Breeding method for commercial line of Huayu chickens with white feather terminal paternal line

Abstract

The invention discloses a breeding method for a commercial line of tile grey chickens with a terminal paternal line being white feather, and relates to the technical field of poultry genetic breeding and propagation. The method comprises the following steps: hybridizing and breeding gray-feather Anyi tile gray chickens and spotted-feather snow-peak black-bone chickens to obtain spotted-feather black-bone chickens with genetic stability as a first paternal line; the white feather black-bone chicken with genetic stability is obtained through hybridization breeding of the gray-white feather Anyi tile grey chicken and the white feather Xuefeng black-bone chicken and serves as a terminal paternal line; hybridizing the first paternal line with hens of other mature lines to obtain F1-generation hybrid hens, and hybridizing the F1-generation hybrid hens with the terminal paternal line to obtain commercial-generation grey chickens. The method thoroughly solves the problem of provenance loss caused by feeding of the Anyi tile grey chicken stock, and the problems of poor stress resistance, poor meat quality and easiness in reverse research and development caused by simple binary miscellaneous trading. The growth speed and reproductive performance are improved by utilizing mature strains, the variety protection and industrialization requirements are considered, the matching mode is difficult to reversely simulate, and reliable technical support is provided for industrial standardization.

Description

Technical Field

[0001] This invention relates to the field of poultry genetics, breeding and reproduction technology, and in particular to a method for breeding a hybrid strain of Wagyu chickens with white-feathered terminal paternal line. Background Technology

[0002] Wahui chicken is a superior local breed of high-quality broiler chicken in my country. Among them, the Anyi Wahui chicken is distinguished by its unique "five gray" characteristics (gray feathers, gray comb, gray beak, gray skin, and gray shanks). It is characterized by its compact body, glossy feathers, strong disease resistance, excellent foraging ability, and tender, delicious meat, making it highly popular with consumers and a pillar industry of local agriculture. However, traditional Anyi Wahui chickens suffer from slow growth and poor uniformity in production performance, making it difficult to meet the demands of large-scale farming.

[0003] Currently, the production of Anyi Wahui chickens mainly relies on the purebred supply model from original breeding farms. This model directly provides original breeding flocks as the breeding source, which, while preserving the original characteristics of the breed to some extent, also brings many insurmountable drawbacks: (1) The contradiction between breed protection and development and utilization is acute: pure line supply leads to the direct flow of core original breed resources into the commercial production process, which is very easy to cause the loss of excellent alleles and the mixing of the genetic basis of the breed. This poses a serious threat to the long-term preservation of Anyi Wahui Chicken, a precious local breed, and makes it impossible to achieve a virtuous cycle of breed preservation and industrial development.

[0004] (2) Production performance is out of sync with market demand: The original An'yi Wahui chicken breed, which has not been systematically bred, generally has low growth rate, feed conversion rate and egg production performance. This results in long slaughter cycles and high costs for commercial broiler chickens, and the slaughter weight does not match the demand of the mainstream consumer market, which seriously restricts the large-scale development of the industry and its market competitiveness.

[0005] (3) Low industrialization adaptability: The original breeding supply model lacks a standardized breeding process and screening system, resulting in a lack of unified quality evaluation standards for Wahui chicken commercial products. It is difficult to connect with large-scale slaughtering and processing enterprises and standardized market circulation systems, thus restricting the large-scale and standardized development of the Wahui chicken industry.

[0006] To improve the growth performance of local chicken breeds, the industry typically employs hybrid breeding techniques, introducing high-egg-producing or fast-growing commercial strains. The Xuefeng Silkie Chicken is a nationally prized dual-purpose (meat and egg) Silkie chicken breed, characterized by its "five black" traits: black skin, black meat, black bones, black beak, and black feet. Its meat boasts significant nutritional and medicinal value, and it is also known for its tolerance to roughage and strong disease resistance. Its natural population contains different strains, including white-feathered, speckled-feathered, and black-feathered varieties, providing abundant genetic material for hybrid breeding. If the superior production performance of speckled-feathered and white-feathered strains in the Xuefeng Silkie Chicken can be skillfully integrated with the "five gray" traits of the Anyi Wahui Chicken, it is hoped that a new hybrid strain can be developed that combines excellent meat quality, a stable "five gray" appearance, and superior growth performance. However, for the Anyi Wahui Chicken, simple binary hybridization often fails to improve growth rate while maintaining the local breed's disease resistance and superior meat quality, and it also cannot minimize the risk of reverse engineering.

