Application of combination of VvTIFY10A / VvNHX1 and salt tolerance index in identification of salt tolerance of grape rootstock

Abstract

The invention relates to the technical field of fruit tree breeding, in particular to application of combination of VvTIFY10A / VvNHX1 and a salt tolerance index in identification of salt tolerance of grape stocks. The invention provides an application of VvTIFY10A / VvNHX1 or a combination of VvTIFY10A / VvNHX1 and a salt tolerance index in the identification of the salt tolerance of a grape stock. The invention also provides a method for identifying the salt tolerance of the grape stock, which comprises the following steps: treating the grape stock by using a 180-220mM sodium chloride solution, and determining an identification index for identification. The identification method disclosed by the invention has the advantages of simplicity and convenience in operation, high accuracy, high batch-to-batch stability, complementation with production experience and the like, and is beneficial to improving the identification accuracy of the salt tolerance of the grape rootstock.

Description

Technical Field

[0001] This invention relates to the field of fruit tree breeding technology, and more particularly to... VvTIFY10A / VvNHX1 Application of salt tolerance index in the identification of salt tolerance of grape rootstock. Background Technology

[0002] Soil salinization is a problem faced in grape cultivation and one of the most significant environmental stresses affecting grape growth and reducing the yield of high-quality fruit. Grapes are moderately salt-tolerant, requiring suitable salt concentrations for growth; exceeding a certain threshold will cause stress and damage. Grapes possess the varietal advantages of being adaptable to both high-altitude and low-altitude environments, and their salt tolerance limit can be increased by using resistant rootstocks. The application of salt-tolerant rootstocks can significantly improve the interaction between grapes and the environment, mitigating the impact of abiotic stresses. Conducting systematic research on rootstock salt tolerance will deepen our understanding of the mechanisms of grape salt tolerance, overcome the salinization problems faced in production, and improve the salt tolerance of grafted seedlings.

[0003] Therefore, this invention provides an efficient method for identifying the salt tolerance of grape rootstocks. Summary of the Invention

[0004] The purpose of this invention is to provide VvTIFY10A / VvNHX1 The combined application of salt tolerance index in the identification of salt tolerance of grape rootstocks can more efficiently and accurately identify the salt tolerance of grape rootstocks.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides VvTIFY10A / VvNHX1 The application of salt tolerance index in the identification of salt tolerance in grape rootstocks, the VvTIFY10A The nucleotide sequence is shown in SEQ ID NO.1. VvNHX1 The nucleotide sequence is shown in SEQ ID NO.2.

[0006] Preferably, the salt tolerance index includes one or more of the following: K / Na, Ca / Na, antioxidant enzyme activity, antioxidant content, and osmotic conditioning substance content. Antioxidant enzymes include superoxide dismutase, peroxidase, and catalase; Antioxidants include malondialdehyde, hydrogen peroxide, and superoxide anion; Osmotic regulators include soluble sugars, soluble proteins, and proline.

[0007] This invention also provides a method for identifying the salt tolerance of grape rootstocks, comprising the following steps: (1) Treat grape rootstocks with 180~220mM sodium chloride solution; (2) Determine the identification indicators of grape rootstocks after salt treatment and / or VvTIFY10A / VvNHX1 ; The identification indicators include one or more of the following: K / Na, Ca / Na, antioxidant enzyme activity, antioxidant content, and osmotic regulating substance content. Antioxidant enzymes include superoxide dismutase, peroxidase, and catalase; Antioxidants include malondialdehyde, hydrogen peroxide, and superoxide anion; Osmotic regulators include soluble sugars, soluble proteins, and proline.

[0008] Preferably, the identification index is VvTIFY10A / VvNHX1 At that time, if salt is applied to grape rootstock 1-3 hours after treatment, VvTIFY10A / VvNHX1 Rising and VvTIFY10A / VvNHX1 If the concentration of salt is ≥2, then the grape rootstock is a salt-sensitive variety; if salt treatment is applied to the grape rootstock 1-3 hours later... VvTIFY10A / VvNHX1 Decline and VvTIFY10A / VvNHX1 If the value is less than 2, then the grape rootstock is a salt-tolerant variety.

