Method for converting melon from side vine fruiting to main vine fruiting and biological material used by method

Abstract

The invention discloses a method for converting side vine fruiting of muskmelons into main vine fruiting and a biological material used by the method. The protein provided by the invention is named as CmWIP1 protein, and is a protein as shown in SEQ ID NO: 1. The gene (named as CmWIP1 gene) for coding the CmWIP1 protein also belongs to the protection range of the invention. The invention also protects the application of the CmWIP1 protein or the CmWIP1 gene as an inhibition target in plant breeding. The aim of plant breeding is to prepare muskmelon germplasm with pistillate flowers growing to main vines; and preparing muskmelon germplasm from fruit setting to main vine. According to the invention, the gene is knocked out by using a gene editing technology, so that the fruiting habit of the muskmelon can be effectively converted from side vine fruiting to main vine fruiting. A brand new technical path and gene resources are provided for molecular design breeding of muskmelons.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a method for converting melons from lateral vine fruiting to main vine fruiting and the biological materials used therein. Background Technology

[0002] melon( Cucumis melo Melon (L.) is an annual vine-like herbaceous crop belonging to the Cucurbitaceae family, widely cultivated worldwide. my country is the largest producer and consumer of melons, ranking first in the world in both cultivated area and yield, possessing significant industrial value. Melons are hermaphroditic, with separate male and female flowers on the same plant. The fruit develops from the pollination of hermaphroditic flowers. In production, most melon varieties do not produce hermaphroditic flowers on the main vine, primarily bearing fruit on lateral vines. Because lateral vines grow indefinitely, fruiting on them leads to overly dense plant growth, poor ventilation and light penetration, and is unsuitable for high-density planting. Furthermore, pruning and thinning lateral vines is labor-intensive, accounting for more than half of the labor in melon production, undoubtedly increasing production costs. Melon with female flowers on the main vine has the advantages of early maturity, high yield, and intensive cultivation, possessing high research and utilization value. Currently, most research on the fruit-setting position of melons is limited to methods of pruning lateral branches and cultivation studies related to the growth status of lateral branches. Therefore, from both the perspective of melon growth and labor costs, the main vine fruiting type of melon is more advantageous than the traditional lateral vine fruiting type. Developing melon varieties that can bear fruit on the main vine is one of the important goals of modern breeding. However, the key genes controlling the fruit-setting position of melon fruits and their genetic mechanisms are still unclear, which seriously restricts the relevant breeding progress.

[0003] WIP1 (WIP-domain protein 1) is a transcription factor in plants containing a C2H2 zinc finger structure, belonging to the C2H2 subfamily. About WIP1 The role of genes in regulating the fruiting habits of melons has not been reported to date. Summary of the Invention

[0004] The purpose of this invention is to provide a method for converting melons from lateral vine fruiting to main vine fruiting and the biological materials used therein.

[0005] The protein provided by this invention is derived from melon and named CmWIP1 protein, and is as follows (a1) or (a2) or (a3) ​​or (a4):

[0006] (a1) The protein shown in SEQ ID NO: 1; (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1); (a3) Proteins related to the female flower buds and / or fruit set sites of melons obtained by substituting and / or deleting and / or adding one or more amino acid residues of (a1). (a4) is a protein derived from melon and has more than 80% identity with (a1) and is associated with the female flower bud and / or the fruit setting part of melon.

[0007] For example, the tag may be a Poly-Arg tag, a Poly-His tag, a FLAG tag, a Strep-tag II tag, a c-myc tag, etc.

[0008] The gene encoding the CmWIP1 protein (named CmWIP1 Genes are also within the scope of protection of this invention.

[0009] The CmWIP1 The genes are (b1) or (b2) or (b3) or (b4): (b1) A DNA molecule with a coding region as shown in SEQ ID NO: 2; (b2) The DNA molecule shown in SEQ ID NO: 3; (b3) A DNA molecule derived from melon and having more than 80% identity with (b1) or (b2) and encoding the protein thereon; (b4) A DNA molecule that hybridizes to the nucleotide sequence defined in (b1) or (b2) under stringent conditions and encodes the protein.