[0007] Therefore, in view of the fundamental defects of the existing Anyi Wahui chicken original breed supply model, as well as the limitations of the existing hybridization program in terms of parent selection and market adaptability, it is urgent to establish a brand-new supporting breeding program. Summary of the Invention

[0008] The purpose of this invention is to provide a breeding method for Wahui chickens with a white-feathered terminal paternal line, thereby solving the problems existing in the prior art. This invention constructs a three-level hybrid breeding system of "Hemp-feathered Silkie Chicken × Mature Strand♀ → White-feathered Silkie Chicken♂", achieving stable inheritance of the "five gray" traits in commercial Wahui chickens (≥99%). This completely solves the problem of seed source loss caused by the original breed supply, and addresses the issues of poor resistance, inferior meat quality, and susceptibility to reverse engineering that arise from simple binary hybrid trading. Utilizing a mature strain improves growth rate and reproductive performance, significantly increasing body weight at 4 months of age, balancing breed protection and industrialization needs. Furthermore, the breeding model is difficult to reverse engineer, providing reliable technical support for industrial standardization.

[0009] To achieve the above objectives, the present invention provides the following solution: This invention provides a method for breeding a Wagyu chicken hybrid with a white-feathered terminal paternal line, comprising the following steps: The first paternal line was developed, which was a genetically stable black-boned chicken strain obtained by crossbreeding and selecting gray-feathered Anyiwa gray chicken and black-boned Xuefeng black-boned chicken. Cultivate terminal paternal line, which is a genetically stable white-feathered black-bone chicken strain obtained by crossbreeding and selecting gray-white feather Anyiwa gray chicken and white-feathered Xuefeng black-bone chicken; First-level hybridization: The first paternal line is crossed with other mature breeds of hens to obtain F1 generation hybrid hens; Second-level hybridization: The terminal paternal line is hybridized with the F1 generation hybrid hen to obtain the commercial Daiwa Grey Chicken.

[0010] Optionally, the breeding of the first paternal line specifically includes hybridization of the Grey Feather Anyi Wa Grey Chicken and the Black-boned Chicken with Mottled Feathers to obtain the F1 generation hybrid population; Individuals with black skin, black flesh, and black bones were selected from the F1 generation hybrid population and crossbred to establish a breeding base population. In the aforementioned breeding base group, targeted breeding is carried out for 3-4 generations. The breeding goal is to achieve stable inheritance of the mottled feather trait, as well as the traits of black skin, black meat, and black bones, until a genetically stable mottled feather black-boned chicken strain is obtained.

[0011] Optionally, the feathers are described as being hemp-gray in color, closely attached to the body, and glossy.

[0012] Optionally, the breeding of the terminal paternal line specifically includes hybridizing the gray-and-white feathered Anyiwa gray chicken with the white feathered Xuefeng black-boned chicken as parents to obtain the F1 generation hybrid population; Individuals with black skin, black flesh, and black bones were selected from the F1 generation hybrid population and crossbred to obtain the F2 generation population; Using the F2 generation as the base population, targeted breeding was carried out for 3-4 generations until a genetically stable white-feathered black-bone chicken strain was obtained.

[0013] Optionally, the targeted breeding includes phenotypic breeding of the white feather trait and molecular marker-assisted breeding.

[0014] Optionally, the white feather characteristic is that the feathers are pure white without any other colors, and the feathers are compact and glossy.

[0015] Optionally, the steps of the molecular marker-assisted selection are as follows: The genotype of the SNP site at 255 bp of the sequence shown in SEQ ID NO.1 was detected in the breeding base population to be tested, and homozygous individuals with genotype AA were selected; The genotypes of SNP sites at positions 161, 223, 347, 376, 586, and 593 bp in the target breeding population as shown in SEQ ID NO.2 were detected, and homozygous individuals with genotypes of “CC, AA, TT, AA, TT and AA” or “TT, AA, TT, AA, CC and AA” at the corresponding sites were selected.