[0009] Preferably, when the identification indicators are K / Na and Ca / Na, if K / Na and Ca / Na increase before disease on the grape rootstock after salt treatment and decrease after disease onset, then the grape rootstock is a salt-sensitive variety; if K / Na and Ca / Na decrease before disease onset after salt treatment, then the grape rootstock is a salt-tolerant variety.

[0010] Preferably, when the identification index is antioxidant enzyme, if the antioxidant enzyme activity first increases and then decreases after salt treatment of the grape rootstock, then the grape rootstock is a salt-sensitive variety; if the antioxidant enzyme activity content continues to increase after salt treatment of the grape rootstock, then the grape rootstock is a salt-tolerant variety.

[0011] Preferably, when the detection index is antioxidants, if the content of antioxidants in the grape rootstock continues to rise after salt treatment, then the grape rootstock is a salt-sensitive variety; if the content of antioxidants in the grape rootstock first rises and then falls after salt treatment, then the grape rootstock is a salt-tolerant variety.

[0012] Preferably, when the detection index is an osmotic regulator, if the content of the osmotic regulator first increases and then decreases after salt treatment of the grape rootstock, then the grape rootstock is a salt-sensitive variety; if the content of the osmotic regulator continues to increase after salt treatment of the grape rootstock, then the grape rootstock is a salt-tolerant variety.

[0013] This invention provides the application of the aforementioned identification method in identifying the salt tolerance of grape rootstocks.

[0014] Beneficial effects: The technical solution of this invention can be used to identify the salt tolerance of grape rootstocks. It has the advantages of simple operation, high accuracy, strong batch-to-batch stability, and complementarity with production experience. It is conducive to improving the accuracy of identifying the salt tolerance of grape rootstocks, deepening the understanding of the salt tolerance mechanism of grapes, and thus playing a positive role in solving the problems of low fruit yield and quality in saline-alkali soils and improving the salt tolerance of grafted seedlings. Attached Figure Description

[0015] Figure 1 The leaf characteristics of rootstocks under salt stress treatment; Figure 2 Different varieties under salt treatment conditions VvTIFY10A Level of expression; Figure 3 Different varieties under salt treatment conditions VvNHX1 Level of expression; Figure 4 Different varieties under salt treatment conditions VvTIFY10A / VvNHX1 ; Figure 5 Different varieties of Na under salt treatment conditions + Ion concentration; Figure 6 For different varieties of K under salt treatment conditions + Ion concentration; Figure 7 Different varieties of Ca under salt treatment conditions 2+ Ion concentration; Figure 8 The K / Na ion concentrations for different varieties under salt treatment conditions; Figure 9 The Ca / Na ion concentrations of different varieties under salt treatment conditions; Figure 10 The SOD content of different varieties under salt treatment conditions; Figure 11 The POD content of different varieties under salt treatment conditions; Figure 12 The CAT content of different varieties under salt treatment conditions; Figure 13 The H2O2 content of different varieties under salt treatment conditions; Figure 14 Different varieties of O2 under salt treatment conditions - content; Figure 15 The MDA content of different varieties under salt treatment conditions; Figure 16 The SP activity of different varieties under salt treatment conditions; Figure 17 The SS activity of different varieties under salt treatment conditions; Figure 18 The activity of different Pro varieties under salt treatment conditions. Detailed Implementation