[0010] The stringent conditions can be described as hybridization at 65°C followed by washing of the membrane in a DNA or RNA hybridization experiment using a solution of 0.1×SSPE (or 0.1×SSC) and 0.1% SDS.

[0011] The CmWIP1 The gene is either (e1) or (e2) or (e3). (e1) A DNA molecule having the segments shown in positions 323-345 of SEQ ID NO: 2 and the segments shown in positions 352-374 of SEQ ID NO: 2; (e2) A DNA molecule having the segments shown in SEQ ID NO: 2, 323-374; (e3) A DNA molecule having the region shown in positions 165-410 of SEQ ID NO: 2.

[0012] This invention also protects CmWIP1 Gene-related biological materials are any of the following (c1) to (c6): (c1) contains CmWIP1 Gene expression cassettes; (c2) contains CmWIP1 Gene recombination vectors; (c3) contains CmWIP1Recombinant cells containing the gene described in claim 2 or 3; (c4) A recombinant vector containing the expression cassette described in (c1); (c5) Recombinant cells containing the expression cassette described in (c1); (c6) Recombinant cells containing the expression vector described in (c2).

[0013] This invention also protects the CmWIP1 protein or CmWIP1 The application of genes is as follows (d1) or (d2): (d1) Application in regulating the position of female flowers in melons; (d2) Application in regulating the fruit setting position of melons.

[0014] The regulation mentioned is negative regulation.

[0015] The regulation of the female flower attachment site in melon refers to the CmWIP1 protein inhibiting the attachment of female flowers to the main vine.

[0016] The regulation of fruit setting in melons refers to the fact that the CmWIP1 protein inhibits fruit setting in melons up to the main vine.

[0017] The regulation of the female flower attachment position in melons refers to: CmWIP1 Genes suppress the growth of female flowers on the main vine of melons.

[0018] The part of the melon that is controlled for fruit setting refers to: CmWIP1 Genes inhibit fruit setting in melons onto the main vine.

[0019] This invention also protects the CmWIP1 protein or CmWIP1 The application of genes as repressive targets in plant breeding; the objectives of the plant breeding are as follows (f1) or (f2): (f1) Preparation of muskmelon germplasm with female flowers growing on the main vine; (f2) Prepare melon germplasm from fruit set to main vine.

[0020] This invention also provides a method for cultivating melons that bear fruit on the main vine (Method I), comprising the following steps: inhibiting the receptor in melons... CmWIP1 Gene expression is used to produce melons that bear fruit on the main vine. The recipient melon possesses the aforementioned... CmWIP1 Gene. The inhibitory receptor in melon CmWIP1 Gene expression can specifically be inhibited by CRISPR / Cas9 receptors in melons. CmWIP1 Gene expression. Inhibition of receptors in melons CmWIP1 Gene expression can be specifically inhibited through introduction. CmWIP1 The material realization of gene expression. Specifically, inhibition. CmWIP1 The substance of gene expression is CmWIP1Gene editing plasmids targeting specific genes. CmWIP1 Gene editing plasmids targeting genes are used for gene editing. CmWIP1 CRISPR / Cas9 plasmids targeting genes. OsCd35 CRISPR / Cas9 plasmids targeting genes express Cas9 protein and OsCd35 sgRNAs that target genes. OsCd35 The sgRNA targeting the gene can be either the sgRNA with a target sequence binding region as shown in positions 404-423 of SEQ ID NO: 5 or the sgRNA with a target sequence binding region as shown in positions 840-859 of SEQ ID NO: 5. For example, the full sequence of the gene editing plasmid is shown in SEQ ID NO: 4 and SEQ ID NO: 5, respectively.

[0021] This invention also provides a method for cultivating melons that bear fruit on the main vine (Method II): knocking out the receptor melon... CmWIP1 The gene, resulting in melons that bear fruit on the main vine. The recipient melon possesses the aforementioned gene. CmWIP1 Gene. The knockout may be the knockout of the entire gene. The knockout may also be the knockout of a portion of the gene.