[0016] Optionally, the grey-feathered Anyiwa grey chicken and the grey-white-feathered Anyiwa grey chicken must have grey shanks, grey beaks, grey skin, and grey combs.

[0017] Optionally, the black-boned chickens of the Ma Yu Xuefeng variety and the black-boned chickens of the Bai Yu Xuefeng variety must possess the characteristics of black skin, black meat, black bones, black beak, and black feet.

[0018] Optionally, the other mature breeds of hens include any colored-feathered blue-legged or yellow-legged breeds.

[0019] The present invention discloses the following technical effects: This invention constructs a three-tiered hybridization system using a specialized black-boned chicken as the first paternal line and a white-boned chicken as the terminal paternal line, combined with rigorously selected parental materials. This fundamentally ensures the stable inheritance and high consistency (achievement rate ≥99%) of the "five gray" traits in the commercial Wahui chicken, completely overcoming the problem of germplasm loss caused by the original breeding stock supply, and the problems of poor resistance, inferior meat quality, and susceptibility to reverse engineering that arise from simple binary hybrid trading. Simultaneously, this supporting solution effectively isolates the core original breeding group of Anyi Wahui chicken from the commercial production stage, eliminating the risk of loss of superior germplasm resources at the source and achieving a virtuous cycle of breed protection and industrial development.

[0020] This invention significantly improves the reproductive performance of parent hens and the growth rate of commercial chickens by flexibly introducing high-yielding, fast-growing mature commercial chicken breeds as the maternal line in the first-stage hybridization. Examples show that, while maintaining excellent meat quality and typical appearance, the commercial Wagyu chicken achieves a significantly higher slaughter weight at 4 months of age, better meeting the demands of large-scale farming and the mainstream consumer market for production efficiency. The ingenious design of this system, producing commercial chickens with gray feathers while the parent and terminal sire lines are mottled and white-feathered respectively, greatly increases the difficulty and cost of reverse engineering, providing reliable technical support for the standardized and large-scale development of the Wagyu chicken industry. Detailed Implementation

[0021] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0022] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0023] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0024] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0025] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0026] This invention uses Anyi Wahui chicken and Xuefeng black-boned chicken white-feathered strain as core breeding materials. Through targeted breeding, the first paternal line and terminal paternal line are synthesized, and then a mature strain is introduced to construct a three-level hybridization model, ultimately obtaining the target commercial Wahui chicken. The specific steps are as follows: Step 1: Preparation of breeding materials Basic population selection: Select gray-feathered and gray-white-feathered groups from the Anyi Wahui chicken population, requiring them to have complete "gray shanks, gray beaks, gray skin, and gray combs", good growth and development, excellent reproductive performance, and health without genetic defects; select purebred white-feathered and mottled-feathered Xuefeng black-boned chicken populations, requiring them to have the "five black" characteristics (black skin, black meat, black bones, black beak, and black feet). Population purification: The selected Anyi Wahui chicken and Xuefeng black-bone chicken populations were purified by two-white purification, and the basic population size was controlled at ≥50 roosters and ≥300 hens to ensure genetic diversity. Specialized paternal line synthesis and selection: (1) Synthesis and breeding of the first paternal line (Black-boned Chicken) Anyi Wahui chicken was used as the female parent (male parent) and Xuefeng black-boned chicken with mottled feathers was used as the male parent (female parent) to crossbreed and obtain the F1 generation hybrid population. Individuals with black skin, black meat and black bones were selected from the F1 generation for crossbreeding and fixation to establish the basic breeding group.

[0027] Targeted breeding criteria: Focus on screening for the mottled feather trait (feathers are mottled gray, close to the body and glossy), while retaining the characteristics of Silkie chickens (black skin, black meat, black bones).

