an A / T base mutation exists at position 101 of the sequence shown in SEQ ID NO.1, and the sequence is as follows: TTTCTGGATAGCACCAGTCTGAATTGCTGAAACATGCAGCGGCACACGATTAACTTTGTACTTTATACTTTTGCTGAAACATTCAGGACTCCAGTGGGCG A / TCTCCAAAAATCGGTACTCCTGAAGCGTGACAATGGAGATGTCGCGGGCTTCTTTGTCCGGAAGATGGTATATGGCTCCCGACTCAGCAATTCTGAAGTTT. (As shown in SEQ ID NO.1, the bold and underlined part is the SNP site Chr2D_603604313 (A / T)).

[0013] Based on this SNP site, a primer set for the KASP marker was designed to amplify the KASP marker primer set associated with salt tolerance during wheat germination. The primer set sequence of the molecular marker is as follows: Chr2D&603604313-F1: GAAGGTGACCAAGTTCATGCTcaggactccagtgGGcgA (shown in SEQ IDNO.2); Chr2D&603604313-F2: GAAGGTCGGAGTCAACGGATTcaggactccagtgGGcgT (shown in SEQ IDNO.3); Chr2D&603604313-R: ccgcgacatctccattgtca (SEQ ID NO.4).

[0014] Two forward primers are used to connect to different fluorescent adapter sequences; the 5' end of forward primer Chr2D&603604313-F1 is connected to the FAM fluorescent adapter sequence, and the 5' end of forward primer Chr2D&603604313-F2 is connected to the VIC fluorescent adapter sequence; the FAM and VIC fluorescent adapter sequences are as follows: FAM: GAAGGTGACCAAGTTCATGCT (shown in SEQ ID NO.5); VIC: GAAGGTCGGAGTCAACGGATT (shown as SEQ ID NO.6).

[0015] This invention also discloses the application of the primer set of the aforementioned molecular markers in marker-assisted breeding related to salt tolerance during wheat germination. In other words, the primer set of the molecular markers of this invention can be used in future marker-assisted breeding to identify the level of salt tolerance during wheat germination by extracting DNA from seedling leaves and detecting the presence of the molecular markers of this invention. The detection can be performed using competitive allele-specific PCR, specifically using the aforementioned primer set of molecular markers.

[0016] This invention also discloses the application of the primer set of the above-mentioned molecular markers in identifying the salt tolerance level of wheat germplasm materials during germination. The specific steps for identification are as follows: Using the DNA of the tested wheat germplasm as a template for competitive allele-specific PCR amplification, PCR amplification was performed using the primer set corresponding to the molecular marker Chr2D&603604313. The reaction system for competitive allele-specific PCR amplification is shown in Table 1, and the PCR reaction procedure is shown in Table 2. Table 1. Reaction system ratios for PCR amplification

[0017] Table 2 PCR reaction procedure

[0018] Competitive allele-specific PCR amplification was performed using primer sets Chr2D&603604313-F1, Chr2D&603604313-F2, and Chr2D&603604313-R. If the PCR product of the sample only detected the FAM fluorescence signal corresponding to primer Chr2D&603604313-F1 with the fluorescent adapter sequence, the detection site was identified as the 0 / 0 genotype, which was determined to be a homozygous type with high salt tolerance during germination. If the PCR product of the sample only detected the FAM fluorescence signal corresponding to primer Chr2D&603604313-F1 with the fluorescent adapter sequence, the detection site was identified as the 0 / 0 genotype, indicating a homozygous type with high salt tolerance during germination. If the VIC fluorescence signal corresponding to the primer Chr2D&603604313-F2 with the fluorescent adapter sequence is detected, the detection site is a 1 / 1 genotype, which is determined to be a homozygous type with low salt tolerance during germination. If both FAM and VIC fluorescence signals corresponding to the primers Chr2D&603604313-F1 and Chr2D&603604313-F2 with the fluorescent adapter sequence are detected at the same time, the detection site is a 0 / 1 genotype (corresponding to the AT genotype), which is determined to be a heterozygous type with low salt tolerance during germination.

[0019] In addition, this invention also protects a kit for identifying salt tolerance during wheat germination, the kit containing primer sets Chr2D&603604313-F1, Chr2D&603604313-F2, and Chr2D&603604313-R. Other components of the kit are conventional reagents. Specifically, it also includes a 2×KASP Master Mix. This invention imposes specific restrictions on the concentration of the primer sets; a concentration of 10 μM can be used. The source of the 2×KASP Master Mix described in this invention is not particularly required.

