Escherichia coli SX-C120 and application thereof in preparation of anti-aging product
Through multi-level system validation of *Ivomyca SX-C120*, a probiotic preparation with multi-target anti-aging function was developed, which solved the problems of single function and limited safety of existing probiotics, and achieved significant anti-aging effect, which can be applied to the preparation of anti-aging drugs.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- GUANGDONG MEDICAL UNIV
- Filing Date
- 2026-02-02
- Publication Date
- 2026-05-19
AI Technical Summary
Existing anti-aging probiotics have limited functions, incomplete verification systems, and traditional probiotic anti-aging dietary supplements have limited safety, making them difficult to use long-term, and lack a systematic chain of evidence.
A strain of *Ivomycosis SX-C120* is provided, which, through multi-level system validation, has multi-target anti-aging functions and can be used to prepare anti-aging drugs in dosage forms including spray gas, solution, semi-solid or solid, gelatin capsules, soft capsules, tablets, lozenges or freeze-dried powder formulations.
Irwinia mirabilis SX-C120 exhibits comprehensive anti-aging effects, including prolonging lifespan, enhancing antioxidant capacity, improving cognitive function, and protecting the intestinal barrier, with good safety profile. It can significantly delay the aging process in nematodes and mice, improve motor function and memory function, and restore the health of intestinal and brain tissue.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of probiotics, specifically relating to a strain of *Ivomyca SX-C120* and its application in the preparation of anti-aging products. Background Technology
[0002] Probiotics are a class of live microorganisms that have clearly beneficial effects on the health of the host. They mainly colonize mucosal tissues such as the human gut and reproductive tract, exerting their core physiological functions by regulating the balance of the host's micro-ecosystem. These microorganisms are diverse, commonly including lactobacilli, bifidobacteria, yeast, and Bacillus subtilis, and are widely found in fermented dairy products and naturally fermented foods. They can also be isolated from the gastrointestinal tract of healthy individuals.
[0003] Numerous studies have confirmed that probiotics possess a wide range of physiological regulatory functions. They can not only regulate the composition of the gut microbiota, inhibit the excessive proliferation of harmful microorganisms, and improve the gut microecological environment, but also effectively enhance host immune function and maintain metabolic homeostasis. Of particular note is the significant potential of probiotics in the field of anti-aging. They can slow down the functional degenerative changes of body tissues and organs and improve age-related physiological phenotypes by inhibiting chronic intestinal inflammation, scavenging excess reactive oxygen species produced by metabolism, and regulating signaling pathways closely related to the aging process. Currently, probiotics are used in the research and development of functional foods and dietary supplements, while also supporting research and application translation in the field of anti-aging.
[0004] Irwinia mirabilis SX-C120 is a functional microbial strain isolated and screened from the intestines of centenarians. It has the advantages of strong antioxidant properties, life extension, and improved learning, memory and cognitive functions, and has good safety.
[0005] Aging is a systemic functional decline that occurs in organisms with increasing age. Its core mechanisms include oxidative stress, chronic inflammation, cellular senescence, and metabolic disorders. Anti-aging aims to delay functional decline and disease by intervening in these biological processes. Antioxidant therapy is one of the important strategies for anti-aging. The accumulation of reactive oxygen species (ROS) damages biological macromolecules, and the application of traditional antioxidants is limited due to limitations in targeting and safety. Probiotics and their metabolites exhibit multi-pathway anti-aging potential: they can not only directly scavenge ROS and enhance the activity of endogenous antioxidant enzymes, but also synergistically achieve multiple effects such as antioxidation, anti-inflammation, and neuroprotection by regulating systemic pathways such as gut microbiota, immune homeostasis, and the gut-brain axis.
[0006] Existing anti-aging probiotics generally suffer from limited functionality and incomplete validation systems, relying heavily on in vitro or single-model data and lacking a systematic chain of evidence encompassing antioxidant effects, lifespan extension, and cognitive enhancement. Furthermore, traditional probiotic anti-aging dietary supplements are difficult to use long-term due to safety limitations. Therefore, developing probiotic strains with multi-functional anti-aging properties and comprehensive, multi-level validation has become a critical technological requirement.
[0007] Therefore, providing a safe anti-aging strain with multi-target anti-aging functions that has been validated through multi-level systems is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention
[0008] To address the aforementioned issues, this invention provides a strain of *Alistipes ihumii* SX-C120, which was deposited at the China Center for Type Culture Collection (CCTCC) on September 12, 2025. The address is CCTCC, Wuhan University, No. 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, China, with accession number CCTCC NO:M 20252020.