[0028] Breeding method: A combination of individual selection and family selection is adopted to continuously select and breed for 3-4 generations until the traits of black-boned chickens are stably inherited (homozygosity ≥95%), and the growth and reproductive performance indicators meet the selection standards, thus forming a genetically stable first paternal line (black-boned chicken strain).

[0029] (2) Synthesis and breeding of terminal paternal line (white-feathered black-boned chicken) The Xuefeng Silkie Chicken (white-feathered strain) was used as the female parent (male parent) and the Anyi Wahui Chicken (male parent) was used as the male parent (female parent) to obtain the F1 generation hybrid population. Individuals with black skin, black meat, and black bones were selected from the F1 generation for crossbreeding and fixation. The F2 generation was then selected for directional breeding to establish a basic population.

[0030] Targeted breeding method: A combination of phenotypic selection and molecular marker-assisted selection is adopted. The phenotype of white feathers (pure white feathers that are close to the body and have a glossy appearance) is selected. Specific markers are designed for genes related to black bones to assist in the screening of homozygous individuals. Continuous breeding is carried out for 3-4 generations or more until the target trait is completely and stably inherited and the growth performance indicators meet the standards, thus forming the terminal paternal line (white-feathered black-boned chicken strain).

[0031] Step 2: Construction of hybridization model and commercial breeding A three-stage hybridization model was adopted, with the specific hybridization combinations as follows: First-level hybridization: Introduce a mature, high-quality chicken breed (any colored-feather breed, blue-legged or yellow-legged, with weight meeting the breeding target) as the female parent, and hybridize it with the first paternal line (black-feathered Silkie chicken) bred above as the male parent to obtain F1 generation hybrid hens (denoted as F1♀); the core objective of this step is to utilize the high reproductive and growth performance of the mature breed to increase the egg production and hatchability of F1 generation hens.

[0032] Second-level hybridization: Using F1♀ as the female parent and the cultivated terminal paternal line (white-feathered Silkie chicken) as the male parent, hybridization is carried out to obtain the commercial Daiwa Grey Chicken.

[0033] Step 3: Product Verification The production performance of commercial individuals obtained through hybridization was verified, with core indicators including: physical appearance traits (five-gray characteristic), average slaughter weight, etc. Details are as follows: Example 1: Small-scale verification test of the supporting seed production method This embodiment aims to verify the feasibility and reliability of the supporting breeding method of the present invention through small-scale laboratory breeding experiments, and to examine whether the core traits of the obtained commercial Daiwa Grey Chicken meet the target requirements, so as to provide experimental basis for subsequent large-scale breeding.

[0034] Step 1: Preparation of breeding materials Basic population selection: Select gray-feathered groups (gray comb, gray beak, gray skin and gray feet) and gray-white-feathered groups from the Wahui chicken population that are growing and developing well, have excellent reproductive performance, and are healthy without genetic defects; select purebred groups of white-feathered and mottled-feathered Xuefeng Silkie chickens, requiring them to have the "five black" characteristics (black skin, black meat, black bones, black beak and black feet).

[0035] Population purification: Selected Anyi Wahui chicken and Xuefeng black-bone chicken populations were purified of pullorum disease and leukemia (referred to as "two whites") to ensure the health of the basic population.

[0036] Specialized paternal line synthesis and selection: (1) Synthesis and breeding of the first paternal line (Black-boned Chicken) Using the grey-feathered Anyiwa Grey Chicken as the sire and the mottled-feathered Xuefeng Silkie Chicken as the dam, a cross was conducted at a male-to-female ratio of 1:10 to obtain 100 F1 generation hybrids. From the F1 generation, individuals possessing black skin, black meat, and black bones (5 roosters and 50 hens) were selected for crossbreeding to obtain 500 F2 generation individuals. Further selection yielded 10 mottled-feathered roosters that retained the characteristics of black skin, black meat, and black bones. These 10 roosters were designated as the first sire (named A) and used for crossbreeding with subsequently introduced strains.

