Medical application of ephedra cochinchinensis flavone Renifolin F

Abstract

The invention relates to the technical field of medicines, in particular to medical application of ephedra cochinchinensis flavone Renifolin F. The ephedra cochinchinensis flavone Renifolin F prepared from ephedra cochinchinensis can inhibit the generation of miR-155 and effectively inhibit the combination of miR-155 and SOCS1, so that the SOCS1 is up-regulated to perform negative feedback regulation on a JAK / STAT pathway, the acute lung injury is effectively antagonized, and the ephedra cochinchinensis flavone Renifolin F is one of main functional components of ephedra cochinchinensis and ephedra cochinchinensis extract for treating the acute lung injury and has a broad application prospect. The discovery has great influence on research and treatment of acute lung injury diseases, and has clinical practical value.

Description

Technical Field

[0001] This invention relates to the field of pharmaceutical technology, specifically to the pharmaceutical uses of Renifolin F, a flavonoid from Ephedra sinica. Background Technology

[0002] Acute lung injury (ALI) is a disease characterized by impaired lung diffusion capacity, caused by various direct or indirect factors such as trauma, infection, inhalation of harmful gases, and shock. Treatment options for ALI are limited. Clinical treatments mainly include a combination of medication and mechanical ventilation. Anti-inflammatory drugs such as corticosteroids and antioxidants such as N-acetylcysteine ​​are primarily used to treat ALI, but these drugs have significant side effects, and their clinical application remains controversial. Clinically, mechanical ventilation and extracorporeal membrane oxygenation (ECMO) are mainly used to alleviate symptoms and improve patient survival. Although strategies for treating ALI are constantly being improved, there is currently no clinically approved specific treatment for this condition. Therefore, actively seeking more effective treatments for ALI is crucial. In recent years, gene-targeted therapy has brought new ideas to the treatment of acute lung injury. MicroRNAs (miRNAs) are a novel non-coding RNA molecular pathway that can regulate gene expression at the post-transcriptional level. Each miRNA can regulate the expression of multiple genes and is closely related to the development and occurrence of various diseases, providing new molecular targets for disease treatment.

[0003] MicroRNAs regulate various cellular functions by modulating specific target genes, acting as regulators of immune responses and participating in the development of multiple inflammatory diseases, including acute lung injury (ALI). MicroRNA-155 (miR-155) is one of several miRNAs associated with the pathogenesis of ALI. Clinical studies of ALI have shown significantly upregulated miR-155 expression in peripheral blood and LPS-induced lung tissue of mice, suggesting it may be a potential therapeutic target for ALI / ARDS. miR-155 can target and bind to the mRNAs of various inflammation-related proteins and inhibit their expression, regulating immune responses and promoting inflammation, playing a crucial role in regulating both acute and chronic inflammation. In LPS-induced ALI, miR-155 promotes inflammatory responses by targeting SOCS1, and its target gene SOCS1 negatively regulates JAK-STAT signaling by blocking JAK2 / STAT3 phosphorylation.

[0004] Ephedra sinica, the dried root of *Strombus chinensis*, a plant in the genus *Strombus* of the Fabaceae family, is a traditional Chinese medicine in Yunnan and surrounding areas. Also known as "Strombus chinensis" or "copper coin root," it has antitussive, expectorant, antiasthmatic, anti-inflammatory, and intestinal motility-promoting effects, and is a commonly used folk remedy for colds and coughs. Therefore, this invention further studies the active components of Ephedra sinica and develops a MiR-155 inhibitor, which is of great significance. Summary of the Invention

[0005] To overcome the shortcomings of existing technologies, this invention extracts one of the main active ingredients, Renifolin F, from Ephedra sinica. Pharmacological and efficacy studies were conducted on Renifolin F and its corresponding pharmaceutical preparations. The results showed that it can significantly inhibit the production of miR-155 and effectively inhibit its binding to SOCS1, thereby upregulating SOCS1 to negatively regulate the JAK / STAT pathway and effectively antagonizing the occurrence of acute lung injury.

[0006] One objective of this invention is the application of Renifolin F in the preparation of drugs for treating acute lung injury; the structural formula of Renifolin F is shown in Formula I: Formula I.

[0007] The following applications are also within the scope of protection of this invention: Application of Renifolin F in the preparation of miR-155 inhibitors.