[0020] The kit of this invention can be used to quickly identify the salt tolerance of wheat during germination, and can also be used to quickly identify the genotype of salt-tolerant wheat germplasm. The specific method follows the steps for identifying salt tolerance during wheat germination. Analysis of the results of competitive allele-specific PCR amplification reveals the following: If the PCR product only detects FAM fluorescence signal corresponding to primer Chr2D&603604313-F1 with a fluorescent adapter sequence, the detection site indicates a 0 / 0 genotype, classifying it as a homozygous type with high salt tolerance during germination. If the PCR product only detects VIC fluorescence signal corresponding to primer Chr2D&603604313-F2 with a fluorescent adapter sequence, the detection site indicates a 1 / 1 genotype, classifying it as a homozygous type with low salt tolerance during germination. If both FAM and VIC fluorescence signals corresponding to primers Chr2D&603604313-F1 and Chr2D&603604313-F2 with fluorescent adapter sequences are detected simultaneously, the detection site indicates a 0 / 1 genotype, classifying it as a heterozygous type with low salt tolerance during germination.

[0021] The present invention has the following advantages: (1) The inventors of this invention located a linkage region in wheat by performing genome-wide association analysis on the relative germination rate of wheat. The linkage region contains an SNP site named Chr2D&603604313. This molecular marker is located on chromosome 2D of the wheat reference genome. Using the molecular marker Chr2D&603604313 of this invention, the salt tolerance of wheat germplasm during germination can be rapidly identified.

[0022] (2) Using markers linked to the relative germination rate of wheat for screening is beneficial for molecular marker-assisted selection breeding. The method is simple and feasible, which can improve efficiency and save costs.

[0023] (3) The molecular markers of the present invention have the characteristics of convenient detection, stable amplification products and high specificity. They can be easily, quickly and with high throughput applied to molecular marker-assisted breeding practices and material identification related to salt tolerance during wheat germination. Attached Figure Description

[0024] Figure 1 Manhattan plot of association analysis of the QTLs (Qualitative Traits) controlling relative germination rate of wheat in this invention.

[0025] Figure 2 The results of QTL localization analysis and linkage intervals for relative germination rate of wheat.

[0026] Figure 3This is a box plot showing the relative germination rates of wheat corresponding to different haplotypes in linkage intervals within a natural wheat population in Embodiment 1 of the present invention. HapA (i.e., the AA genotype in QGR-2D) represents the salt-tolerant type, and HapB (i.e., the TT genotype in QGR-2D) represents the salt-sensitive type. The dots indicate the data distribution, and ** represents P < 0.01.

[0027] Figure 4 This is an analysis of the amplification results of the molecular markers at the Chr2D & 603604313 sites in the F5 wheat segregating population of Example 2 of the present invention. Detailed Implementation

[0028] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.

[0029] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.

[0030] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0031] Example 1: Development of molecular markers related to relative germination rate of wheat This invention analyzes 373 wheat population materials and uses the relative germination rate of wheat materials to measure the salt tolerance of wheat during the germination period. The higher the value, the higher the salt tolerance of the wheat material; the lower the value, the lower the salt tolerance of the wheat material.

[0032]

[0033] The salt and alkali tolerance of wheat was determined by QTL location analysis. Figure 1 , Figure 2A linkage region containing a single SNP locus, named Chr2D&603604313, was located on chromosome 2D of the wheat reference genome (IWGSCRefSeqCSv1.0) at position 603604313. This locus contains an A / T base mutation, and its nucleotide sequence is shown in SEQ ID NO.1, at position 101 (counting from the first base at the 5' end). When the base at this locus is A (AA genotype, 0 / 0 genotype), the wheat material exhibits high salt tolerance; when the base is T (TT genotype, 1 / 1 genotype), the wheat material exhibits low salt tolerance (salt-sensitive type). There is also a heterozygous case, the AT genotype, also known as the 0 / 1 genotype, which results in a salt-sensitive wheat material. Box plot of salt tolerance distribution corresponding to the genotypes at the Chr2D & 603604313 loci in the population is shown below. Figure 3 Among them, wheat materials with genotype 0 / 0 exhibited high salt and alkali tolerance, while wheat materials with genotype 1 / 1 were salt and alkali sensitive. Furthermore, the salt and alkali tolerance of wheat materials with genotype 1 / 1 was significantly lower than that of wheat materials with genotype 0 / 0, meaning there was a significant difference in salt and alkali tolerance between the two groups. However, the differences between wheat materials with genotypes 0 / 1 and 1 / 1 were not significant.