[0037] (2) Synthesis and breeding of terminal paternal line (white-feathered black-boned chicken) Preparation of white-feathered roosters: The An'yi Wa Grey Chicken (grey-white feathers, gray comb, gray beak, gray skin and gray feet) with gray-white feathers was used as the male parent and the Xuefeng Black-boned Chicken with white feathers was used as the female parent for crossbreeding. Natural mating was carried out at a male-to-female ratio of 1:10 to obtain 100 F1 generation hybrid individuals. From the F1 generation, individuals with black skin, black meat and black bones (5 roosters and 50 hens) were selected for crossbreeding to obtain 300 F2 generation roosters with white feathers (pure white feathers that are close to the body and have a glossy appearance).

[0038] To obtain terminal paternal lines with more homozygous genetic background and more stable traits, molecular marker-assisted selection was performed on the aforementioned 300 male Silkie chickens. The specific steps are as follows: ① Target genotyping. Genomic DNA was extracted from rooster blood, and specific primers were designed (Table 1). The target fragment was amplified by PCR and sent to Shanghai Jierui Biotechnology Co., Ltd. for sequencing.

[0039] Table 1 Primer Information The target fragment sequence amplified by primers HF and HR is as follows: TCACGGTCACCGCCTCACAGAGGGTGTGGGCCTGGGTCTCCAGGCAACAGAGCAGAGGCTCTGGCAGGCAGTGCAGCGTCACGTCAGGAATTATGGCTTCCCTCAACCTGCTGGCACTGCTGCCCCG GCCAGAGCCACGAGCGGAGATGTCCCTTGGCCAAGGCTGCAGCGCTGGAGCCACGCTAGCATTTCTTGGCTGAGTCCAGCCTAGGTTTCTAGACAGTCTAGTAAACATTTGCAAGTCAACAGCATATW TGGTATCTAGCGTGCGTGGTGAGTGACTTTCTACGTGGTTTGATAGGTATTGGACAAGCTGAACAAGCTTTAATCTAAAAGAGGAGATGAGATTAACTCGTAGGGGAAATGCTTTCCTCGGGGATTTGGGAGTGGATGTGCACTGCAACAGGTTGCCCGGGGAGGCCGTGGGGTCACCGTCCCTGGATGCGTGCAGGAACCATGCTGATGTAGCACTGAGGGGCATGTTCAGTGGGCATGGAAGGGATGACCCGTCTGAATGCCTACCTGTGCAGCCTGCTGAGCCTGCCCTGGCAGGCAATTTGGACACGCTGAT (SEQ ID NO.1).

[0040] The target fragments amplified by primers MC1RAF and MC1RAR are as follows: GAGGGCAACCAGAGCAATGCCACGGCCGGGGCCGGAGGTGCCTGGTGCCAGGGGCTGGACATCCCCAATGAGCTCTTCCTGACGCTGGGGCTGGTGAGCCTGGTGGAGAACCTGCTGGTGGTGGCCGCCATCCTCAAGAACAGGAATCTGCACTCGCCCA S GTACTACTTCATCTGCTGCCTGGCCGTCTCCGACATGCTGGTGAGCGTCAGCAACCTGGCC R AGACGCTCTTCATGCTGCTGATGGAGCACGGCGTGCTGGTGATCCGCGCCAGCATCGTCCGCCACATGGACAATGTCATCGACATGCTCATCTGCAGCTCCGTCGTGTCCTCCCTCTCCTTCC Y GGGGGTCATCGCCGTGGACCGCTACATC RCCATCTTCTATGCGCTGCGCTACCACAGCATCATGACGCTGCAGCGCGCCGTGGTCACCATGGCCAGCGTCTGGCTGGCCAGCACCGTCTCCAGCACCGTCTTAATCACCTACTACCGCAACAACGCCATCCTTGCTCTGCCTCATTGGCTTCTTCCTCTTCATGCTGGTCCTCATGCTGGTGCTCTACATTCACATGTTCGCGCTGGCG Y GCCACC M CGTGCGCAGCATCTCCAGCCAGCAGAAGCAGCCCACCATCTACCGCACCAGCAGCCTGAAGGGAGCCGTCACGCTCACCATCCTGCTGGGAGTCTTCTTCATCTGCTGGGGGCCCTTCTTCTTCCACCTCATCCTCATCGTCACCTGCCCCACCAACCCCTTCTGCACCTGCTTCTTCAGCTATTTCAACCTCTTCCTCATCCTCATCATCTG (SEQ ID NO. 2).