[0008] Application of Renifolin F in the preparation of drugs for acute respiratory distress syndrome (ALI / ARDS).

[0009] Furthermore, the compound represented by Formula I is obtained by extraction and isolation from Ephedra sinica or by artificial synthesis.

[0010] Unless otherwise indicated, all stereoisomers, geometric isomers, tautomers, nitrides, hydrates, solvates, metabolites, salts, and pharmaceutically acceptable prodrugs of Renifolin F of the present invention are within the scope of the present invention.

[0011] In particular, the pharmaceutically acceptable salt of the said Renifolin F is a physiologically acceptable salt (especially when administered as a drug to humans and / or mammals).

[0012] Furthermore, the drug's mechanism of action is manifested in inhibiting miR-155 expression levels.

[0013] Furthermore, the drug uses Renifolin F or a pharmaceutically acceptable salt thereof as its active ingredient, and is formulated into a pharmaceutically acceptable dosage form using pharmaceutically acceptable excipients. The structural formula of Renifolin F is shown in Formula I. Formula I.

[0014] Another object of the present invention is to provide a pharmaceutical composition for treating acute lung injury, said pharmaceutical composition comprising a compound of formula I or a pharmaceutically acceptable salt thereof, and pharmaceutically acceptable excipients. Formula I Furthermore, the pharmaceutical composition also contains other components with anti-acute lung injury activity for compound use.

[0015] The content of Renifolin F in the pharmaceutical composition for treating acute lung injury and / or acute respiratory distress syndrome (ALI / ARDS) accounts for 1-99% of the total pharmaceutical composition. Preferably, the content of Renifolin F accounts for 3-85% of the pharmaceutical composition. More preferably, the content of Renifolin F accounts for 5-50% of the pharmaceutical composition. Most preferably, the content of Renifolin F accounts for 15-30% of the pharmaceutical composition.

[0016] Another object of the present invention is to provide a method for treating acute lung injury, comprising administering to a patient a therapeutically effective amount of Renifolin F.

[0017] In other words, this invention relates to a new application of Renifolin F or herbal extracts containing Renifolin F in the treatment of acute lung injury, providing a new pharmaceutical application for the treatment of acute lung injury, or a pharmaceutically acceptable salt or solvate thereof, or a herbal extract containing an effective amount for the treatment of acute lung injury, i.e., a new application in the treatment of acute lung injury.

[0018] The acute lung injury described in this article mainly refers to infectious acute lung injury and respiratory distress syndrome caused by the deterioration of lung injury. The infectious acute lung injury is selected from: major infectious acute lung injury caused by SARS virus, influenza A virus, avian influenza virus, as well as lung injury caused by Escherichia coli, Pseudomonas aeruginosa, Streptococcus pneumoniae, Staphylococcus aureus, Klebsiella pneumoniae, and influenza virus infection.

[0019] Those skilled in the art will fully understand that the pharmaceutically acceptable excipients are generally recognized for use in this purpose and as inactive ingredients in the pharmaceutical preparation.

[0020] The excipients include solvents, propellants, solubilizers, co-solvents, emulsifiers, colorants, binders, disintegrants, fillers, lubricants, wetting agents, osmotic pressure regulators, stabilizers, flow aids, flavoring agents, preservatives, suspending agents, coating materials, fragrances, anti-adhesion agents, binding agents, penetration enhancers, pH adjusters, buffers, plasticizers, surfactants, foaming agents, defoamers, thickeners, encapsulating agents, humectants, absorbents, diluents, flocculants and anti-flocculation agents, filter aids, and release inhibitors.

[0021] The diluent can be one or more of mannitol, sucrose, lactose, sorbitol, xylitol, polyethylene glycol, propylene glycol, vegetable oil, and mineral oil; the disintegrant can be one or more of croscarmellose sodium, colloidal silica, and citric acid; the binder can be one or more of starch paste, ethanol, water, and povidone alcohol solution; the preservative can be one or more of ethylparaben, propylparaben, sorbic acid, potassium sorbate, calcium propionate, sodium dehydroacetate, sodium diacetate, and sodium lactate; and the antioxidant can be ethylenediaminetetraacetic acid, disodium ethylenediaminetetraacetate, butylated hydroxytoluene, glycine, inositol, and other antioxidants. The flavoring agent may be one or more of the following: citric acid, sodium ascorbate, lecithin, malic acid, hydroquinone, citric acid, succinic acid, and sodium metabisulfite; the flavoring agent may be one or more of the following: aspartame, sucrose, xylitol, steviol glycosides, cyclamate, sorbitol, cocoa, pure vanilla, vanillin, ethyl vanillin, chocolate, malt, and mint; the suspending agent may be one or more of the following: xanthan gum, polyvinylpyrrolidone, sodium alginate, aluminum stearate, and hydrogenated vegetable oil; the emulsifier may be one or more of the following: alkyl sulfate, soap, dodecylbenzene sulfonate, lactate, sulfosuccinate, monoglyceride sulfonate, phosphate ester, siloxane, and taurine.