[0016] This invention provides VvTIFY10A / VvNHX1 The application of salt tolerance index in the identification of salt tolerance in grape rootstocks, the VvTIFY10A The nucleotide sequence is shown in SEQ ID NO.1. VvNHX1 The nucleotide sequence is shown in SEQ ID NO.2; The SEQ ID NO.1 is (VIT_09s0002g00890): ATGTCGAATTCACCGGAGTTCTCTGATTTCGCCGGCCGGAAGTCCGGGAAGTTGCCGGACAGGTCGAATTTCTCGCAGACCTGTAATCTCTTGAGCCAGTTCCTCAAGGAAAAGGGAAGATTCGGGGATCTCAGCCTCGGCATGGCCGGGAAATCTGAGACCAAAGGGAGGCCTGAATCATTCAAATCATCAACCATGTCATTTGACCTGTTAAACAAGGATAAATCTAGCGAGGCTTCGGGGCAAAACGTTGGTGGATCCTCCAATTTGAAATCCAGTGATTTCTACCCTCAGTTTGCTGGTTTTGGTTCCCTTGCTTCCATTGACGAAGCCATTAATATGGCTGATTTCAGGAAATCGGCAACAACAGAGTCGGAAACTTCTCAGATGACAATATTCTACGCCGGCCAAGTGCTGGTATTCAATGATTTTCCGGCCGAGAAGGCCAGAGAAGTCATGCTATTAGCCGCCAAGGGAACCCCCCAAAATACTAGCGGCTTCCTCTCCACTTCTGGCCCTGAAAAAATCAATACAGGCAGCTCAACCGCCCCTAGCCCTAGCATCCCCGCCTCGCCGGCCACCACCCCGAACCCTCAAGCCCTCAGCTCTGGTACTTTCAGCATTCCTGCCTCGCCTGCAGCCACCCCAAACCCTCAAGCTCCTCTTGGCTCTGAACTGCCAATTGCAAGGAGAAACTCACTTCACCGGTTCTTGGAGAAGAGAAAAGATCGGGTCAATTCGAAAGCACCATACCAAGTAAACAATCCATCCAGACCTTCTCCAAAGCCTGAAGAGGACACCAACCCAAAGCTCAACAAAGATGAAGGTCAATCATCAAAGCAACTTGATCTTAGATTGTAG;

[0017] In this invention, the salt tolerance index includes one or more of the following: K / Na, Ca / Na, antioxidant enzyme activity, antioxidant content, and osmotic conditioning substance content. Antioxidant enzymes include superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT); Antioxidants include malondialdehyde (MDA), hydrogen peroxide (H2O2), and superoxide anion (O2). - ); Osmotic regulators include soluble sugars (SS), soluble proteins (SP), and proline (Pro).

[0018] This invention also provides a method for identifying the salt tolerance of grape rootstocks, comprising the following steps: (1) Treat grape rootstocks with 180~220mM sodium chloride solution; (2) Determine the identification indicators of grape rootstocks after salt treatment and / or VvTIFY10A / VvNHX1 ; The identification indicators include one or more of the following: K / Na, Ca / Na, antioxidant enzyme activity, antioxidant content, and osmotic regulating substance content. Antioxidant enzymes include superoxide dismutase, peroxidase, and catalase; Antioxidants include malondialdehyde, hydrogen peroxide, and superoxide anion; Osmotic regulators include soluble sugars, soluble proteins, and proline.

[0019] In this invention, the cultivation method for grape rootstock before treatment includes the following steps: selecting one-year-old seedlings and planting them in a substrate, watering them thoroughly to ensure that the roots are in close contact with the substrate; retaining one strong branch for each plant and removing side branches to ensure nutrient supply; when the plants grow to early to mid-May and have 7 to 8 functional leaves, starting the treatment with sodium chloride solution. In this invention, the sodium chloride solution treatment is performed once every 3 days; The matrix consists of peat and garden soil; The mass ratio of peat to garden soil is 1:1.

