Medical application of shRNA combinatorial library targeting KDM8

Abstract

The invention belongs to the technical field of gene drugs, and particularly relates to medical application of a shRNA combinatorial library targeting KDM8. The shRNA combinatorial library of the targeted KDM8 participates in the endothelial cell copper death process regulated by ox-LDL by regulating the expression of copper death key proteins FDX1 and DLAT. The expression of KDM8 is specifically inhibited in endothelial cells through the shRNA combinatorial library, and the copper death process can be effectively blocked, so that the oxidative lipoprotein-induced endothelial cell injury is slowed down. The invention provides a new candidate tool and theoretical basis for ox-LDL induced endothelial cell injury.

Description

Technical Field

[0001] This invention belongs to the field of gene drug technology, specifically relating to the pharmaceutical use of a KDM8-targeting shRNA combinatorial library. Background Technology

[0002] Oxidized low-density lipoprotein (ox-LDL)-induced copper death in endothelial cells is a key pathogenic factor driving the development of atherosclerosis (AS). Excessive accumulation of ox-LDL in endothelial cells can significantly induce mitochondrial dysfunction, oxidative damage, and lipid peroxidation, leading to progressive endothelial cell death. This process exacerbates inflammatory damage to the vascular endothelium and pathological remodeling of the vascular wall, potentially triggering organic changes in blood vessels and causing serious cardiovascular events such as coronary heart disease and stroke, severely threatening patients' lives. As a core pathological basis of cardiovascular disease, the high incidence of AS is closely related to the global incidence and mortality of cardiovascular disease, becoming a significant burden on national health. During the evolution of AS, ox-LDL exposure and oxidative stress can induce various forms of programmed cell death in endothelial cells, including copper death, apoptosis, and pyroptosis. Among these, inhibiting endothelial cell copper death is of significant importance in delaying the progression of AS.

[0003] Epigenetics involves the regulation of heritable gene expression independent of DNA sequence alterations. Various factors, including environment, diet, and lifestyle, can influence gene function through epigenetic mechanisms. In asthenospermia (AS), epigenetic regulation primarily involves DNA methylation, histone modifications, and the involvement of non-coding RNA. Histone modifications are catalyzed by specific enzymes, achieved by adding or removing chemical groups (such as methyl groups) from the histone tail. Histone demethylation is an important modification, catalyzed by histone demethylases (HDMs) to remove methyl groups from histones, thereby activating or inhibiting gene expression.

[0004] HDM mainly includes two categories: lysine-specific demethylases (LSD) and demethylases containing the Jumonji domain (JMJD). The development and progression of AS are regulated by multiple factors and dimensions, with genetic and epigenetic factors playing key driving roles. Epigenetic mechanisms can profoundly influence the pathological process of AS by regulating the expression status of key metabolism-related genes. Lysine demethylase 8 (KDM8) is a protein with a JmjC domain, widely distributed in the nucleus and cytoplasm, and catalyzes the demethylation of H3K36me2. H3K36me2 is a multidimensional, highly environment-dependent histone modification that can both promote and inhibit gene expression under certain conditions, exhibiting bidirectional regulatory activity. By mediating H3K36me2 demethylation, KDM8 can both promote and potentially inhibit the expression of downstream genes. Summary of the Invention

[0005] To address the problems existing in the prior art, the present invention provides a pharmaceutical application of a KDM8-targeting shRNA combinatorial library, which can specifically inhibit the expression of the KDM8 gene in vascular endothelial cells through RNA interference technology.

[0006] To achieve the above-mentioned objectives, the present invention adopts the following technical solution:

[0007] In a first aspect, the present invention provides the use of a KDM8-targeting shRNA combinatorial library or a recombinant vector containing the same in the preparation of a medicament for inhibiting copper death in endothelial cells.

[0008] To achieve more thorough and stable downregulation of KDM8 expression with the same transduction efficiency, this invention designs an shRNA combo library consisting of three independent shRNAs targeting different sites of KDM8, the nucleic acid sequence of which is shown in SEQ ID NO.1. This shRNA combo library can act on multiple regions of the target gene mRNA simultaneously, reducing the escape risk caused by single target sequence variation or RNA secondary structure masking, and achieving a synergistic gene silencing effect.