[0009] This invention also provides the application of the above-mentioned *Ivomyca SX-C120* in the preparation of anti-aging drugs.
[0010] Furthermore, the drug includes pharmaceutically acceptable adjuvants.
[0011] Furthermore, the dosage form of the drug is a spray gas, solution, semi-solid, or solid.
[0012] Furthermore, the dosage form of the drug is gelatin capsules, soft capsules, lozenges, or freeze-dried powder preparations.
[0013] The present invention has the following beneficial effects:
[0014] As can be seen from the above technical solution, compared with the prior art, this invention discloses a strain of *Ivomyces SX-C120* and its applications. *Ivomyces SX-C120* was isolated from fresh feces of centenarians in Suixi County, Zhanjiang City, Guangdong Province. It possesses comprehensive anti-aging effects, including prolonging lifespan, enhancing antioxidant capacity, improving cognitive function, protecting the intestinal barrier, and regulating the expression of aging-related genes, with good safety profile. This provides a theoretical reference and guiding basis for developing probiotic preparations for prevention or anti-aging using *Ivomyces SX-C120*. Attached Figure Description
[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0016] Figure 1 Transmission electron micrograph of *Ivomyca SX-C120*;
[0017] Figure 2 Results of in vitro tolerance test for *Ivomyca SX-C120*;
[0018] Figure 3 Figure 1 shows the results of in vitro total antioxidant assay, DPPH scavenging assay, and hydroxyl radical scavenging assay for *Ivomyca SX-C120*.
[0019] Figure 4 Figure 1 shows the results of a heat stress experiment on *C. elegans* after treatment with different concentrations of *Ivomys* SX-C120.
[0020] Figure 5 The experimental results show the effect of *Ivomycosis imidae* SX-C120 on the lifespan of *C. elegans*.
[0021] Figure 6 Figure 1. Results of body bending experiment of Caenorhabditis elegans after treatment with Allergy to Irwiniae SX-C120;
[0022] Figure 7 Figure 1. Experimental results of pharyngeal pump rate of Caenorhabditis elegans after treatment with Allergy to Irwiniae SX-C120;
[0023] Figure 8 Figure 1. Experimental results of lipofuscin in *C. elegans* after treatment with *Ivomyca spp.* SX-C120.
[0024] Figure 9 Figure 1. Results of ROS assay for Caenorhabditis elegans after treatment with Allergy to Irwiniae SX-C120.
[0025] Figure 10 Image of the Oil Red O test results of *C. elegans* after treatment with *Ivomyca simulans* SX-C120;
[0026] Figure 11 A bar chart showing the safety assessment of organ indices in experimental mice using *Allobacillus irritans* SX-C120;
[0027] Figure 12 The central resting time and total resting time of mice in an open field experiment after gavage administration of *Allobacterium irhumezii* SX-C120;
[0028] Figure 13 Results of novel object recognition experiments in mice after gavage administration of *Allobacterium irhumae* SX-C120;
[0029] Figure 14 The mean swimming speed, time spent in the target quadrant, and number of platform crossings in mice after gavage administration of *Ivomilum aegyptium* SX-C120 were measured.
[0030] Figure 15 H&E staining image of the intestinal barrier function in mice after gavage administration of Allergy to Ivomilum SX-C120;
[0031] Figure 16 H&E staining image of the effect of Allergy to Ivomilum SX-C120 on the hippocampus of mouse brain tissue after gavage;
[0032] Figure 17 Immunohistochemical images of ZO-1 in mouse colon after gavage administration of *Allergy to Ivomilum SX-C120*;
[0033] Figure 18 Immunohistochemical images of P21 and SYP in the CA1 region of the mouse hippocampus after gavage administration of *Ivomyca esculenta* SX-C120. Detailed Implementation
[0034] Various exemplary embodiments of the present invention are now described in detail. Unless otherwise specified, the methods used in the embodiments are conventional methods, and the reagents used are commercially available reagents or reagents prepared using conventional methods. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and embodiments of the present invention.
[0035] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, regarding numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included within the scope of this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0036] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0037] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This specification and embodiments are merely exemplary.
[0038] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0039] Example 1 Experimental Method:
[0040] 1. Isolation, identification, and preservation of bacterial strains
[0041] (1) Isolation of bacterial strains: Fresh fecal samples from elderly people in Suixi County, Zhanjiang City, Guangdong Province were serially diluted and inoculated into blood agar plates. The plates were anaerobically cultured at 37°C for 48-72 hours. Single colonies were picked from the plates and streaked for three generations to obtain purified bacterial strains. The single colonies obtained from the third generation were inoculated into blood agar plates and anaerobically cultured at 37°C for 12-16 hours. 30% glycerol (containing 0.5% cysteine) was added, and the bacterial solution was mixed with an equal volume of glycerol and stored in a -80°C refrigerator.