[0022] The drug exists in the form of tablets, capsules, pills, powders, granules, syrups, solutions, emulsions, injections, sprays, aerosols, and patches.

[0023] The drug is administered via gastrointestinal and non-gastrointestinal routes.

[0024] Specifically, the non-gastrointestinal route of administration is selected from injection, respiratory administration, skin administration, mucosal administration, or cavity administration.

[0025] Non-gastrointestinal drug delivery preparations are selected from injections, sprays, aerosols, patches, etc.

[0026] Specifically, the gastrointestinal administration formulation is selected from tablets, capsules, powders, granules, pills, solutions, emulsions, or syrups.

[0027] The pharmaceutical composition of the present invention contains 0.1-90% by weight of Renifolin F; preferably, the content of Renifolin F accounts for 3-85% of the pharmaceutical composition, more preferably, the content of Renifolin F accounts for 5-50% of the pharmaceutical composition, and most preferably, the content of Renifolin F accounts for 15-30% of the pharmaceutical composition.

[0028] Pharmaceutical compositions may be prepared according to methods known in the art. For this purpose, if desired, the active ingredient may be combined with one or more solid or liquid pharmaceutical excipients and / or adjuvants to form a suitable administration or dosage form for human use.

[0029] In addition, colorants, preservatives, flavorings, tasters, sweeteners or other materials may be added to pharmaceutical preparations if necessary.

[0030] Those skilled in the art will understand that the dosage of the pharmaceutical composition of the present invention depends on many factors, such as the sex, age, weight, and individual response of the patient or animal, the route of administration, and the frequency of administration. The dosage can be administered in a single dose or in several doses, such as two, three, or four doses. The dosage level must be selected based on the specific route of administration, the severity of the condition being treated, and the patient's condition and medical history. However, it is the practice in the art to start with a dosage below the level required to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.

[0031] Unless otherwise stated, the term “therapeutic effective dose” as used herein refers to the dosage of a drug required to produce an effective effect; “therapeutic effective dose” is subject to adjustment and variation and is ultimately determined by healthcare professionals, taking into account factors such as the route of administration and the nature of the formulation, the recipient’s weight, age and other general characteristics, as well as the nature and severity of the disease being treated.

[0032] Generally speaking, the dosage of the pharmaceutical composition of the present invention for mammals, especially humans, calculated based on the active ingredient, can be between 1 and 1000 mg / kg body weight / day, for example between 1 and 500 mg / kg body weight / day, for example between 50 and 500 mg / kg body weight / day, or 100 and 500 mg / kg, or 150 and 500 mg / kg, or 200 and 500 mg / kg, or 250 and 500 mg / kg.

[0033] The Renifolin F flavonoid obtained from Ephedra sinica in this invention can inhibit the production of miR-155 and effectively inhibit its binding to SOCS1, thereby upregulating SOCS1 to negatively regulate the JAK / STAT pathway. It can effectively antagonize the occurrence of acute lung injury and is one of the main active ingredients of Ephedra sinica and its extracts in the treatment of acute lung injury. This discovery has a significant impact on the research and treatment of acute lung injury and has clinical practical value. Attached Figure Description