[0022] This invention also provides a method for cultivating melons that bear fruit on a main vine (Method III): using the genomic DNA of the recipient melon... CmWIP1 Gene editing is performed using the target gene as the gene, and screening is conducted from the gene-edited plants. CmWIP1 The plant with the missing gene is the melon that bears fruit on the main vine. CmWIP1 Gene deletion refers to CmWIP1 Gene deletions do not exist, including but not limited to those in CmWIP1 Insertions and / or deletions and / or substitutions have been made in the gene. CmWIP1 Gene deletion can specifically be CmWIP1 Loss of gene function. CmWIP1 Loss of gene function refers to the loss of the ability to inhibit the growth of female flowers on the main vine of melons. CmWIP1 Loss-of-function gene refers to the loss of the ability to inhibit fruit set in melons and its progression to the main vine. The recipient melon possesses the aforementioned... CmWIP1 Genes. Specifically, the gene editing may be CRISPR / Cas9-based gene editing. Using the recipient melon genomic DNA... CmWIP1 Gene editing can be performed by importing genes that serve as target genes. CmWIP1 Gene editing plasmids targeting specific genes are used for gene editing. CmWIP1 Gene editing plasmids targeting genes are used for gene editing. CmWIP1 CRISPR / Cas9 plasmids targeting genes. OsCd35CRISPR / Cas9 plasmids targeting genes express Cas9 protein and OsCd35 sgRNAs that target genes. OsCd35 The sgRNA targeting the gene can be either the sgRNA with a target sequence binding region as shown in positions 404-423 of SEQ ID NO: 5 or the sgRNA with a target sequence binding region as shown in positions 840-859 of SEQ ID NO: 5. For example, the full sequence of the gene editing plasmid is shown in SEQ ID NO: 4 and SEQ ID NO: 5, respectively.

[0023] This invention also provides a method for cultivating melons that bear fruit on a main vine, comprising the following steps: [The text abruptly ends here, likely due to an incomplete sentence or missing information.] CmWIP1 The segment shown in SEQ ID NO: 6 in the gene is replaced with the segment shown in SEQ ID NO: 7 or SEQ ID NO: 8 to obtain a melon that grows on the main vine. The replacement is homozygous, meaning that the replacement occurs in both homologous chromosomes. The recipient melon possesses the... CmWIP1 Gene.

[0024] This invention also protects melons produced by any of the methods described above that bear fruit on the main vine.

[0025] This invention also protects the application of melons produced by any of the methods described above, specifically (g1) or (g2): (g1) as a male or female parent in the hybridization and breeding of main-vine fruiting melon germplasm; (g2) Application as a genetic tool in studying the molecular mechanism of sex determination in melons.

[0026] This invention prepared CmWIP1 Mutant plants with gene loss of function have genomic DNA CmWIP1 The gene was edited, resulting in the complete or partial loss of its function. Compared with the wild type, the mutant plant has the following phenotype: main stem fruiting: female flowers can differentiate and set fruit normally at multiple consecutive nodes on the main stem, breaking the limitation of the wild type that only bears fruit on lateral stems.

[0027] Compared with the prior art, the present invention has the following significant advantages and beneficial effects: ① It discloses for the first time... CmWIP1 The key role of this gene in regulating the fruiting habits of melons lays the theoretical foundation for its application; ② Knockout through gene editing CmWIP1Genes can improve the fruiting parts of melons, greatly shortening the breeding cycle; ③ Save labor and are suitable for mechanization: The main vine fruiting material obtained does not require tedious topping and pruning operations, greatly reducing labor intensity and production costs, making it very suitable for modern, intensive greenhouse cultivation and mechanized production; ④ Using gene editing technology, mutants can be created accurately and efficiently, and the mutants obtained do not contain exogenous transgenic fragments, which has greater potential and lower regulatory threshold in breeding applications.