[0009] SEQ ID NO.1:

[0010] 1 CTAGGAATTC GTTACGTGCG GGCTCTGGAT TTTTCAAGAG AAAATCCAGA GCCCGCACGT

[0011] 61 AATTTTTGAA TTGAGGGCCT ATTTCCCATG ATTCCTTCAT ATTTGCATAT ACGATACAAG

[0012] 121GCTGTTAGAGATAATTGG AATTAATTTG ACTGTAAACA CAAAGATATT AGTACAAAAT

[0013] 181 ACGTGACGTA GAAAGTAATA ATTTCTTGGG TAGTTTGCAG TTTTAAAATT ATGTTTTAAA

[0014] 241 ATGGACTATC ATATGCTTAC CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC

[0015] 301 TTGTGGAAAG GACGAAACAC CGGGCATCAG AAAGCCGAAT GTTTTTCAAG AGAAAACATT

[0016] 361 CGGCTTTCTG ATGCTTTTTG AATTGAGGGC CTATTTCCCA TGATTCCTTC ATATTTGCAT

[0017] 421 ATACGATACA AGGCTGTTAG AGAGATAATT GGAATTAATT TGACTGTAAA CACAAAGATA

[0018] 481 TTAGTACAAA ATACGTGACG TAGAAAGTAA TAATTTCTTG GGTAGTTTGC AGTTTTAAAA

[0019] 541 TTATGTTTTA AAATGGACTA TCATATGCTT ACCGTAACTT GAAAGTATTT CGATTTCTTG

[0020] 601 GCTTTATATATCTTGTGGAA AGGACGAAAC ACCGGTCAGC AAATACATCG TGAATGTTCA

[0021] 661 AGAGACATTC ACGATGTATT TGCTGATTTT TGAATTACCG GTCTGC

[0022] In a second aspect, the present invention provides the use of a KDM8-targeting shRNA combinatorial library or a recombinant vector containing the same in the preparation of a medicament for protecting endothelial cells from ox-LDL-induced oxidative damage, the nucleic acid sequence of the shRNA combinatorial library being shown in SEQ ID NO.1.

[0023] A third aspect of the present invention provides the use of a KDM8-targeting shRNA combinatorial library or a recombinant vector containing the same in the preparation of a medicament for the prevention or delay of AS, wherein the nucleic acid sequence of the shRNA combinatorial library is shown in SEQ ID NO.1.

[0024] In some embodiments of the present invention, the recombinant vector is the pLKO.5 plasmid.

[0025] Compared with existing technologies, this invention reveals the key regulatory role of KDM8 in ox-LDL-induced copper death in endothelial cells. Studies have found that upregulation of KDM8 expression promotes the expression of copper death-related proteins FDX1 and DLAT, thereby exacerbating endothelial cell damage. Based on this, this invention uses shRNA interference technology to specifically inhibit KDM8 expression in endothelial cells. In vitro cell experiments confirm that interfering with KDM8 expression can significantly inhibit copper death, potentially alleviating the pathological progression of ankylosing spondylitis (AS) and providing a new intervention strategy and molecular target for the prevention and treatment of AS. Attached Figure Description

[0026] These and / or other aspects and advantages of the present invention will become apparent and readily understood from the following description of preferred embodiments taken in conjunction with the accompanying drawings, in which:

[0027] Figure 1 This is the PCR identification result of shRNA targeting KDM8;

[0028] Figure 2 This is a diagram showing the validation results of KDM8 protein expression in HUVEC cells using a KDM8-targeting shRNA combinatorial library.

[0029] Figure 3 The changes in mRNA expression of key copper death genes FDX1 and DLAT in control and ox-LDL-induced HUVEC cells after expression of the KDM8-targeting shRNA combinatorial library are shown (***, P<0.001).

[0030] Figure 4 The figure shows the results of expression of the KDM8-targeting shRNA combinatorial library and the levels of malondialdehyde (MDA), a lipid peroxidation product, and reactive oxygen species (ROS) in HUVEC cells induced by ox-LDL (**, P<0.01).

[0031] Figure 5 The graph shows the survival rates of HUVEC cells in the control group and ox-LDL induced after expression of the KDM8-targeting shRNA combinatorial library (**, P<0.01). Detailed Implementation

[0032] To facilitate understanding of the present invention, a more complete description will be given below with reference to the accompanying drawings. Some embodiments of the invention are shown in the drawings. However, the invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided so that the disclosure of the invention will be thorough and complete.