[0034] Figure 1 The effects of Renifolin F on IL-6, TNF-α, and IL-1β in the BALF of mice with acute lung injury were investigated; compared with the normal group, ## P < 0.01, # P < 0.05; compared with the model group, P < 0.01, P < 0.05; Figure 2 The effect of Renifolin F on serum IL-6, TNF-α, and IL-1β in mice with acute lung injury; among them, compared with the normal group, ## P < 0.01, # P < 0.05; compared with the model group, P < 0.01, P < 0.05; Figure 3 The effect of this study on the dry-wet weight ratio of the lungs in mice with acute lung injury; compared with the normal group, ## P < 0.01, # P < 0.05; compared with the model group, P < 0.01, P < 0.05; Figure 4 The results of Renifolin staining of lung tissue from mice with acute lung injury (H&E staining). Figure 5 The effect of Renifolin F on the expression level of microRNA-155 in lung tissue of mice with acute lung injury was investigated; compared with the normal group, ## P < 0.01, # P < 0.05; compared with the model group, P < 0.01, P < 0.05; Figure 6The effect of Renifolin F on SOCS1 expression in lung tissue of mice with acute lung injury is shown; where A is the protein imprinting map and B is the protein expression level map; compared with the normal group... ## P < 0.01, # P < 0.05; compared with the model group, P < 0.01, P < 0.05; Figure 7 The image shows the effect of Renifolin F on the expression of JAK-STAT pathway-related proteins in the lung tissue of mice with acute lung injury; where A is the protein imprinting map and B is the protein expression level map; compared with the normal group... ## P < 0.01, # P < 0.05; compared with the model group, P < 0.01, P < 0.05. Detailed Implementation

[0035] To enable those skilled in the art to better understand the technical solutions of the present invention, the present invention will be described in detail below with reference to specific embodiments. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions or as recommended by the manufacturer. Unless otherwise specified, the test materials used in the following embodiments were purchased from conventional biochemical reagent stores. Unless otherwise stated, percentages and parts are by weight. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those familiar with the art. Furthermore, any methods and materials similar to or equivalent to those described herein can be applied to the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0036] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0037] The technical solution of the present invention will be further described in detail below with reference to specific embodiments and accompanying drawings. It should be understood that the following embodiments are only used to explain the present invention and are not intended to limit the present invention.

[0038] Materials and reagents: Dexamethasone and LPS were purchased from Sigma-Aldrich (USA); HE staining kit, antigen retrieval solution, 4% paraformaldehyde, environmentally friendly dewaxing and clearing solution, PBS buffer, RNA extraction solution, and chloroform substitute were purchased from Wuhan Saiwei Biotechnology Co., Ltd.; Neutral resin, anhydrous ethanol, xylene, and n-butanol were purchased from Sinopharm Chemical Reagent Co., Ltd.; Mouse IL-6 kit (Catalog No. EK206), Mouse TNF-α kit (Catalog No. EK282), and Mouse IL-1β kit (Catalog No. EK201B) were purchased from Hangzhou Lianke Biotechnology Co., Ltd.; SOCS1, JAK2, P-JAK2, STAT3, and P-STAT3 were purchased from CST Biotechnology (USA).

[0039] Example 1: Preparation of Renifolin F (ephedra flavonoid) Ephedra sinica was collected in Pu'er City, Yunnan Province, People's Republic of China in June 2019. 10.0 kg of dried and pulverized Ephedra sinica was extracted with 70% ethanol at room temperature, and the crude extract was obtained after vacuum concentration. This crude ethanol extract was diluted with water and then extracted with ethyl acetate. The ethyl acetate fraction was purified by MCI gel chromatography and Sephadex LH-20 gel chromatography, eluting sequentially with a gradient of water-methanol (1:0→0:1) and silica gel (CHCl3-MeOH, 20:1→5:1), finally yielding 117 mg of Renifolin F. HPLC analysis showed that the purity of Renifolin F from Ephedra sinica was greater than 99%.

[0040] Example 2: Investigation of the effects of Renifolin F (ephedra flavonoid) on mice with acute lung injury. Experimental data adopted (mean x ± standard deviation) is expressed as mean x ± standard deviation. Data were statistically analyzed using Image J, and SPSS 21.0 was used for data processing. Analysis of variance and t-tests were used for comparisons between groups. Results are expressed as mean x ± standard deviation. # P < 0.05 or ## P < 0.01 indicates a significant difference compared to the normal control group. P < 0.05 or P < 0.01 indicates a significant difference compared to the model control group. GraphPad Prism 9.0 was used for plotting.