[0028] Through in-depth research, the inventors discovered that CmWIP1 Genes are key negative regulators controlling the fruiting location of melons. Knocking out this gene using gene editing technology can effectively change the fruiting habit of melons from "lateral vine fruiting" to "main vine fruiting." This provides a completely new technical approach and genetic resource for molecular design breeding of melons. Attached Figure Description

[0029] Figure 1 For the identification of gene-edited plants.

[0030] Figure 2 This is a comparison of the outcome traits in the early stages of plant development.

[0031] Figure 3 This is a comparison of the fruiting traits at the plant maturity stage. Detailed Implementation

[0032] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0033] Unless otherwise specified, the experimental methods in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the light-dark alternation culture cycle is 16h light / 8h dark. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. Unless otherwise specified, the quantitative experiments in the following examples are all performed in triplicate, and the results are averaged. Huangdanzi melon is the cultivated variety Huangdanzi melon (Xinjiang Jinfeng Seed Industry Co., Ltd.). The melon CmWIP1 protein is shown in SEQ ID NO: 1, and is present in the melon cDNA. CmWIP1 The gene is shown in SEQ ID NO: 2, in the melon genomic DNA. CmWIP1 The gene is shown in SEQ ID NO:3 (the coding frame is located at positions 35-913 in SEQ ID NO:3).

[0034] Implementation examples I. CmWIP1 Construction of gene editing plasmids targeting specific genes by CmWIP1 The gene-editing plasmid targeting the gene is a circular plasmid formed from double-stranded DNA molecules, and its full sequence is shown in SEQ ID NO:4 and SEQ ID NO:5, respectively. In SEQ ID NO:4, positions 9951-14054 constitute the Cas9 gene. In SEQ ID NO:5, positions 404-423 are the target sequence binding region of sgRNA1, and positions 840-859 are the target sequence binding region of sgRNA2.

[0035] II. Preparation of Recombinant Agrobacterium The gene-editing plasmid obtained in step one was introduced into Agrobacterium AGL1 to obtain recombinant Agrobacterium.

[0036] Recombinant Agrobacterium was inoculated into liquid 1 / 2 MS medium and cultured at 28°C with shaking at 200 rpm until OD500 was reached. 600nm A value of 0.4-0.5 indicates a contamination solution.

[0037] III. Preparation of Gene-Edited Plants 1. Take the seeds of Huangdanzi melon, peel off the outer seed coat, then disinfect with 75% alcohol aqueous solution for 30 seconds, then disinfect and sterilize with 5% sodium hypochlorite aqueous solution for 10-15 minutes, then rinse with sterile water, and then place in a dark environment at room temperature overnight.

[0038] 2. After completing step 1, take the seeds, remove the inner seed coat, and then place them on solid MS medium and incubate in the dark at 28°C for one day.

[0039] 3. After completing step 2, take the seed, cut off the tail end of the seed and about 5 mm of the radicle end, and cut the remaining part in the middle to obtain explants (i.e., one seed will eventually yield 4 explants). Immerse the explants in the infection solution prepared in step 2 (using a syringe to perform vacuum treatment 10 times), then place the explants on filter paper to dry, and then place the explants on a co-culture medium and culture at 26°C under light for 3 days.

[0040] Co-culture medium (pH 5.8): containing MS salt 4.4 g / L, sucrose 30 g / L, agar 8 g / L, CuSO4·5H2O 1 mg / L, MES 0.6 g / L, 6-BA (cytokinin) 0.5 mg / L, IAA (auxin) 0.1 mg / L and AS (acetylsyleugenol) 0.2 mM, with the remainder being water.

[0041] 4. After completing step 3, take the explants and transfer them to a selection medium. Culture them at 26°C under alternating light and dark conditions for three weeks. At this time, clustered shoots can be observed growing on the explants.

[0042] Screening medium (pH 5.8): containing MS salt 4.4 g / L, sucrose 30 g / L, agar 8 g / L, CuSO4·5H2O 1 mg / L, MES 0.6 g / L, 6-BA 0.5 mg / L, IAA 0.1 mg / L, Cef (cephalosporin) 250 mg / L, Tim (termethin) 150 mg / L and glufosinate 4 mg / L, with the remainder being water.