[0042] (2) Morphological identification of the strain: Observation was performed by transmission electron microscopy, and the results are as follows: Figure 1 As shown, the strain is a plump, oval rod-shaped organism with a regular outline; under an electron microscope, it appears as a dark, dense structure without flagella, pili, or spores, and belongs to the small bacillus species.
[0043] (3) Molecular biological identification of the strain: The full-length 16S rDNA of the isolated strain was amplified by PCR. The amplification products were electrophoresed using the universal 16S primers 1492R (5'-GGTTACCTTGTTACGACTT-3') and 27F (5'-AGAGTTTGATCCTGGCTCAG-3'). After obtaining the corresponding bands, the amplification products were sequenced, and the sequencing results were compared with the standard bacterial sequences on NCBI using BLAST. The sequence identity with the Alistipes ihumii type strain AP11 was 99.12%. The final identification result was Alistipes ihumii, strain number SX-C120. Its 16S rDNA sequence is shown below.
[0044] GTTTCCCTGCGGCAGCCTACACATGCAAGTCGAGGGGCATCGGATAGAGTACTTCGGTACTCTTGCCGGCGACCGGCGGACGGGTGCGTAACGCGTATGCAACCTACCTTCAACAGGGGGATAATCCGAAGAAATTTGGTCTAATACCCCATAATATTCCGACAGGCATCTGTTGGAGTTGAAAGCTTCGGTGGTTGGAGATGGGCATGCGTTGTATTAGCTAGATGGTGAGGTAACGGCTCACCATGGCGATGATACATAGGGGGACTGAGAGGTTTTCCCCCCACACTGGTACTGAGACACGGACCAGACTCCTACGGGAGGCAGCAGTGAGGAATATTGGTCAATGGACGGAAGTCTGAACCAGCCATGCCGCGTGCAGGATGAATGTGCTATGCATTGTAAACTGCTTTTGTACGAGGGTAAACACAGATACGCGTATCTGCTTGAAAGTATCGTACGAATAAGGATCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCTGTTTTTTAAGTTAGAGGTGAAAGCTCGACGCTCAACGTCGAAATTGCCTCTGATACTGAGAGACTAGAGTGTAGTTGCGGAAGGCGGAATGTGTGGTGTAGCGGTGAAATGCTTAGATATCACACAGAACACCGATTGCGAAGGCAGCTTTCCAAGCTATTACTGACGCTGAGGCACGAAAGCGTGGGGAGCGAACAGGATTAGATACCCTGGTAGTCCACGCAGTAAACGATGATAACTCGTTGCCGGCGATACACAGTCGGTGACTTAGCGAAAGCGTTAAGTTATCCACCTGGGGAGTACGTTCGCAAGAATGAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGAGGAACATGTGGT
[0045] (4) Preservation of strain: This strain has been deposited at the China Center for Type Culture Collection (CCTCC), located at No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province. The deposit date is September 12, 2025. The strain is classified as *Ivomyca spp.* SX-C120 and the accession number is CCTCC NO:M 20252020.
[0046] 2. Preparation of bacterial suspension, culture supernatant, and corresponding lyophilized powder
[0047] OD 600 Irwinia mirabilis SX-C120 bacterial suspension with a pH of 1.0 was inoculated into autoclaved GAM liquid medium at a ratio of 1% and cultured at 37°C for 72 h. After centrifugation at 8000 r / min for 8 min, the supernatant was collected and filtered through a 0.22 µm microporous membrane to obtain the culture supernatant, which was then freeze-dried for 72 h to obtain the culture supernatant lyophilized powder. The bacterial suspension was collected and resuspended in an equal volume of PBS to obtain the bacterial suspension, which was then freeze-dried for 72 h to obtain the bacterial cell lyophilized powder.
[0048] 3. In vitro tolerance test
[0049] After mixing thoroughly by pipetting, aspirate *Ivomyces SX-C120* bacterial suspension and inoculate 1% of the culture into 5 mL of liquid medium with bile salt concentrations of 0.03%, 0.1%, and 0.3%, and liquid medium (containing 10 g / L pepsin) at pH 2 and 3, respectively, as experimental groups. The culture was incubated at 37°C for 48 h. The corresponding uninoculated medium served as a blank control. OD values were measured at 0 h and 48 h. 600 The value is used to calculate the cell survival rate.