[0041] Laboratory animals: C57BL / 6J male mice. Weight 16-18 g, purchased from Spiford (Beijing) Biotechnology Co., Ltd., and housed at the Animal Experiment Center of Yunnan University of Traditional Chinese Medicine; Test drug: Renifolin, the flavonoid from ephedra prepared in Example 1; Positive control drug: Dexamethasone; Preparation of LPS stimulant: Weigh LPS according to the modeling concentration of 10 mg / kg, dissolve it in physiological saline, and prepare it immediately before use; Preparation of DEX solution: Weigh DEX according to the dosage of 5 mg / kg, dissolve it in physiological saline, and store it in the dark at low temperature; Preparation of RF solution: Weigh RF according to the high dose of 10 mg / kg and the low dose of 5 mg / kg, dissolve it in physiological saline, and store it at low temperature.

[0042] Experimental grouping: After SPF-grade C57BL / 6J male mice were acclimatized for one week, they were randomly divided into a normal control group (Control), a model control group (Mod), a dexamethasone group (Dex: 5 mg / kg), a low-dose Renifolin F group (RF-L: 5 mg / kg), and a high-dose Renifolin F group (RF-H: 10 mg / kg), with 6 mice in each group.

[0043] Experimental methods: Mice were pre-administered via gavage for 6 consecutive days at a dose of 0.1 mL / 10 g. The Control and Mod groups were given the corresponding volume of physiological saline according to the mice's body weight, the Dex group was given the corresponding volume of Dex solution, and the RF-L and RF-H groups were given the corresponding concentration and volume of RF solution. On the 7th day, 30 minutes after the end of administration, an acute lung injury mouse model was established by intraperitoneal injection of 10 mg / kg LPS stimulant at a dose of 0.1 mL / 10 g. The normal control group was modeled by intraperitoneal injection of physiological saline instead of LPS stimulant.

[0044] Example 2.1 Effects of Renifolin F on IL-6, TNF-α, and IL-1β levels in BALF and serum of mice with acute lung injury Serum sample collection: Samples were collected from mice 6 hours after modeling. After anesthetizing the mice, blood was collected from the eyeballs and placed in 1.5 mL centrifuge tubes. The samples were left at room temperature for 1-2 hours until the blood samples separated into layers. Then, the samples were centrifuged in a low-temperature centrifuge (centrifugation conditions: 4℃, 3000 rpm, 15 min). The supernatant was aliquoted and stored at -80℃.

[0045] BALF Sample Collection: After blood collection, mice were dislocated by neck, and their limbs and heads were fixed to a rodent board. The neck and chest / abdomen were wiped with alcohol. The neck was first opened, and the peritracheal tissue and muscles were removed to expose a clean trachea for subsequent intubation. The thoracic cavity was then opened to expose the complete trachea and lung tissue. The entire right lung was clamped along the root of the right bronchus with an arterial clamp. Intubation was then performed. After intubation, the left lung was irrigated with 0.3 mL of pre-cooled PBS, aspirated three times, and this procedure was repeated twice. The irrigating fluid from both irrigation cycles was combined into a 1.5 mL EP tube, stored at low temperature, and centrifuged (4℃, 1000 rpm, 5 min). The supernatant was aliquoted and stored at -80℃.

[0046] The levels of IL-6, TNF-α, and IL-1β in serum and BALF were detected using a mouse ELISA kit (see [link to mouse ELISA kit]). Figure 1-2 ).

[0047] like Figure 1 As shown, acute lung injury causes a large amount of inflammatory factors to be secreted. Compared with the normal group, the secretion of inflammatory factors IL-6, TNF-α and IL-1β in BALF of model mice was significantly increased. After intervention with Dex and Renifolin F, compared with the model group, Dex and Renifolin F can significantly reduce the secretion of IL-6, TNF-α and IL-1β in BALF, and the difference is statistically significant.

[0048] Depend on Figure 2 It can be seen that, compared with the normal group, the secretion of inflammatory factors IL-6, TNF-α and IL-1β in the serum of mice in the model group was significantly increased. After intervention with Dex and Renifolin F, compared with the model group, Dex and Renifolin F can significantly reduce the secretion levels of IL-6, TNF-α and IL-1β in the serum, and the difference is statistically significant.

[0049] Example 2.2 Investigating the effect of Renifolin F on the dry-to-wet weight ratio of lungs in mice with acute lung injury Take the right lung of a mouse, wipe off the bloodstains on the surface, measure its wet weight, and then dry it in a 60℃ constant temperature oven for 72 h until constant weight. Measure its dry weight and calculate the W / D value of the lung tissue.

[0050] Depend on Figure 3 It can be seen that the W / D value of mice in the model group was significantly increased compared with the normal group. After intervention with Dex and Renifolin F, the W / D values ​​of Dex and Renifolin F were significantly reduced compared with the model group, and the differences were statistically significant.