[0041] ②Select Taobao H site selection: Based on the sequencing results, homozygous (AA) individuals with base A at position 255bp in the amplified fragment shown in SEQ ID NO.1 were selected.

[0042] Selection of the e site (MC1R gene-related site): Based on the sequencing results, examine the bases at positions 161, 223, 347, 376, 586, and 593 bp in the amplified fragment shown in SEQ ID NO.2. Select homozygous individuals whose genotypes at the corresponding sites are "CC, AA, TT, AA, TT, AA" or "TT, AA, TT, AA, CC, AA".

[0043] Based on the above molecular marker screening results, 10 homozygous outstanding individuals that meet the requirements were finally selected from 300 roosters to serve as terminal paternities.

[0044] Step 2: Construction of hybridization model and commercial breeding First-stage hybridization: Hens of different breeds were crossed with the first paternal line. The introduced breeds were named C1, C2, and C3, and their basic physical characteristics are shown in Table 2. Twenty-five hens from each of the three breeds were crossbred with ten roosters from the first paternal line (mixed insemination), and 25 healthy and well-developed offspring hens were selected from the offspring of each hybrid combination.

[0045] Table 2 Basic characteristics of the introduced strains Second-stage hybridization: Ten roosters from the terminal paternal line were crossbred with hens selected from the first-stage hybridization to obtain commercial broiler chickens. The results are shown in Table 3. All commercial individuals from the various hybridization combinations, regardless of sex, exhibited the "five gray characteristics" (gray feathers, gray shanks, gray beak, gray skin, and gray comb) of the Wahui chicken. This indicates that this hybridization model can meet the requirements for producing Wahui chickens with these five gray characteristics and can be used for breeding new Wahui chicken varieties, unaffected by the feather and skin color of the introduced C-line maternal parent.

[0046] Table 3. Physical characteristics of offspring from different mating lines Example 2 introduces the Qingjiao Ma chicken as a breeding line for a mature strain. This embodiment uses the Qingjiao Ma chicken as a mature, high-quality breed, and constructs a three-stage hybridization model with a specially bred paternal line. The aim is to demonstrate how the breeding method of this invention can stably produce commercial Daiwa Grey chickens with both excellent "five-gray" appearance and good production performance under near-industrial-scale conditions. The specific breeding process is as follows: Step 1: Preparation of breeding materials Selection of the basic breeding population: Select gray-feathered groups (gray comb, gray beak, gray skin, and gray feet) and gray-white-feathered groups from the gray chicken population that are growing and developing well, have excellent reproductive performance, and are healthy without genetic defects, including 100 gray-feathered roosters and 100 gray-white-feathered roosters; Select purebred white-feathered and mottled-feathered Xuefeng Silkie chickens, which are required to have the "five black" characteristics (black skin, black meat, black bones, black beak, and black feet), including 500 white-feathered hens and 500 mottled-feathered hens.

[0047] Population purification: The selected Anyi Wahui chicken and Xuefeng black-bone chicken populations were purified of pullorum disease and leukemia (referred to as "two whites") to ensure the health of the basic population. Finally, 60 gray-feathered Wahui chicken roosters, 60 gray-white-feathered Wahui chicken roosters, 300 white-feathered Xuefeng black-bone chicken hens, and 300 mottled-feathered Xuefeng black-bone chicken hens were selected.

[0048] Specialized paternal line synthesis and selection: (1) Synthesis and breeding of the first paternal line (Black-boned Chicken) Using the grey-feathered Anyiwa Grey Chicken as the male parent and the mottled-feathered Xuefeng Silkie Chicken as the female parent, a crossbreeding was conducted at a male-to-female ratio of 1:10 to obtain 2,520 F1 generation hybrid individuals. From the F1 generation, individuals with black skin, black meat, and black bones (100 roosters and 1,000 hens) were selected for crossbreeding and fixation to obtain 10,000 F2 generation individuals. Further selection was conducted to identify 2,500 mottled-feathered (feathers are mottled grey, close to the body and glossy) roosters that retained the characteristics of black skin, black meat, and black bones, thus establishing a basic breeding group.