[0050] Experimental results: such as Figure 2 As shown, *Ivomyces SX-C120* had a survival rate of 77.77% under extremely acidic conditions at pH 2.0 and a survival rate of 79.81% in an environment with 0.3% bile salts, indicating that it has excellent gastrointestinal adaptability.
[0051] 4. In vitro antioxidant capacity assay
[0052] (1) Total antioxidant capacity experiment—equivalent to Fe 2+ Concentration of antioxidant capacity
[0053] Under acidic conditions, antioxidants can reduce Fe. 3+ -TPTZ produces blue Fe 2+-TPTZ, the total antioxidant capacity of a sample can be calculated by reading the absorbance at 593 nm. *Ivoire disoproxil f. sp.* SX-C120 lyophilized powder and culture supernatant lyophilized powder samples (10 mg / mL) were used for testing. The total antioxidant capacity (T-AOC) assay kit (FRAP method) (Regeneron Biotech, TO1005-100T) was used to determine the total antioxidant capacity of the samples: standards (FeSO4 gradient solution) or samples were added to the FRAP working solution, reacted at 37℃ for 30 min, and the absorbance was measured at 593 nm. A standard curve was established with the Fe²⁺ concentration of the standards as the ordinate and the absorbance value as the abscissa (regression equation: y = 1.5927x + 0.2777). The corresponding Fe²⁺ equivalent concentration was calculated based on the sample absorbance value, and a Fe²⁺ concentration > 1 nM was used as the criterion for good antioxidant capacity.
[0054] (2) DPPH free radical scavenging rate experiment
[0055] The DPPH radical scavenging capacity of *Ailuropoda oryzae* SX-C120 lyophilized powder and culture supernatant lyophilized powder (10 mg / mL) was determined using a DPPH (1,1-Diphenyl-2-picrylhydrazyl) free radical scavenging ability kit (Nanjing Jiancheng Biotechnology, A153-1-1). After mixing the sample with DPPH working solution, the mixture was reacted at 25℃ in the dark for 30 min. The supernatant was then centrifuged, and the absorbance was measured at 517 nm. A system containing the same volume of methanol was used as a control, and a system containing DPPH working solution was used as a blank. The calculation formula was: Scavenging rate (%) = [1 - (A... 测定 - A 对照 ) / A 空白 × 100%. A clearance rate exceeding 50% is considered to indicate good antioxidant capacity.
[0056] (3) Hydroxyl radical scavenging rate experiment
[0057] The hydroxyl radical scavenging capacity of *Ailuropoda oryzae* SX-C120 lyophilized powder and culture supernatant lyophilized powder (10 mg / mL) was determined using a hydroxyl radical detection kit (Nanjing Jiancheng Biotechnology, A018-1-1). The sample, substrate, and colorimetric system were reacted at 37℃ for 1 min, then the reaction was terminated, and the sample was allowed to develop color at room temperature for 20 min. The absorbance was measured at 550 nm. Wells containing standard H2O2 were used as standard controls. The calculation formula was: Scavenging capacity (U / mL) = (A... 对照 - A 测定 ) / (A 标准 - A 空白 )×C 标准 × 1 / V 样× N, a clearance rate of over 50% is considered to indicate good antioxidant capacity.
[0058] Experimental results: such as Figure 3 As shown, the lyophilized powder of *Ivomyces spp.* SX-C120 culture supernatant exhibited superior antioxidant activity compared to the bacterial cell component. The total antioxidant capacity of the *Ivomyces spp.* SX-C120 culture supernatant and bacterial cells reached 1.247 nM Fe²⁺ and 0.291 nM Fe²⁺, respectively; the hydroxyl radical scavenging rates of the *Ivomyces spp.* SX-C120 culture supernatant and bacterial cells were 86.53% and 23.33%, respectively; and the DPPH scavenging rates of the *Ivomyces spp.* SX-C120 culture supernatant and bacterial cells were 85.23% and 82.62%, respectively. These results indicate that the *Ivomyces spp.* SX-C120 culture supernatant possesses good in vitro antioxidant effects.
[0059] 5. Nematode culture and nematode synchronization treatment
[0060] Escherichia coli OP50 was inoculated into LB medium and cultured overnight. The bacterial culture was then concentrated by centrifugation and spread onto NGM plates for later use. Active adult Caenorhabditis elegans were placed on NGM plates containing OP50 bacterial culture and incubated at 20°C. Oviposition-stage adults were collected and treated with alkaline lysis buffer (containing NaOH and sodium hypochlorite) under vortex shaking conditions (<5 min). After centrifugation, the eggs were washed four times with M9 buffer. The lysed eggs were transferred to fresh NGM plates containing OP50 and incubated at 20°C until the L4 stage for subsequent experiments.