[0051] Example 2.3 Investigating the effects of Renifolin F on lung tissue in mice with acute lung injury Mouse lung tissue was collected, washed with physiological saline to remove blood, blotted dry with filter paper, and the middle lobe of the lung was isolated. The tissue was then incubated overnight in 4% paraformaldehyde for 24 hours, embedded in paraffin, and sections approximately 4 μm thick were obtained. The sections were dewaxed to water, stained with hematoxylin and eosin, mounted with neutral resin, and scanned using a scanner. The images were analyzed to observe airway pathological changes (see...). Figure 4 ).

[0052] Depend on Figure 4 Histopathological observation revealed that the lung tissue of the normal group mice was structurally normal, with clear tissue and well-filled alveoli, and no obvious pathological changes were observed. In contrast, the alveolar capillaries of the Mod model group mice were dilated, the lumen was filled with red blood cells, there were a small number of red blood cells in the alveolar cavity, and the alveolar walls were significantly thickened with a large number of inflammatory cell infiltrations. The high- and low-dose Renifolin F groups showed reduced inflammatory cell infiltration in the lung tissue, reduced alveolar protein exudation, and thinner alveolar walls compared to the model group. These results indicate that Renifolin F can alleviate the pathological damage to the lung tissue of mice with LPS-induced acute lung injury.

[0053] Example 2.4 Investigating the effect of Renifolin F on the expression level of microRNA-155 in a small number of lung tissues from acute lung injury. 20 mg of mouse lung tissue was collected and placed in a homogenization tube. 1 mL of RNA extraction buffer was added, and the mixture was homogenized thoroughly using a homogenizer. The homogenized sample was centrifuged at 4°C, 12000 rpm for 10 min. The supernatant was collected, and 250 μL of chloroform substitute was added. The mixture was repeatedly inverted and mixed, then allowed to stand for 3 min. Centrifugation was repeated under the same conditions. The supernatant was collected, and 0.8 times the volume of isopropanol was added to precipitate RNA. The RNA was washed with 75% ethanol by centrifugation, and 15 μL of pure water was added to dissolve the RNA. RNA concentration was then determined. Total RNA was reverse transcribed into cDNA using a miRNA-cDNA first-strand synthesis kit. PCR amplification was performed according to the SYBR Green protocol. Pro Taq The HS premixed qPCR kit was used to perform PCR amplification with the prepared cDNA as a template. The reaction mixture was added according to the instructions, and the PCR reaction was carried out. The reaction conditions were: 95°C pre-denaturation for 30 s; 95°C denaturation for 15 s, 55°C annealing for 30 s, 72°C extension for 30 s, for 40 cycles. The mRNA expression level of the target gene was normalized using ACTB and calculated using the 2-ΔΔCt method. The experimental results are shown below. Figure 6 As shown. Specific primer information is as follows: mmu-MIR-155-5P-RT: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACCCCTAT; mmu-MIR-155-5P-S: ACACTCCAGCTGGGTTAATGCTAATTGTGAT; Universal primer-A: TGGTGTCGTGGAGTCG; U6-S: CTCCGCTTCGGCAGCACA; U6-A:AACGCTTCACGAATTTGCGT Figure 5 As shown, the expression of miR-155 in the lung tissue of LPS-induced acute lung injury mice was significantly upregulated. Compared with the normal group, the expression level of microRNA-155 in the lung tissue of the model group mice was significantly upregulated. After intervention with Dex and Renifolin F, compared with the model group, Dex and Renifolin F could downregulate the expression level of microRNA-155 in the lung tissue, and the difference was significant.

[0054] Example 2.5 Investigating the effect of Renifolin F on the expression of the target protein SOCS1 in the lung tissue of mice with acute lung injury. Mouse lung tissue (30 g / mouse) was placed in a 2.5 mL homogenization tube, along with 200 μL of tissue lysis buffer and steel balls of varying sizes. The tissue was homogenized using a low-temperature homogenizer. The homogenized lung tissue was then placed on ice for 30 min to lyse, followed by centrifugation at 3000 rpm for 10 min. The supernatant was collected as the total protein extract. The protein content of each sample was measured using a BCA kit. Based on the results, the protein content was adjusted to be consistent. The samples were aliquoted, boiled with bromophenol blue to denature the proteins, and stored at -20°C. After SDS-PAGE separation, the proteins were transferred to a 0.45 μm PVDF membrane and blocked with 8% skim milk powder prepared with 1×TBST for 24 hours. After blocking, the PVDF membrane was placed in an incubator containing primary antibody working solution and incubated overnight at 4°C. The membrane was then removed and washed three times with 1×TBST for 5 min each time. Secondary antibody working solution was then added, and the membrane was incubated on a shaker at room temperature for 2 h. Protein bands were detected and captured using an enhanced chemiluminescence (ECL) detection kit, and then exposed for imaging. The protein bands were quantified using ImageJ software.