[0020] In this invention, the identification index is: VvTIFY10A / VvNHX1 At that time, if salt is applied to grape rootstock 1-3 hours after treatment, VvTIFY10A / VvNHX1 Rising and VvTIFY10A / VvNHX1 If the concentration of salt is ≥2, then the grape rootstock is a salt-sensitive variety; if salt treatment is applied to the grape rootstock 1-3 hours later... VvTIFY10A / VvNHX1 Decline and VvTIFY10A / VvNHX1 If the value is less than 2, then the grape rootstock is a salt-tolerant variety.

[0021] In this invention, when the identification indicators are K / Na and Ca / Na, if K / Na and Ca / Na increase before disease on the grape rootstock after salt treatment and decrease after disease onset, then the grape rootstock is a salt-sensitive variety; if K / Na and Ca / Na decrease before disease onset after salt treatment, then the grape rootstock is a salt-tolerant variety.

[0022] In this invention, when the identification index is antioxidant enzyme, if the antioxidant enzyme activity first increases and then decreases after salt treatment of grape rootstock, then the grape rootstock is a salt-sensitive variety; if the antioxidant enzyme activity content continues to increase after salt treatment of grape rootstock, then the grape rootstock is a salt-tolerant variety. Among the antioxidant enzymes, SOD is the primary identification indicator, while POD and CAT are secondary identification indicators.

[0023] In this invention, when the detection index is antioxidants, if the content of antioxidants in grape rootstock continues to rise after salt treatment, then the grape rootstock is a salt-sensitive variety; if the content of antioxidants in grape rootstock first rises and then falls after salt treatment, then the grape rootstock is a salt-tolerant variety. The antioxidants are primarily composed of O2. - H2O2 and MDA are the primary identification indicators, while H2O2 and MDA are the secondary identification indicators.

[0024] In this invention, when the detection index is an osmotic regulator, if the content of the osmotic regulator first increases and then decreases after salt treatment of the grape rootstock, then the grape rootstock is a salt-sensitive variety; if the content of the osmotic regulator continues to increase after salt treatment of the grape rootstock, then the grape rootstock is a salt-tolerant variety. Pro is the primary identification indicator for the osmotic conditioning substances, while SS and SP are secondary identification indicators.

[0025] This invention provides the application of the aforementioned identification method in identifying the salt tolerance of grape rootstocks.

[0026] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0027] Example 1: Treatment method and disease index

[0028] Grape rootstock varieties 5BB(A), 1103P(B), Beta (C) and 3309C(D) were selected as experimental materials and were all purchased from Shandong Zhichang Grape Co., Ltd. On March 20th, an experimental potted plant test was conducted at the Yangdu Research and Innovation Base of the Zhejiang Academy of Agricultural Sciences in Haining City, Jiaxing, Zhejiang Province. One-year-old seedlings were planted in a substrate (a 1:1 mixture of peat and garden soil), thoroughly watered to ensure close contact between the roots and the substrate, and one strong branch was retained per plant, with side branches removed to ensure nutrient supply. On May 20th, when the plants had 7-8 functional leaves, the rootstock varieties were irrigated with a 200mM NaCl solution (1L in 3-gallon pots) every 3 days. Six seedlings were used for each treatment, with three replicates, and the watering served as a control group. Leaf samples were taken at 0h, 1h, 3h, 6h, 12h, 24h, 36h, 48h, 72h, 120h, 192h, and 216h after treatment. The salt injury index (SI) was measured at 96h, and the results are as follows: Figure 1 As shown in Table 1; SI = (1×S1+2×S2+3×S3+4×S4) / (4×number of leaves)×100, where S is the number of plants at the corresponding salt damage level; Grade 0: Normal, no salt damage symptoms; Grade 1: Mild salt damage, with scorched or slightly wilted edges of basal leaves, or symptoms appearing on less than 20% of leaves; Grade 2: Moderate salt damage, with scorched edges of central leaves or wilted central leaves, or symptoms appearing on 40% of leaves; Grade 3: Severe salt damage, with 40% of basal leaves turning yellow or completely wilted, or symptoms appearing on 60% of leaves; Grade 4: Extremely severe salt damage, with 60% of basal leaves scorched or falling off, or symptoms appearing on 80% of leaves. Table 1. Time of salt damage symptoms and salt damage index of different leaf parts of different varieties

[0029] A salt damage index below 0.6 indicates a salt-tolerant variety, while a salt damage index of 0.6 or above indicates a salt-sensitive variety. 5BB and 1103P are salt-tolerant varieties, while Beta and 3309C are salt-sensitive varieties.