[0061] 6. Grouping and treatment in nematode experiments
[0062] The synchronized nematodes were cultured to the L4 stage and then transferred to NGM plates of different treatments for group culture. The SX-C120 supernatant used in the experiment was the culture supernatant collected after centrifugation to remove bacterial cells following 72 hours of culture of the SX-C120 strain in GAM liquid medium, then lyophilized and reconstituted in ultrapure water. 200 μL of E. coli OP50 was added to each group of plates (except the SX-C120 bacterial group) as a basal diet.
[0063] The experimental groups were as follows: The bacterial cell group (SX-C120 cells) was treated with 200 µL of SX-C120 bacterial suspension, while the control group (OP50) received no additional components. The supernatant group (SX-C120 supernatant) received an additional 1 mL of SX-C120 culture supernatant in the plate, while the control group (GAM) received an additional 1 mL of GAM liquid culture medium. Except for the nematode lifespan assay, all other experiments were conducted 5 days after drug administration, with plates changed every 2 days.
[0064] 7. Nematode heat stress experiment
[0065] Different concentrations of SX-C120 bacteria (10) were used to treat the bacteria. 8 CFU / mL, 10 9 CFU / mL, 10 10 Nematodes treated with CFU / mL and SX-C120 supernatant (5 mg / mL, 10 mg / mL, 15 mg / mL) for 5 days were transferred to NGM empty plates and heat-treated in a 35°C incubator for 9 hours. They were then transferred to a 20°C incubator for 12 hours for rewarming. Afterwards, the number of surviving and dead nematodes in each plate was counted, with at least 60 nematodes counted in each group.
[0066] Experimental results: such as Figure 4 As shown, the SX-C120 supernatant at 15 mg / mL showed the best effect, increasing the nematode's resistance to heat stress by 7.83% (P=0.0013), while SX-C120 cells at 10 mg / mL showed the best effect. 9 The optimal concentration of CFU / mL showed the best effect, increasing the heat stress resistance of nematodes by 9.45% (P=0.0006), indicating that *Ivomyca SX-C120* can enhance the heat stress resistance of nematodes.
[0067] 8. Nematode lifespan test
[0068] The synchronized nematodes were cultured to the L4 stage and then transferred to cells supplemented with SX-C120 cells (10). 9 The nematodes were cultured on NGM plates containing CFU / mL and SX-C120 culture supernatant (15 mg / mL) at 20°C. The plates were changed every two days. After ten days, the number of dead nematodes was recorded daily (death was defined as no response to mechanical stimulation) until all nematodes had died. Each group contained no fewer than 100 nematodes, and the difference in mortality rates between the treatment and control groups was statistically analyzed.
[0069] Experimental results: such as Figure 5 As shown, the maximum lifespan of the OP50 control group and the SX-C120 bacterial group was 22 days and 25 days, respectively. Compared with the OP50 control group, the lifespan of nematodes in the SX-C120 bacterial group was prolonged by 13.64% (P < 0.01). The maximum lifespan of the GAM control group and the SX-C120 supernatant group was 25 days and 27 days, respectively. Compared with the GAM control group, the lifespan of nematodes in the SX-C120 supernatant group was prolonged by 8.00% (P < 0.0001). This confirms that *Ivomyca elegans* SX-C120 has a certain ability to prolong the lifespan of nematodes.
[0070] 9. Nematode bending experiment
[0071] Synchronized and treated nematodes were transferred to empty NGM plates and allowed to crawl freely for 1 minute to remove surface attachments. The number of body bends completed within 60 seconds was then recorded, with at least 30 nematodes counted per group. Body bend was defined as a semi-circular trajectory of the nematode's head along the x-axis, with the pharyngeal direction as the y-axis.
[0072] Experimental results: such as Figure 6 As shown, compared with the OP50 control group (29.53 times / min), the SX-C120 bacterial group had an average number of body flexions of 32.00 times / min, an increase of 8.36% (P<0.01); compared with the GAM control group (32.0 times / min), the SX-C120 supernatant group had an average number of body flexions of 39.0 times / min, an increase of 22.91% (P<0.0001), indicating that *Ivomyces spp.* SX-C120 can significantly improve the motility of nematodes.
[0073] 10. Nematode pharyngeal pump rate experiment
[0074] After being synchronized and treated, the nematodes were transferred to NGM plates containing food. After they started feeding normally, the number of pharyngeal pulsations per minute of each group of nematodes was observed and recorded under a stereomicroscope. The difference in pharyngeal pump rate between the two groups was statistically compared. At least 30 nematodes were counted in each group.