[0055] Figure 6 As can be seen, miR-155 promotes the inflammatory response by targeting SOCS1. Therefore, inhibiting the production of miR-155 can effectively inhibit its binding to SOCS1 and upregulate SOCS1 expression. Figure 6As shown, compared with the normal group, the expression of SOCS1 protein in the lung tissue of mice in the model group was significantly decreased; compared with the model group, the expression of SOCS1 protein in the lung tissue of mice in the model group increased after RF and Dex treatment.

[0056] Example 2.6 Investigating the effect of Renifolin F on the expression of JAK-STAT pathway-related proteins in lung tissue of mice with acute lung injury. P-JAK2, P-STAT3, JAK2, STAT3, and GAPDH proteins were extracted using the same method as in Example 2.5, quantified, gel-coated, electrophoresed, transferred to a membrane, blocked, incubated with primary antibody, incubated with secondary antibody, and developed. ImageJ software was used to quantify the protein bands.

[0057] Figure 7 As shown, upregulation of SOCS1 negatively regulates the JAK / STAT pathway, effectively antagonizing the occurrence of acute lung injury. Compared with the normal group, the expression of P-JAK2 and P-STAT3 proteins in the lung tissue of model group mice was significantly increased, while JAK2 and STAT3 showed no significant changes. Compared with the model group, after RF and Dex treatment, the expression of P-JAK2 and P-STAT3 proteins in the lung tissue of model group mice decreased to varying degrees, while JAK2 and STAT3 showed no significant changes.

[0058] Finally, it should be noted that the above description is only a preferred embodiment of the present invention. Those skilled in the art, under the guidance of the present invention, can make various similar representations without departing from the spirit and claims of the present invention, and such modifications all fall within the protection scope of the present invention.

Claims

1. The use of Renifolin F or a pharmaceutically acceptable salt thereof in the preparation of a drug for treating acute lung injury; the structural formula of Renifolin F is shown in Formula I: Equation I.

2. The application according to claim 1, characterized in that, The compound shown in Formula I is obtained by extraction and isolation from Ephedra sinica or by artificial synthesis.

3. The application according to claim 1, characterized in that, The drug's mechanism of action involves inhibiting miR-155 expression levels.

4. The application according to claim 1, characterized in that, The acute lung injury refers to infectious acute lung injury and respiratory distress syndrome caused by the deterioration of lung injury. The infectious acute lung injury is selected from: major infectious acute lung injury caused by SARS virus, influenza A virus, avian influenza virus, and lung injury caused by Escherichia coli, Pseudomonas aeruginosa, Streptococcus pneumoniae, Staphylococcus aureus, Klebsiella pneumoniae, and influenza virus infection.

5. The application according to claim 1, characterized in that, The drug uses Renifolin F or a pharmaceutically acceptable salt of it as its active ingredient and is formulated into a pharmaceutically acceptable dosage form with pharmaceutically acceptable excipients.

6. A pharmaceutical composition, characterized in that, It includes an active ingredient and pharmaceutically acceptable excipients; the active ingredient is a compound of Formula I or a pharmaceutically acceptable salt thereof. Equation I.

7. The pharmaceutical composition according to claim 6, characterized in that, It also includes at least one other active component that inhibits miR-155 expression levels.

8. The pharmaceutical composition according to claim 6 or 7 is in the form of an oral dosage form, an injectable dosage form, or a sustained-release dosage form.

9. The pharmaceutical composition according to claim 6 or 7, characterized in that, The compound shown in Formula I is obtained by extraction and isolation from Ephedra sinica or by artificial synthesis.

10. The pharmaceutical composition according to claim 6 or 7, characterized in that, The pharmaceutical composition is used to inhibit miR-155 expression levels.

Images