[0049] The breeding process combines individual selection with family selection for three generations. In each generation, the core group is selected based on the purity of the mottled feather trait, the integrity of the black-boned characteristics, and the growth and reproductive performance. After the third generation, the homozygosity of the mottled feather and black-boned chicken traits is 100%. At four months of age, the weight of roosters is 1500g, the weight of hens is 1200g, the age at first laying is 140 days, and the fertilization rate of hatching eggs is 95%, thus forming a genetically stable first paternal line (mottled black-boned chicken strain).

[0050] (2) Synthesis and breeding of terminal paternal line (white-feathered black-boned chicken) The Anyi Wa Grey Chicken (grey-white feathers, grey comb, grey beak, grey skin, and grey feet) was used as the male parent and the Xuefeng Black-boned Chicken with white feathers was used as the female parent for crossbreeding. Natural mating was carried out at a male-to-female ratio of 1:10, and 2,410 F1 generation hybrid individuals were obtained. From the F1 generation, individuals with excellent black skin, black meat, and black bones (100 roosters and 1,000 hens) were selected for crossbreeding and fixation. The F2 generation with white feathers (white feathers that are close to the body and have a glossy appearance) was selected to establish the foundation group.

[0051] To accelerate the breeding process and improve selection accuracy, molecular marker-assisted selection was implemented for the basic population. The specific operation was the same as step (2) in Example 1. The primers in Table 1 were used to perform genotyping on the candidate individuals at the H locus and MC1R gene-related locus. Homozygous superior individuals that met the "AA" genotype (H locus) and the genotype combination of "CC, AA, TT, AA, TT and AA" or "TT, AA, TT, AA, CC and AA" (MC1R gene-related locus) were selected. Finally, 100 roosters and 1000 hens were selected from the individuals that underwent molecular selection to form the basic population.

[0052] A combination of individual and pedigree selection was used to continuously breed for three generations, selecting individuals with excellent white feathers, black skin, black meat, and black bones in each generation. After four generations of continuous breeding, the white feather homozygosity reached 100%, the "five black" characteristics were complete, the weight of 4-month-old roosters was 1500g, and that of hens was 1200g. The fertilization rate of hatching eggs was 95%, and the hatching rate of fertilized eggs was 90.1%, forming a stable terminal paternal line (white-feathered black-boned chicken strain).

[0053] Step 2: Construction of hybridization model and commercial breeding First-stage hybridization: Green-legged Ma chickens were introduced as the female parent (60 roosters and 350 hens, with body weights meeting the breeding target; 4-month-old roosters weighed 3500g and hens 2800g). These were hybridized with the first paternal line (Ma-feathered Silkie chickens) roosters at a male-to-female ratio of 1:11. 3800 hatching eggs were collected, yielding 1720 F1 generation hybrid hens. These F1 generation hens began laying eggs at 143 days of age, producing 183 eggs at 500 days of age, with a fertilization rate of 95%, achieving the genetic transmission of high reproductive performance.

[0054] Second-stage hybridization: F1 generation hens were used as the female parent and hybridized with cultivated terminal paternal line (white-feathered black-bone chicken) roosters at a male-to-female ratio of 1:10. 14,500 hatching eggs were collected and incubated under standard incubation conditions (temperature 37.8-38.2℃, humidity 55-65%) to obtain 11,860 commercial individuals.

[0055] Step 3: Product Verification The above-mentioned commercial individuals were tested for appearance and production performance: In terms of appearance, 99% of the individuals had complete "five gray" characteristics (gray feathers, gray shanks, gray beak, gray skin and gray comb), and there were no unqualified individuals with mixed-color feathers or non-gray shanks; in terms of production performance, the average weight of commercial roosters at 4 months of age was 1950g, and that of hens was 1600g.