[0034] Based on this SNP site and its upstream and downstream sequences, markers for KASP detection were developed, and the following primer set was designed using SnapGene: Chr2D&603604313-F1: GAAGGTGACCAAGTTCATGCTcaggactccagtgGGcgA (shown in SEQ IDNO.2); Chr2D&603604313-F2: GAAGGTCGGAGTCAACGGATTcaggactccagtgGGcgT (shown in SEQ IDNO.3); Chr2D&603604313-R: ccgcgacatctccattgtca (SEQ ID NO.4).

[0035] Two forward primers are used to connect to different fluorescent adapter sequences; the 5' end of forward primer Chr2D&603604313-F1 is connected to the FAM fluorescent adapter sequence, and the 5' end of forward primer Chr2D&603604313-F2 is connected to the VIC fluorescent adapter sequence; the FAM and VIC fluorescent adapter sequences are as follows: FAM: GAAGGTGACCAAGTTCATGCT (shown in SEQ ID NO.5); VIC: GAAGGTCGGAGTCAACGGATT (shown as SEQ ID NO.6).

[0036] Competitive allele-specific PCR amplification was performed on the test samples using this primer set. The results showed that if the PCR product only detected the FAM fluorescence signal corresponding to primer Chr2D&603604313-F1 with the fluorescent adapter sequence, the detection site indicated a 0 / 0 genotype, classifying it as a homozygous type with high salt tolerance during germination. If the PCR product only detected the VIC fluorescence signal corresponding to primer Chr2D&603604313-F2 with the fluorescent adapter sequence, the detection site indicated a 1 / 1 genotype, classifying it as a homozygous type with salt sensitivity. If both FAM and VIC fluorescence signals corresponding to primers Chr2D&603604313-F1 and Chr2D&603604313-F2 with the fluorescent adapter sequence were detected simultaneously, the detection site indicated a 0 / 1 genotype, classifying it as a heterozygous type with salt sensitivity. Figure 3 ).

[0037] This study developed markers in 373 wheat germplasm materials. 170 wheat germplasm materials had a genotype of 0 / 0 at the Chr2D&603604313 locus; 203 wheat germplasm materials had a genotype of 1 / 1 at the Chr2D&603604313 locus. A t-test showed a significant difference between the 0 / 0 and 1 / 1 genotypes. P <0.01). The detection results are consistent with the genotype at the Chr2D&603604313 locus and the actual relative germination rate determination results. Figure 2 ).

[0038] The 373 wheat materials used for the label development were wheat materials published in the article "Wang X, et al. Population transcriptome and phenotype analysis reveals that Rht-D1b contributes all argerseedling root to modern bread wheat. Plant Cell. 2025 Oct31;37(11):koaf267."

[0039] Example 2: Accuracy verification of the molecular markers described in this invention The molecular markers described above were used to identify 125 lines from the F5 segregating population, with a prediction accuracy of 86.40%. The relative germination rates of the wheat germplasm materials used and the genotypes corresponding to the Chr2D&603604313 loci are shown in Table 3. Table 3. Relative germination rates and genotypes corresponding to the Chr2D&603604313 locus in the F5 segregating population of 125 lines.

[0040]

[0041] The molecular markers described above were used to identify 50 wheat germplasm materials from natural populations, with a prediction accuracy of 86.00%. The relative germination rates of the wheat germplasm materials used and the genotypes corresponding to the Chr2D&603604313 locus are shown in Table 4. Table 4. Relative germination rates of 50 wheat germplasms and genotypes corresponding to the Chr2D&603604313 locus.

[0042] Using the genomic DNA of the wheat germplasm to be identified as a template, competitive allele-specific PCR was performed using the primer pair to obtain the PCR product.

[0043] The reaction system for competitive allele-specific PCR amplification is as follows: 2.5 μL genomic DNA, 2.5 μL 2×KASPMaster Mix, and 0.07 μL mixed primer mix (F1:F2:R=2:2:5). The preferred PCR amplification reaction program is: 30℃ pre-read fluorescence for 1 min, 94℃ initial denaturation for 15 min; 94℃ denaturation for 20 s, 64℃ annealing and extension for 1 min, 10 cycles; 94℃ denaturation for 20 s, 56℃ annealing and extension for 1 min, 35 cycles.