[0075] Experimental results: such as Figure 7 As shown, the average number of pharyngeal pumping events in the SX-C120 bacterial group was 92.43 times / min, which was 11.81% higher than that in the OP50 control group (82.67 times / min) (P<0.01). The average number of pharyngeal pumping events in the SX-C120 supernatant group was 94.67 times / min, which was 35.30% higher than that in the GAM control group (69.97 times / min) (P<0.0001). This indicates that the feeding behavior (pharyngeal pumping rate) of nematodes was significantly improved after treatment with *Ivomyces spp.* SX-C120.
[0076] 11. Detection experiment of lipofuscin accumulation in nematodes
[0077] Synchronized and treated nematodes were placed on a glass slide containing 50 μL of 1 mM levamisole (filtered through a 0.22 μm membrane), covered with a coverslip, and fixed in the dark. Fluorescence images of the nematodes were captured using the EVOS cell imaging system, and the lipofuscin accumulation level and distribution characteristics of the nematodes were analyzed using ImageJ software. At least 30 nematodes were counted in each group.
[0078] Experimental results: such as Figure 8As shown, the fluorescence intensity of the SX-C120 bacterial group decreased to 49.40% of the OP50 control group (P<0.0001), and the fluorescence intensity of the SX-C120 supernatant group decreased to 68.51% of the GAM control group (P<0.01), indicating that *Ivomyca SX-C120* can effectively reduce the accumulation of lipofuscin to delay the aging process of nematodes.
[0079] 12. Experiment on the determination of reactive oxygen species (ROS) in nematodes
[0080] After synchronization and treatment, nematodes were washed with M9 buffer, and the washing was repeated at least three times after centrifugation or natural sedimentation until the nematodes were dispersed and clear. The supernatant was discarded, and approximately 100 μL of M9 buffer was retained. 2 μL of dichlorofluorescein (DCF) working solution (final concentration 1 μmol / L) was added, and the mixture was incubated at 20°C and 100 rpm in the dark for 1 hour. After staining, the nematodes were washed three times with M9 buffer, and the supernatant was removed by centrifugation each time to remove residual probes. Finally, the nematodes were transferred to 2% agarose slides, covered with coverslips, and green fluorescence images were captured under a fluorescence microscope. The ROS accumulation level of each group of nematodes was quantitatively analyzed by fluorescence intensity. At least 30 nematodes were counted in each group.
[0081] Experimental results: such as Figure 9 As shown, the fluorescence intensity of the SX-C120 bacterial group decreased to 84.94% of the OP50 control group (P < 0.05), and the fluorescence intensity of the SX-C120 supernatant group decreased to 81.48% of the GAM control group (P < 0.001), indicating that *Ivomyca SX-C120* can delay the aging of nematodes through anti-oxidation.
[0082] 13. Nematode Oil Red O Staining Experiment
[0083] After being synchronized and treated, nematodes were collected, washed with M9 buffer (3000 rpm, 1 min), and then fixed with 4% paraformaldehyde for 10 min. The nematodes were then subjected to four freeze-thaw cycles at -80°C to disrupt their chitin. They were then washed three times with M9 buffer (3000 rpm, 1 min), stained with 60% Oil Red O solution at room temperature for 45 min. Afterward, the nematodes were washed with M9 buffer containing 0.01% Tween to remove excess stain, and then transferred to a 2% agarose gel pad for photographing. At least 30 nematodes were included in each experimental group. The intensity of Oil Red O in the images was quantitatively analyzed using ImageJ software.
[0084] Experimental results: such as Figure 10As shown, the lipid accumulation in the SX-C120 bacterial group was significantly reduced to 81.32% of that in the OP50 control group (P<0.0001), and the lipid accumulation in the SX-C120 supernatant group was reduced to 87.28% of that in the GAM control group (P<0.01). This indicates that *Ivomyca SX-C120* can delay the aging of nematodes by reducing the accumulation of aging substances through lipid reduction.
[0085] 14. Strain Safety Assessment Experiment
[0086] Safety assessment of the strain was performed using 4-week-old ICR mice, with animals acclimatized for 1 week prior to the experiment. Twelve male and twelve female mice were randomly divided into a saline group (control group) and an *Ivoire sinensis* SX-C120 group (experimental group), with six males and six females in each group. The saline group (control group) was administered 0.1 mL / 10 g of saline for three consecutive days, while the experimental group (experimental group) received 0.1 mL / 10 g of *Ivoire sinensis* SX-C120 bacterial suspension (1×10⁻⁶). 9 After gavage administration of CFU / mL, mice were fed normally for 3 weeks, and then samples (heart, liver, spleen, lung, and kidney) were collected to calculate the organ index. Organ index = internal organ weight / mouse body weight.