[0043] 5. After completing step 4, cut off the clustered shoots and transfer them to a new selection medium. Culture them at 26℃ with alternating light and dark conditions until the height of the clustered shoots reaches 0.5cm-1cm. Subculture once every three weeks.

[0044] 6. After completing step 5, cut off the clustered buds and transfer them to a rooting medium. Culture them at 26°C under alternating light and dark conditions until they root. The rooted plants are the T0 generation regenerated plants.

[0045] Rooting medium (pH 5.8): contains MS salt 4.4 g / L, sucrose 30 g / L, agar 8 g / L and Tim 150 mg / L, with the remainder being water.

[0046] 7. Screen gene-edited plants from T0 generation regenerated plants, i.e. T0 generation gene-edited plants.

[0047] Method for screening gene-edited plants: Leaves are taken, genomic DNA is extracted, and PCR amplification is performed using primer pairs composed of F0 and R0. The PCR amplification products are then recovered and sequenced. If the sequencing result of a test plant differs from the reference sequence, the test plant is a gene-edited plant. Reference sequence (hereinafter the same): Leaves of Huangdanzi melon are taken, genomic DNA is extracted, and PCR amplification is performed using primer pairs composed of F0 and R0. The PCR amplification products are then recovered and sequenced; the sequencing result is the reference sequence.

[0048] F0:5'-TGCTTTGCATTTAGGGCTTCC-3' R0: 5'-GTCTTGAAGCAAAGAGGGCAA-3' 8. Self-pollinate T0 generation gene-edited plants, harvest seeds, and cultivate the seeds into plants, which are the T1 generation plants.

[0049] 9. Select homozygous gene-edited plants from the T1 generation plants, i.e., T1 generation homozygous gene-edited plants.

[0050] Method for screening homozygous gene-edited plants: Take leaves, extract genomic DNA, perform PCR amplification using primer pairs composed of F0 and R0, then recover the PCR amplification products and sequence them; if the sequencing result of a test plant is only one and different from the reference sequence, the test plant is a homozygous gene-edited plant.

[0051] Two homozygous gene-edited plants were obtained and named respectively. cr-cmwip1-1 and cr-cmwip1-2 .

[0052] cr-cmwip1-1 and cr-cmwip1-2 See sequencing results Figure 1 .

[0053] Compared with the reference sequence, cr-cmwip1-1 The only difference in the PCR amplification products was that “GAGTTAATAAGGGTCAATATTGGATTCCAACTCCTACTCAGATTCTCATTGGTCCAACTCAAT” was replaced with “GAGTTAATAAGGGTCAAACTCAAT” (39 nucleotides were missing).

[0054] Compared with the reference sequence, cr-cmwip1-2 The only difference in the PCR amplification products is that “GAGTTAATAAGGGTCAATATTGGATTCCAACTCCTACTCAGATTCTCATTGGTCCAACTCAAT” was replaced with “GAGTTAATAAGGGTCAAACTTGGATTCCATGCCCTCCTTGCATTCTCATTGGTCCAACTCAAT” (a mutation of 9 nucleotides occurred, causing some amino acid mutations).

[0055] IV. Phenotypic Analysis The test site was located at the test base in Shule County, Kashgar City, Xinjiang Uygur Autonomous Region.

[0056] The trial will take place in April 2025.

[0057] Two weeks after germination, the wild-type plants (i.e., Huangdanzi melon plants, denoted by WT) will be selected. cr-cmwip1-1 and cr- cmwip1-2 Transplant the seedlings to a field greenhouse, manage them under the same cultivation conditions, and observe and record their agronomic traits.

[0058] See example photos 50 days after transplanting Figure 2 In the early stages of plant growth: no female flowers were observed forming on the main vine of the wild-type plant; all female flowers were borne on the lateral vines. cr-cmwip1-1 and cr-cmwip1-2Normally developed female flowers and fruits can be formed on the main vine of the plant.