[0044] Determining the salt tolerance of wheat germplasm during germination based on competitive allele-specific PCR products: Table 3 shows that, in this study, 125 lines from the F5 segregating population were identified. 59 wheat lines had a genotype of 0 / 0 at the Chr2D&603604313 locus; 5 wheat lines had a genotype of 0 / 1 at the Chr2D&603604313 locus; and 61 wheat lines had a genotype of 1 / 1 at the Chr2D&603604313 locus. The t-test showed a significant difference between the 0 / 0 and 1 / 1 genotypes. P <0.01). The detection results are basically consistent with the genotype at the Chr2D&603604313 locus and the actual relative germination rate determination results. Figure 4 Furthermore, this invention also identified 50 wheat germplasm materials from natural populations. As shown in Table 4, the genotypes and actual relative germination rates were largely consistent, indicating that the molecular marker detection accuracy of this invention is high. Therefore, the KASP marker of this invention can effectively identify the salt tolerance of wheat materials and can be used for the prediction and screening of salt-tolerant wheat materials during the germination period.

[0045] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. A molecular marker associated with salt tolerance during wheat germination, characterized in that, The molecular marker is located on the wheat 2D chromosome, and its nucleotide sequence is shown in SEQ ID NO.

1. There is an A / T base mutation at position 101 of the sequence shown in SEQ ID NO.

1. When the base at this position is A, the wheat material has high salt and alkali tolerance during germination, and when the base at this position is T, the wheat material has low salt and alkali tolerance during germination.

2. The molecular marker related to salt tolerance during wheat germination according to claim 1, characterized in that, The molecular marker is the KASP marker.

3. A primer set for amplifying the molecular marker of claim 1, characterized in that, The primer sequence is as follows: Chr2D&603604313-F1: GAAGGTGACCAAGTTCATGCTcaggactccagtgGGcgA; Chr2D&603604313-F2: GAAGGTCGGAGTCAACGGATTcaggactccagtgGGcgT; Chr2D&603604313-R:ccgcgacatctccattgtca.

4. The primer set of molecular markers according to claim 3, characterized in that, The two forward primers are connected to different fluorescent adapters; the 5' end of the forward primer Chr2D&603604313-F1 is connected to the FAM fluorescent adapter, and the 5' end of the forward primer Chr2D&603604313-F2 is connected to the VIC fluorescent adapter.

5. The application of the primer set of the molecular marker described in claim 4 in assisting in the identification of the salt tolerance level during wheat germination.

6. A method for assisting in the identification of salt tolerance during wheat germination, comprising the following steps: (1) Extracting genomic DNA from wheat to be tested; (2) Using the genomic DNA extracted in step (1) as a template, competitive allele-specific PCR amplification was performed using the primer set of the molecular markers described in claim 3, and the results of competitive allele-specific PCR amplification were analyzed. (3) Make a judgment based on the result of step (2), and the specific criteria are as follows: Competitive allele-specific PCR amplification was performed using primer sets Chr2D&603604313-F1, Chr2D&603604313-F2, and Chr2D&603604313-R. If only FAM fluorescence signal was detected in the PCR product of the sample, the locus was identified as 0 / 0 genotype, which was determined to be a homozygous type with high salt tolerance during germination. If only VIC fluorescence signal was detected in the PCR product of the sample, the locus was identified as 1 / 1 genotype, which was determined to be a homozygous type with low salt tolerance during germination. If both FAM and VIC fluorescence signals were detected, the locus was identified as 0 / 1 genotype, which was determined to be a heterozygous type with low salt tolerance during germination.

7. A kit for assisting in the identification of salt tolerance during wheat germination, characterized in that, The kit contains a primer set of the molecular markers described in claim 3.

8. The application of the kit according to claim 7 in assisting the identification of salt tolerance during wheat germination.

9. The application according to claim 8, characterized in that, The method for auxiliary identification of wheat salt tolerance during germination using the aforementioned kit is as follows: (1) Extracting genomic DNA from wheat to be tested; (2) Using the genomic DNA extracted in step (1) as a template, competitive allele-specific PCR amplification was performed using the primer set of the molecular markers described in claim 3, and the results of competitive allele-specific PCR amplification were analyzed. (3) Analyze the results of competitive allele-specific PCR amplification. If only FAM fluorescence signal is detected in the PCR product of the sample, the site is 0 / 0 genotype and is determined to be a homozygous type with high salt tolerance during germination. If only VIC fluorescence signal is detected in the PCR product of the sample, the site is 1 / 1 genotype and is determined to be a homozygous type with low salt tolerance during germination. If both FAM and VIC fluorescence signals are detected, the site is 0 / 1 genotype and is determined to be a heterozygous type with low salt tolerance during germination.