[0087] Experimental results: such as Figure 11 As shown, there were no statistically significant differences in organ indices between the saline control group and the experimental group in both female and male mice. This indicates that the live *Ivomys SX-C120* bacteria (including bacterial cells and supernatant) did not significantly affect the structure and function of the major organs of mice, nor did it cause significant acute or subacute toxic reactions in mice, demonstrating the safety of this strain.
[0088] 15. Grouping and treatment of aging model mice
[0089] Six-month-old male SAMP8 mice were used as the model mice. Six-month-old male SAMR1 mice were used as the control mice. Animals were acclimatized for one week before the experiment. Animal housing conditions: 5 mice / cage, group housing, laboratory environment temperature 25℃, humidity 55%, with light and dark alternation every 12 hours. Free access to food and water was provided, but food and water were restricted before and after the experiment. Experimental mouse group: SAMP8 mice were administered 200μL of 1×10 [unspecified medication] by gavage daily. 9 CFU of probiotics was administered for 12 weeks. Control mice: Normal SAMR1 mice and premature aging SAMP8 mice were administered 200 μL of physiological saline daily by gavage for 12 weeks. Behavioral experiments began at week 13, and dissections were performed at week 15.
[0090] 16. Mouse open field test
[0091] Each mouse was placed in the center of an empty box, and video tracking was automatically recorded for 5 minutes. Before each trial, the playing area was cleaned with paper towels and 70% ethanol to minimize interference. The total distance walked in the playing area and the number of times the mouse entered the center were recorded.
[0092] Experimental results: such as Figure 12 As shown, compared with the SAMP8 mouse group, the central resting time of the SX-C120 supernatant group and the SX-C120 bacterial group was reduced by 94.87% (P<0.05) and 96.50% (P<0.05), respectively, and the total resting time was reduced by 71.92% (P<0.0001) and 57.30% (P<0.001), respectively. This indicates that *Ivomyces spp.* SX-C120 can effectively improve its depressive-like behavior and exhibit more exploratory behavior.
[0093] 17. Novel Object Recognition Experiment in Mice
[0094] Each mouse was allowed to move freely in an empty box for 5 minutes to develop a habit, and spontaneous activity was recorded. After 24 hours, the mouse was placed alone in the center of the box. Two identical objects (blocks) were placed in the two corners of the box. The time spent exploring each object within 5 minutes was recorded. Exploration was defined as actively touching or facing the object (within 2 cm). After 24 hours of training, memory ability was tested using the same procedure, except that one of the familiar objects was replaced by a completely new one. The recognition index (RI) was determined using the exploration time for each object [for the familiar object (f) and the new object (n) respectively]: RI = Tn / (Tn + Tf)
[0095] Experimental results: such as Figure 13 As shown, compared with the recognition index of the SAMP8 mouse group (0.31), the recognition indices of the SX-C120 supernatant group and the bacterial group were 0.55 (P<0.001) and 0.46 (P<0.05), respectively, which were improved, indicating that the short-term memory ability of the mice was partially restored.
[0096] 18. Mouse water maze test
[0097] Mice were trained twice daily for five consecutive days in a pool containing a hidden platform submerged 1 cm below the water surface. During each training session, the mice were placed in the water facing the pool wall and given 60 seconds to locate the platform. If a mouse failed to find the platform within 60 seconds, it was guided to the platform and allowed to remain there for 15 seconds. On the sixth day, the platform was removed, and the mice were allowed to swim for 60 seconds. All trials were monitored by a camera.
[0098] Experimental results: such as Figure 14As shown, compared with the SAMP8 mouse group, the average swimming speed of the SX-C120 supernatant group and the bacterial cell group increased by 1.90 times (P<0.01) and 93.16% (P=0.2230), respectively; the time spent in the target quadrant increased by 4.85 times (P<0.05) and 4.90 times (P=0.07), respectively; and the number of platform crossings increased by 10.25 times (P<0.05) and 7.75 times (P=0.0544), respectively. This indicates that *Ivoireiae* SX-C120 can restore the motor function and long-term memory of mice.