[0030] Example 2 VvTIFY10A / VvNHX1

[0031] RNA was extracted from the sampling sites using the Kangwei Century Plant RNA Extraction Kit (CW2985s); first-strand cDNA was synthesized using the Monad kit; qPCR was performed using the QIAGEN kit, with a reaction volume of 10µl: 2x Reaction Mix SYBR Green PCR Master Mix 5µl, QN ROX Reference Dye 0.05µl, Primer A 0.7µl, Primer B 0.7µl, RNase-free water 2.55µl, and cDNA 1µl. The program was: PCR initial heatactivation 2 min at 95℃, 40 cycles (Denaturation Combined annealing / extension 95℃ 5s, 60℃ 30s); primers were designed using Primer 3 (Table 2), and the detection results were obtained using 2... -ΔΔct Data analysis was performed, salt treatment / control values ​​were calculated, and gene expression level trend graphs were plotted. The results are as follows: Figures 2-4 As shown; Table 2 Primer Information

[0032] If salt is applied to grape rootstocks 1-3 hours after treatment... VvTIFY10A / VvNHX1 Rising and VvTIFY10A / VvNHX1 If the concentration of salt is ≥2, then the grape rootstock is a salt-sensitive variety; if salt treatment is applied to the grape rootstock 1-3 hours later... VvTIFY10A / VvNHX1 Decline and VvTIFY10A / VvNHX1 If the value is less than 2, then the grape rootstock is a salt-tolerant variety; qPCR was used for testing. VvTIFY10A and VvNHX1 level of expression VvTIFY10A The expression trends in salt-tolerant varieties 5BB and 1103P were basically consistent, showing a significant upregulation trend at 1 h and 6 h after salt treatment. Symptoms appeared in the lower leaves of both 5BB and 1103P at 36 h, after which... VvTIFY10A The expression level rose rapidly, reaching its peak at 48 hours before declining. In the salt-sensitive varieties Beta and 3309C, there was a significant upregulation trend from 1 to 3 hours, followed by downregulation from 3 to 6 hours, with peak expression levels at 24 hours and 48 hours, respectively. Compared to 3309C, Beta showed a stronger response to salt treatment. VvNHX1 The pattern of expression level change and VvTIFY10A Completely different, two significant upregulation peaks were observed in the salt-sensitive varieties Beta and 3309C at 24h and 48h, with expression levels continuously downregulating after 2d. VvTIFY10AThe expression patterns of salt-tolerant varieties 5BB and 1103P differed. In 5BB, distinct peaks appeared at 1h, 12h, 36h, 3d, and 8d, while in 1103P, the expression was relatively gradual before 24h, followed by a sustained and significant upregulation after 24h. (Comparison) VvTIFY10A / VvNHX1 Salt-sensitive varieties Beta and 3309C showed significant responses in the early stages of salt treatment (1–3 h). VvTIFY10A / VvNHX1 >2, especially for Beta varieties approaching 10; in 3309C, only at 3h and 36h, VvTIFY10A / VvNHX1 >1 at all other times, <1 at all other times. The variation patterns of the two genes in the salt-tolerant varieties 5BB and 1103P are basically consistent, with peaks at 6h, 24h, and 48h. In 1103P, VvTIFY10A / VvNHX1 It generally remains at a level <1, in 5BB between 1h and 6h, and at 2d. VvTIFY10A / VvNHX1 >1.