[0059] See exemplary photos 80 days after transplanting Figure 3 During the plant's maturity stage: wild-type plants only bear fruit on lateral vines, and no fruit is produced on the main vine; cr-cmwip1-1 and cr-cmwip1-2 Successful fruit setting on the main vine of the plant represents a fundamental shift from "fruiting on lateral vines" to "fruiting on the main vine."

[0060] The results show that CmWIP1 The loss of gene function relieved the inhibition of "main vine fruiting", leading to the consequence of main vine fruiting.

[0061] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. Proteins, in the following forms: (a1) or (a2) or (a3) ​​or (a4): (a1) The protein shown in SEQ ID NO: 1; (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1); (a3) Proteins related to the female flower buds and / or fruit set sites of melons obtained by substituting and / or deleting and / or adding one or more amino acid residues of (a1). (a4) is a protein derived from melon and has more than 80% identity with (a1) and is associated with the female flower bud and / or the fruit setting part of melon.

2. The gene encoding the protein of claim 1.

3. The gene as described in claim 2, characterized in that: The gene is one of the following (b1) or (b2) or (b3) or (b4): (b1) A DNA molecule with a coding region as shown in SEQ ID NO: 2; (b2) The DNA molecule shown in SEQ ID NO: 3; (b3) A DNA molecule derived from melon and having more than 80% identity with (b1) or (b2) and encoding the protein thereon; (b4) A DNA molecule that hybridizes to the nucleotide sequence defined in (b1) or (b2) under stringent conditions and encodes the protein.

4. Gene-related biological materials, as described in any one of (c1) to (c6) below: (c1) An expression cassette containing the gene of claim 2 or 3; (c2) A recombinant vector containing the gene of claim 2 or 3; (c3) A recombinant cell containing the gene of claim 2 or 3; (c4) A recombinant vector containing the expression cassette described in (c1); (c5) Recombinant cells containing the expression cassette described in (c1); (c6) Recombinant cells containing the expression vector described in (c2).

5. CmWIP1 protein or CmWIP1 The application of genes is as follows (d1) or (d2): (d1) Application in regulating the position of female flowers in melons; (d2) Application in regulating the fruit-setting position of melons; The CmWIP1 protein is the protein described in claim 1; CmWIP1 The gene is the gene described in claim 2 or 3.

6. CmWIP1 protein or CmWIP1 The application of genes as repressive targets in plant breeding; the objectives of the plant breeding are as follows (f1) or (f2): (f1) Preparation of muskmelon germplasm with female flowers growing on the main vine; (f2) Preparation of melon germplasm from fruit set to main vine; The CmWIP1 protein is the protein described in claim 1; CmWIP1 The gene is the gene described in claim 2 or 3.

7. The method for cultivating melons that bear fruit on the main vine is either Method I, Method II, or Method III; Method I includes the following steps: inhibiting receptors in melons CmWIP1 Gene expression results in melons that bear fruit on the main vine; Method II includes the following steps: knocking out the receptor melon CmWIP1 Genes that produce melons on the main vine; Method III includes the following steps: using the genomic DNA of the recipient melon... CmWIP1 Gene editing is performed using the target gene as the gene, and screening is conducted from the gene-edited plants. CmWIP1 A plant with a missing gene is a melon that bears fruit on the main vine. The CmWIP1 The gene is the gene described in claim 2 or 3.

8. A method for cultivating melons that bear fruit on the main vine, comprising the following steps: [The text abruptly shifts to a seemingly unrelated topic about a melon genome and a method for cultivating melons that bear fruit on the main vine.] CmWIP1 The segment shown in SEQ ID NO: 6 in the gene was replaced with the segment shown in SEQ ID NO: 7 or SEQ ID NO: 8 to obtain melons that bear fruit on the main vine; CmWIP1 The gene is the gene described in claim 2 or 3.

9. Melons produced by the method of claim 7 or 8, bearing fruit on the main vine.

10. The application of the melon according to claim 9 is as follows (g1) or (g2): (g1) as a male or female parent in the hybridization and breeding of main-vine fruiting melon germplasm; (g2) Application as a genetic tool in studying the molecular mechanism of sex determination in melons.

Images