[0099] 19. Histopathological sections of mouse colon tissue
[0100] After mouse dissection, the colon was immediately fixed with 4% paraformaldehyde, followed by dehydration with a 10%, 20%, and 30% sucrose gradient, and then frozen overnight at -80°C. The tissue sections were thawed in a cryostat for 30 minutes before sectioning to prepare 20 μm thick sections. For H&E staining, the sections were stained with hematoxylin for 10 minutes, followed by incubation with eosin at 25°C for 30 seconds. The histological morphology of the colon was observed using an optical microscope.
[0101] Experimental results: such as Figure 15 As shown, compared with the SAMR1 mouse group, the SAMP8 mouse group showed a decrease in the number of U-shaped crypt goblet cells and damage to their structure in the colon. In the SAMP8 mouse group, gavage with culture supernatant and bacterial cells of *Ivomyces SX-C120* alleviated all of the above symptoms, specifically manifested as an increase in the number of goblet cells in the U-shaped crypt structure in the colon and restoration of the crypt structure. This indicates that gavage with culture supernatant and bacterial cells of *Ivomyces SX-C120* can alleviate the damage to the intestinal barrier in mice.
[0102] 20. Pathological sections of mouse hippocampus tissue
[0103] After mouse dissection, the hippocampus was immediately fixed with 4% paraformaldehyde, followed by dehydration with a 10%, 20%, and 30% gradient of sucrose solution, and then frozen overnight at -80°C. Tissue sections were thawed in a cryostat for 30 minutes before sectioning to prepare 20 μm thick sections. For H&E staining, sections were stained with hematoxylin for 10 minutes, followed by incubation with eosin at 25°C for 30 seconds. The histological morphology of hippocampal neurons was observed using an optical microscope.
[0104] Experimental results: such as Figure 16As shown, compared with the SAMR1 mouse group, the SAMP8 mouse group exhibited neuronal damage in the hippocampus. In the SAMP8 mouse group, gavage administration of culture supernatant and cells of *Ivoire dissecans* SX-C120 alleviated all of the above symptoms. Specifically, many neurons in the hippocampus showed atrophy and reduced deep staining, with clearer cytoplasmic and nuclear boundaries. These phenomena indicate that gavage administration of *Ivoire dissecans* SX-C120 culture supernatant and cells can alleviate the neuronal damage caused by aging in mice.
[0105] 21. Immunohistochemistry of mouse intestinal tissue
[0106] After dissection of mice, colon tissue was taken, and the expression of tight junction protein ZO-1 (Zonula Occludens-1) was observed after paraffin embedding, sectioning, and immunohistochemical staining. ZO-1 is a key protein that constitutes tight junctions of the intestinal epithelium and participates in maintaining the integrity of the intestinal barrier. Its expression level can reflect the strength of the intestinal barrier function.
[0107] Experimental results: such as Figure 17 The results showed that, compared with the SAMP8 mouse group, the culture supernatant and bacterial cells of *Ivomyces SX-C120* could increase the expression of ZO-1 in colon tissue, indicating that *Ivomyces SX-C120* alleviated the damage to the membrane barrier in SAMP8 premature aging mice.
[0108] 22. Immunohistochemistry of mouse hippocampus tissue
[0109] After dissection of mice, tissue from the CA1 region of the hippocampus was collected, paraffin-embedded, sectioned, and immunohistochemically stained to observe the expression of synaptic vesicle membrane proteins (SYP) and P21 (CDKN1A, Cyclin-dependent kinase inhibitor 1A). SYP is a marker of presynaptic terminals, and its expression changes can reflect the density and functional state of hippocampal neuronal synapses; P21 is a cyclin-dependent kinase inhibitor, and its expression changes are associated with neuronal senescence, stress response, or cell cycle reactivation.
[0110] Experimental results: such as Figure 18 As shown, compared with the SAMP8 mouse group, the supernatant group and cell group of *Ivomyces SX-C120* can increase the expression of SYP and decrease the expression of P21 in brain tissue, indicating that *Ivomyces SX-C120* delays the aging of brain tissue cells in SAMP8 premature mice.
[0111] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A strain of Alistipes ihumii SX-C120, characterized in that, This strain was deposited at the China Center for Type Culture Collection (CCTCC), Wuhan University, No. 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, on September 12, 2025. The accession number is CCTCC NO:M 20252020.
2. The use of *Ivomyca SX-C120* as described in claim 1 in the preparation of anti-aging drugs.
3. The application according to claim 2, characterized in that, The drug includes pharmaceutically acceptable adjuvants.
4. The application according to claim 2, characterized in that, The dosage form of the drug is a spray gas, solution, semi-solid or solid.
5. The application according to claim 2, characterized in that, The dosage form of the drug is gelatin capsules, soft capsules, lozenges, or freeze-dried powder preparations.