[0033] Example 3 Ion Concentration

[0034] Sampling points were divided into pre-treatment (P1), pre-disease (P2), early-stage disease (P3), and late-stage disease (P4). The potassium (K) content in the leaves of each grape variety in Example 1 was determined using ICP-MS mass spectrometry with the external standard method. + ), calcium (Ca 2+ ), sodium (Na + Calculate the K / Na and Ca / Na ratios based on the content of Na; the results are as follows: Figures 5-9 As shown; If, after salt treatment, the K / Na and Ca / Na ratios increase before the onset of disease and decrease after the onset of disease, the grape rootstock is a salt-sensitive variety; if, after salt treatment, the K / Na and Ca / Na ratios decrease before the onset of disease, the grape rootstock is a salt-tolerant variety. K in salt-tolerant varieties A and B + Concentration and Ca 2+ The concentration of potassium was generally higher than that of salt-sensitive varieties C and D; under salt treatment conditions, the potassium concentration in salt-tolerant varieties was higher. + and Ca 2+ The concentration of Na was higher than that of the control, and lower in salt-sensitive varieties; Na in A and B + The concentration of Na in C and D remained consistently low, with a maximum of 0.35 g / kg; as salt treatment progressed, the concentration of Na in C and D... + The K / Na ratio rose sharply to 2.11 g / kg, while the Ca / Na ratio gradually decreased to 1.11 and 2.04. The K / Na and Ca / Na ratios in A and B were significantly higher than those in C and D. In the later stages of the disease, the K / Na ratios were 8.87 and 12.26, and the Ca / Na ratios were 15.10 and 13.92, respectively. Under normal conditions, the K / Na and Ca / Na ratios of salt-tolerant varieties were significantly higher than those in C and D.

[0035] Example 4 Antioxidant enzymes

[0036] Superoxide dismutase (SOD) activity was determined by the NBT photoreduction reaction, peroxidase (POD) activity was determined by the guaiacol method, and catalase (CAT) activity was determined by hydrogen peroxide. The results are as follows: Figures 10-12 As shown; SOD was used as the main identification indicator, and POD and CAT were used as auxiliary identification indicators. If the antioxidant enzyme activity of grape rootstock first increased and then decreased after salt treatment, the grape rootstock was a salt-sensitive variety. If the antioxidant enzyme activity of grape rootstock continued to increase after salt treatment, the grape rootstock was a salt-tolerant variety. After salt treatment, the activities of SOD, POD and CAT in salt-tolerant varieties were higher than those in salt-sensitive varieties. Among them, the activities of SOD and POD continued to increase in A and B, while in C and D, the activities increased before the onset of disease after salt treatment and decreased after the onset of disease. The activity of CAT showed a consistent trend in the four varieties, with the activity increasing after salt treatment and then decreasing after the onset of disease.

[0037] Example 5 Antioxidant substances

[0038] Malondialdehyde (MDA) content was determined using the thiobarbituric acid (TBA) method, hydrogen peroxide (H2O2) content was determined using the titanium salt colorimetric method, and superoxide anion (O2) content was determined using the hydroxylamine oxidation method. - ) content, results as follows Figures 13-15 As shown; With O2 - The primary identification indicator is H2O2, while the secondary identification indicators are MDA. If the content of antioxidants in grape rootstocks continues to rise after salt treatment, the grape rootstocks are salt-sensitive varieties; if the content of antioxidants in grape rootstocks first rises and then falls after salt treatment, the grape rootstocks are salt-tolerant varieties. H2O2 and O2 in A and B - After salt treatment, the MDA content increased slightly, then decreased to a lower level after the onset of the disease; while in C and D, the MDA content continued to increase or remained at a relatively high level; among the four varieties, B had the lowest overall MDA level, and the MDA content gradually decreased after salt treatment; in A, the MDA content increased after treatment and decreased after the onset of the disease; in C and D, the MDA content continued to increase.