[0033] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0034] Example 1

[0035] Two μg of the KDM8 shRNA combinatorial library sequence synthesized from the complete DNA genome was added to 1 μL EcoRI and 1 μL AgeI restriction enzyme (TransGen Biotech), and the volume was adjusted to 40 μL with ddH2O. The mixture was incubated at 37 °C for 4 hours. Two μg of the pLKO.5 plasmid was added to a 10× digestion buffer, along with 1 μL EcoRI and 1 μL AgeI restriction enzyme (TransGen Biotech), and the volume was adjusted to 40 μL with ddH2O. The mixture was incubated at 37 °C for 4 hours to linearize the pLKO.5 plasmid. The digested KDM8 shRNA combinatorial library sequence and the linearized pLKO.5 plasmid were then recovered using a PCR recovery kit.

[0036] Take 2 ng of the KDM8 digested shRNA combinatorial library sequence, add 10 ng of linearized pLKO.5 plasmid, 1×T4 ligase buffer, and 1 μL of T4 ligase (TransGen Biotech). Incubate at 16 °C for 10 hours.

[0037] After the reaction, 2 μL of the reaction product was transformed into 50 μL of DH5α competent cells. The transformed bacteria were plated in LB solid culture dishes containing 100 μg / mL Ampicillin and incubated at 37 ℃ for 16 hours to obtain single colony clones. Single colony clones were picked and added to LB medium tubes containing 100 μg / mL Ampicillin and cultured with shaking for 16 hours. The obtained single colony clones were identified by colony PCR according to the manufacturer's instructions. The results showed that colony PCR successfully identified the pLKO.5 vector (a recombinant KDM8 shRNA library). Figure 1 ).

[0038] Example 2

[0039] Liposome-mediated shRNA transfection and establishment of a stable interference cell model: 2 µg of the mixture and 6 µL of Fugene 6 transfection reagent were added sequentially to 100 µL of opti-MEM medium. After gentle mixing, the mixture was incubated at room temperature for 15 minutes, and then added to adherent cells in 6-well plates at a density of 1×10⁶ cells / well. 6In HUVEC cells, cells were collected 36 hours after transfection, and the protein expression level of KDM8 was detected by Western blot to verify the interference effect.

[0040] Western blot verification of interference efficiency: Transfected HUVEC cells were collected, total protein was extracted, 10 µg protein sample was separated by SDS-PAGE electrophoresis and transferred to PVDF membrane, and immunohybridization and chemiluminescence detection were performed using KDM8 specific antibody and β-actin internal control antibody, respectively.

[0041] The results showed that, compared with the control group, the expression level of KDM8 protein in HUVEC cells transfected with the KDM8 shRNA combo library was significantly decreased, indicating that the constructed shRNA interference system can effectively inhibit the expression of target genes. Figure 2 ).

[0042] Example 3

[0043] HUVEC cells in good growth condition with a confluence of approximately 70%–80% were used for transfection. 2 µg of the KDM8-targeting shRNA plasmid library and 6 µL of Fugene6 transfection reagent were added sequentially to an EP tube containing 100 µL of opti-MEM medium. The mixture was gently aspirated and incubated at room temperature for 15 minutes to form the transfection complex. The original medium in the 6-well plate was replaced with 1.8 mL of fresh complete medium, and the transfection complex was added dropwise. After gently mixing with a cross-shaped shake, the cells were incubated at 37 °C in a 5% CO2 incubator. Cells were collected 36 hours after transfection for subsequent RNA extraction.

[0044] Discard the culture medium from the 6-well plate, add 1 mL of TRIzol lysis buffer to each well, and repeatedly pipette to fully lyse the cells. Transfer the lysis buffer to a 1.5 mL EP tube and incubate at room temperature for 5 minutes. Add 200 µL of chloroform to the EP tube, tighten the cap, and shake vigorously for 15 seconds, then incubate at room temperature for 3 minutes. Centrifuge at 12,000 rpm for 15 minutes at 4 °C. Carefully aspirate the colorless aqueous phase and transfer it to a new RNase-free EP tube. Add an equal volume of isopropanol, mix thoroughly by inverting, and incubate at room temperature for 10 minutes. Centrifuge again at 12,000 rpm for 10 minutes at 4 °C. Discard the supernatant and wash the precipitate with 1 mL of pre-chilled 75% ethanol. Centrifuge at 7,500 rpm for 5 minutes at 4 °C, discard the supernatant, and allow the RNA precipitate to dry at room temperature for 5 minutes. Finally, dissolve the RNA in 30 µL of RNase-free ddH2O and determine the RNA concentration and purity.