[0056] The above results fully demonstrate that the supporting scheme for producing Wahui chickens with a first paternal line of mottled feathers and a terminal paternal line of white feathers provided by this invention can not only completely solve the problems of feather color separation and loss of breeding stock caused by traditional pure breeding, but also significantly improve the growth rate and reproductive performance of commercial Wahui chickens by introducing strains with excellent production performance, thus achieving a perfect unity of protecting the excellent traits of local breeds and efficient industrial utilization.

[0057] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A method for breeding a hybrid of white-feathered Wagyu chickens with a terminal paternal line, characterized in that, Includes the following steps: The first paternal line was developed, which was a genetically stable black-boned chicken strain obtained by crossbreeding and selecting gray-feathered Anyiwa gray chicken and black-boned Xuefeng black-boned chicken. Cultivate terminal paternal line, which is a genetically stable white-feathered black-bone chicken strain obtained by crossbreeding and selecting gray-white feather Anyiwa gray chicken and white-feathered Xuefeng black-bone chicken; First-level hybridization: The first paternal line is crossed with other mature breeds of hens to obtain F1 generation hybrid hens; Second-level hybridization: The terminal paternal line is hybridized with the F1 generation hybrid hen to obtain the commercial Daiwa Grey Chicken.

2. The method for breeding the Wahui chicken breeding system according to claim 1, characterized in that, The breeding of the first paternal line specifically includes hybridization of the Grey Feather Anyi Wa Grey Chicken and the Black-boned Chicken with Mottled Feathers Xuefeng to obtain the F1 generation hybrid population; Individuals with black skin, black flesh, and black bones were selected from the F1 generation hybrid population and crossbred to establish a breeding base population. In the aforementioned breeding base group, targeted breeding is carried out for 3-4 generations. The breeding goal is to achieve stable inheritance of the mottled feather trait, as well as the traits of black skin, black meat, and black bones, until a genetically stable mottled feather black-boned chicken strain is obtained.

3. The method for breeding the Wahui chicken breeding system according to claim 2, characterized in that, The feathers described are grayish-brown, close to the body, and glossy.

4. The method for breeding the Wahui chicken breeding system according to claim 1, characterized in that, The breeding of the terminal paternal line specifically includes hybridization of the gray-and-white feathered Anyiwa gray chicken and the white-feathered Xuefeng black-boned chicken as parents to obtain the F1 generation hybrid population; Individuals with black skin, black flesh, and black bones were selected from the F1 generation hybrid population and crossbred to obtain the F2 generation population; Using the F2 generation as the base population, targeted breeding was carried out for 3-4 generations until a genetically stable white-feathered black-bone chicken strain was obtained.

5. The method for breeding the Wahui chicken breeding system according to claim 4, characterized in that, The targeted breeding includes phenotypic selection of the white feather trait and molecular marker-assisted selection.

6. The method for breeding the Wahui chicken breeding system according to claim 5, characterized in that, The white feathers are characterized by pure white feathers without any other colors, and the feathers are compact and glossy.

7. The method for breeding the Wahui chicken breeding system according to claim 5, characterized in that, The steps of the molecular marker-assisted selection are as follows: The genotype of the SNP site at 255 bp of the sequence shown in SEQ ID NO.1 was detected in the breeding base population to be tested, and homozygous individuals with genotype AA were selected; The genotypes of SNP loci at positions 161, 223, 347, 376, 586, and 593 bp in the breeding population to be tested were detected, and homozygous individuals with genotypes of "CC, AA, TT, AA, TT and AA" or "TT, AA, TT, AA, CC and AA" at the corresponding loci were selected.

8. The method for breeding the Wahui chicken breeding system according to claim 1, characterized in that, The grey-feathered Anyiwa grey chicken and the grey-white-feathered Anyiwa grey chicken must have grey shanks, grey beaks, grey skin, and grey combs.

9. The method for breeding the Wahui chicken breeding system according to claim 1, characterized in that, The black-boned chickens described above, including the white-boned black-boned chickens, must possess the characteristics of black skin, black meat, black bones, black beak, and black feet.

10. The method for breeding the Wahui chicken breeding system according to claim 1, characterized in that, The other mature breeds of hens include any colored-feathered breed with blue or yellow legs.

Images