[0039] Example 6 Antioxidant substances

[0040] The content of soluble sugars (SS) was determined using the anthrone colorimetric method, the content of soluble proteins (SP) was determined using the Coomassie Brilliant Blue G-250 method, and the content of proline (Pro) was determined using the ninhydrin colorimetric method; the results are as follows. Figures 16-18 As shown; Using Pro as the primary identification index and SS and SP as secondary identification indexes, if the content of osmotic regulators first increases and then decreases after salt treatment of grape rootstock, the grape rootstock is a salt-sensitive variety; if the content of osmotic regulators continues to increase after salt treatment of grape rootstock, the grape rootstock is a salt-tolerant variety. SP, SS, and Pro gradually increase in salt-tolerant varieties, while in salt-sensitive varieties, they decrease after a slight increase.

[0041] Example 7 Comprehensive Analysis

[0042] The data from Examples 3 to 6 were processed using Excel 2016 and SPSS 26.0 software. One-way ANOVA, principal component analysis, and correlation analysis were performed. Duncan's test was used for multiple comparisons and significance tests (P<0.05). The results are shown in Tables 3 and 4. Table 3 Correlation analysis of salt tolerance index

[0043] Through correlation analysis, O2 - A highly significant positive correlation was found with H2O2 (0.75), indicating the simultaneous accumulation of both reactive oxygen species (ROS) and exacerbating oxidative damage. Highly significant positive correlations were also found among SOD, POD, and CAT, suggesting that these three antioxidant enzymes work synergistically to scavenge ROS and maintain cellular oxidative balance. MDA and O2... - A significant positive correlation (0.457) indicates that the accumulation of reactive oxygen species leads to membrane damage. SS and SP are all highly significantly positively correlated with SOD, POD, and CAT, representing that osmotic regulators not only maintain cell turgor pressure but also synergistically enhance salt tolerance with the antioxidant system. Pro is significantly positively correlated with H2O2 and O2. - It showed a significant negative correlation, but no significant correlation with SOD, POD, or CAT. 2+ Significantly positively correlated with SOD, POD, CAT, and SS. K / Na and Ca / Na showed extremely significant positive correlations (0.951), but K... + and Ca 2+ The correlation was not significant.

[0044] Table 4 Principal Component Analysis of Salt Tolerance Index

[0045] Principal component analysis (PCA) was used to standardize the 15 indicators and then perform dimensionality reduction. Table 4 shows that the main information of the 15 indicators is concentrated in the first four principal components, with a cumulative contribution rate of 82.928%, indicating that these four principal components can reflect most of the information about grape salt tolerance. Principal component 1 has a contribution rate of 33.598%, with absolute loadings > 0.6 for SOD (0.765), POD (0.859), SS (0.874), SP (0.649), and CAT (0.806). These variables are mostly related to antioxidant enzyme activity and soluble substances, representing the antioxidant metabolism dimension. Principal component 2 has extremely high loadings (>0.85) for K / Na (0.884) and Ca / Na (0.934), reflecting ion balance characteristics and representing the ion homeostasis dimension. Principal component 3 has loadings > 0.85 for H2O2 (0.808) and O2. - (0.87) The loading is relatively high and is associated with plant oxidative stress and antioxidant defense systems. Principal component 4 and K + The K / Ca ratio (0.86) and K / Ca ratio (0.868) have relatively high loadings, and are also associated with ions, especially K+. + Balance-related.

[0046] The weights are calculated based on the principal component contribution rate. Combined with the score variables of the four principal components, the comprehensive score of each sample is calculated according to F = (0.33598 F1 + 0.25433 F2 + 0.12485 F3 + 0.11413 F4) / 0.82928. The results are shown in Table 5. Table 5. Sample Overall Scores and Rankings

[0047] The results showed that the salt-tolerant group scored significantly higher than the salt-sensitive group, effectively distinguishing samples with different salt tolerance levels, thus proving the reliability of the model.