[0045] First, add 1 µg of total RNA as a template to an RNase-free PCR tube, then add RNase-free ddH2O to a total volume of 12 µL. Next, add 4 µL of 5× reverse transcription buffer, 2 µL of reverse transcriptase, and 2 µL of Oligo dT primer, for a total volume of 20 µL. Place the PCR tube in a PCR instrument for reverse transcription. The reaction program is set as follows: incubation at 37 °C for 15 minutes, followed by heating at 85 °C for 5 seconds to inactivate the reverse transcriptase.

[0046] Using cDNA obtained from reverse transcription as a template, the mRNA expression levels of key copper death genes FDX1 and DLAT, and the internal reference gene β-actin were detected by RT-qPCR. The qPCR reaction mixture was prepared in a 96-well plate as follows: 10 µL 2×SYBR Green premix, 0.5 µL upstream primer (10 µM), 0.5 µL downstream primer (10 µM), 1 µL cDNA template, and 8 µL RNase-free ddH2O. Each sample was tested in triplicate. The reaction program was: 95 °C pre-denaturation for 30 seconds; 95 °C denaturation for 5 seconds; 60 °C annealing and extension for 30 seconds, for a total of 40 cycles. Finally, β-actin was used as the internal reference gene, and 2... ΔΔCt The method calculated the relative expression levels of the target genes. The results showed that the KDM8 shRNA combinatorial library significantly inhibited the expression of FDX1 and DLAT. Figure 3 ).

[0047] Example 4

[0048] HUVECs in the logarithmic growth phase were seeded into cell culture plates and cultured overnight at 37 °C and 5% CO2 in DMEM high-glucose medium containing 10% fetal bovine serum. After cell attachment, the cells were transfected with either a control empty vector or a KDM8-targeting shRNA plasmid library. Eight hours after transfection, complete medium containing 70 μg / mL ox-LDL was added, and the cells were cultured for another 48 hours.

[0049] After culture, the MDA content and ROS levels in cells were measured using MDA and ROS detection kits, respectively. MDA was detected using the thiobarbituric acid method: cells were collected and lysed, reacted with TBA, and the absorbance at 532 nm was measured. ROS was detected using the DCFH-DA fluorescent probe method: after loading the probes onto cells, they were washed, and the fluorescence intensity was measured using a fluorescence microplate reader at an excitation wavelength of 488 nm and an emission wavelength of 525 nm. The results showed that the KDM8-targeting shRNA plasmid library significantly inhibited ox-LDL-induced MDA and ROS levels in HUVEC cells, suggesting that the KDM8-targeting shRNA plasmid library has the ability to protect endothelial cells from ox-LDL-induced oxidative damage. Figure 4 ).

[0050] Example 5

[0051] To investigate the role of KDM8 in ox-LDL-induced endothelial cell injury and death, control group HUVEC cells and HUVEC cells transduced with the KDM8 shRNA library were seeded in 96-well cell culture plates and cultured overnight as usual. After cell attachment, the cells were treated with complete medium containing 70 μg / mL ox-LDL and cultured for another 48 hours.

[0052] After culture, cell viability was assessed using the CCK-8 assay: 10 μL of CCK-8 solution was added to each well, and the cells were incubated for 4 hours. The absorbance at 450 nm was then measured using a microplate reader. The relative viability of each group was calculated based on the absorbance of the control group, thus evaluating the effect of KDM8 downregulation on ox-LDL-induced endothelial cell damage.

[0053] Compared with the control group, the survival rate of endothelial cells was significantly improved after transduction with the KDM8 shRNA combinatorial library, indicating that the KDM8 shRNA combinatorial library can effectively alleviate ox-LDL-induced endothelial cell damage and death. Figure 5 ).

Claims

1. The use of a KDM8-targeting shRNA combinatorial library or a recombinant vector containing the same in the preparation of a drug for inhibiting copper death in endothelial cells, wherein the nucleic acid sequence of the shRNA combinatorial library is shown in SEQ ID NO.

1.

2. The use of a KDM8-targeting shRNA combinatorial library or a recombinant vector containing the same in the preparation of a medicament for protecting endothelial cells from oxidative damage induced by oxidized low-density lipoprotein, wherein the nucleic acid sequence of the shRNA combinatorial library is shown in SEQ ID NO.

1.

3. The use of a KDM8-targeting shRNA combinatorial library or a recombinant vector containing the same in the preparation of a drug for the prevention or delay of atherosclerosis, wherein the nucleic acid sequence of the shRNA combinatorial library is shown in SEQ ID NO.

1.

4. The application according to any one of claims 1-3, characterized in that, The recombinant vector is the pLKO.5 plasmid.

Images