[0048] As can be seen from the above embodiments, the present invention provides VvTIFY10A / VvNHX1 The application of salt tolerance index in the identification of salt tolerance in grape rootstocks. The identification method of the present invention has the advantages of simple operation, high accuracy, strong batch-to-batch stability, and complementarity with production experience, which is conducive to improving the accuracy of salt tolerance identification of grape rootstocks.

[0049] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. VvTIFY10A / VvNHX1 The application of salt tolerance index in the identification of salt tolerance in grape rootstocks, the VvTIFY10A The nucleotide sequence is shown in SEQ ID NO.

1. VvNHX1 The nucleotide sequence is shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that, The salt tolerance index includes one or more of the following: K / Na, Ca / Na, antioxidant enzyme activity, antioxidant content, and osmotic conditioning substance content. Antioxidant enzymes include superoxide dismutase, peroxidase, and catalase; Antioxidants include malondialdehyde, hydrogen peroxide, and superoxide anion; Osmotic regulators include soluble sugars, soluble proteins, and proline.

3. A method for identifying the salt tolerance of grape rootstock, characterized in that, Includes the following steps: (1) Treat grape rootstocks with 180~220mM sodium chloride solution; (2) Determine the identification indicators of grape rootstocks after salt treatment and / or VvTIFY10A / VvNHX1 ; The identification indicators include one or more of the following: K / Na, Ca / Na, antioxidant enzyme activity, antioxidant content, and osmotic regulating substance content. Antioxidant enzymes include superoxide dismutase, peroxidase, and catalase; Antioxidants include malondialdehyde, hydrogen peroxide, and superoxide anion; Osmotic regulators include soluble sugars, soluble proteins, and proline.

4. The identification method according to claim 3, characterized in that, The identification index is: VvTIFY10A / VvNHX1 At that time, if salt is applied to grape rootstock 1-3 hours after treatment, VvTIFY10A / VvNHX1 Rising and VvTIFY10A / VvNHX1 If the concentration of salt is ≥2, then the grape rootstock is a salt-sensitive variety; if salt treatment is applied to the grape rootstock 1-3 hours later... VvTIFY10A / VvNHX1 Decline and VvTIFY10A / VvNHX1 If the value is less than 2, then the grape rootstock is a salt-tolerant variety.

5. The identification method according to claim 3, characterized in that, When the identification indicators are K / Na and Ca / Na, if K / Na and Ca / Na increase before the onset of disease and decrease after the onset of disease in grape rootstocks treated with salt, then the grape rootstocks are salt-sensitive varieties. If the K / Na and Ca / Na ratios decrease after salt treatment of grape rootstocks before disease onset, then the grape rootstock is a salt-tolerant variety.

6. The identification method according to claim 3, characterized in that, When the identification index is antioxidant enzyme, if the antioxidant enzyme activity first increases and then decreases after salt treatment of grape rootstock, then the grape rootstock is a salt-sensitive variety; if the antioxidant enzyme activity content continues to increase after salt treatment of grape rootstock, then the grape rootstock is a salt-tolerant variety.

7. The identification method according to claim 3, characterized in that, When the detection index is antioxidants, if the content of antioxidants in grape rootstock continues to rise after salt treatment, then the grape rootstock is a salt-sensitive variety; if the content of antioxidants first rises and then falls after salt treatment, then the grape rootstock is a salt-tolerant variety.

8. The identification method according to claim 3, characterized in that, When the detection index is an osmotic regulator, if the content of the osmotic regulator first increases and then decreases after salt treatment of the grape rootstock, then the grape rootstock is a salt-sensitive variety; if the content of the osmotic regulator continues to increase after salt treatment of the grape rootstock, then the grape rootstock is a salt-tolerant variety.

9. The application of the identification method according to any one of claims 3 to 8 in the identification of salt tolerance of grape rootstocks.

Images