Application of CmoMAPK3 gene in regulation and control of plant salt tolerance

By overexpressing or knocking out the CmoMAPK3 gene in pumpkin and grafted cucumber, and using root transient transformation technology to regulate its salt tolerance, the gap in MAPK research on plant salt tolerance was filled, and the effects of enhancing or weakening the salt tolerance of pumpkin and grafted cucumber under salt stress were achieved.

CN122060779APending Publication Date: 2026-05-19HUAZHONG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HUAZHONG AGRI UNIV
Filing Date
2026-02-10
Publication Date
2026-05-19

AI Technical Summary

Technical Problem

Current research on the use of MAPK in regulating plant salt tolerance has not yet covered all species, especially in pumpkins and grafted cucumbers, where it remains unclear how to improve their salt tolerance.

Method used

By overexpressing or knocking out the CmoMAPK3 gene in pumpkin and grafted cucumber, gene regulation was carried out in the pumpkin root system using root transient transformation technology to enhance its tolerance to salt stress.

Benefits of technology

Under salt stress, overexpression of the CmoMAPK3 gene can increase the maximum photosynthetic efficiency, antioxidant enzyme activity, ABA and H2O2 content of pumpkin and grafted cucumber, and reduce the relative conductivity and malondialdehyde content, thereby enhancing their salt tolerance; while knocking out the CmoMAPK3 gene reduces their salt tolerance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122060779A_ABST
    Figure CN122060779A_ABST
Patent Text Reader

Abstract

The invention provides an application of a CmoMAPK3 gene in regulation and control of plant salt tolerance, including an application of the CmoMAPK3 gene in regulation and control of pumpkin salt tolerance and an application of the CmoMAPK3 gene in regulation and control of grafted cucumber salt tolerance. Protein kinase CmoMAPK3 interacting with CmoNAC1 is screened through a yeast double-impurity screening library, CmoMAPK3 is overexpressed in a pumpkin root system by utilizing a melon hairy root system, and related physiological indexes such as phenotype analysis, photosynthetic capacity, malondialdehyde content, relative conductivity, ABA and H2O2 content, antioxidant enzyme activity and the like of pumpkins and grafted cucumbers under salt stress are determined. The CmoMAPK3 can improve the tolerance of pumpkins and grafted cucumbers to salt stress, and has important theoretical significance on clarification of a complete signal channel of the salt tolerance of the grafted cucumbers.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to a... CmoMAPK3 Application of genes in regulating plant salt tolerance. Background Technology

[0002] Soil salinization is one of the major abiotic stresses restricting global agricultural production, causing severe damage to plants through osmotic stress, ion toxicity, and oxidative stress. In production, grafting is commonly used as a method for crops to cope with salt stress. Pumpkin has a strong ability to resist abiotic stresses, making it the most widely used rootstock for cucurbits. Studies have reported that using pumpkin as rootstock can reduce oxidative damage and improve the salt tolerance of grafted cucumbers by mediating stomatal closure and antioxidant enzyme system activity in cucumber scion leaves. Abscisic acid (ABA) is one of the earliest studied stress hormones and signaling molecules in plants, playing an important role in plant drought, cold, and salt tolerance. Research has found that after plants are exposed to high salt and other stimuli, large amounts of ABA rapidly accumulate, causing stomatal closure. The signal transduction process of ABA regulating stomatal movement is extremely complex, involving Ca... 2+ H2O2, along with various kinases, phosphatases, phospholipases, and other signaling molecules, are involved. Numerous experiments have shown that H2O2 acts as a second messenger in the ABA signal transduction process regulated by the MAPK cascade pathway.

[0003] Recent studies have further revealed that the MAPK cascade signaling pathway, a highly conserved signaling module in eukaryotes, plays a central role in plant responses to salt stress. In rice, the OsMAPK5-OsWRKY72 pathway negatively regulates grain length and positively regulates resistance to salt and drought stress. While MAPKs play a crucial role in plant salt tolerance, their role in every species has not yet been fully explored; therefore, how MAPKs regulate salt tolerance in other species requires further investigation. Summary of the Invention

[0004] In view of this, the present invention provides a CmoMAPK3 Application of genes in regulating salt tolerance in pumpkins and grafted cucumbers CmoMAPK3 Gene overexpression can increase the maximum photosynthetic efficiency, antioxidant enzyme activity, ABA and H2O2 content of pumpkin and grafted cucumber, reduce the relative conductivity and malondialdehyde content of pumpkin and grafted cucumber, and improve the salt tolerance of pumpkin and grafted cucumber. To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a CmoMAPK3 Application of genes in regulating salt tolerance in pumpkins.

[0005] Preferably, when CmoMAPK3 When the gene is overexpressed, the salt tolerance of pumpkin increases.

[0006] Preferably, when CmoMAPK3 When the gene is knocked out, the pumpkin's salt tolerance decreases.

[0007] Secondly, the present invention provides CmoMAPK3 Application of genes in regulating salt tolerance in grafted cucumbers.

[0008] Preferably, when CmoMAPK3 When the gene is overexpressed, the salt tolerance of grafted cucumbers increases.

[0009] Preferably, when CmoMAPK3 When the gene is knocked out, the salt tolerance of grafted cucumbers is reduced.

[0010] Preferably, pumpkin is used as the rootstock for grafting cucumbers.

[0011] Thirdly, the present invention provides the aforementioned CmoMAPK3 The application of genes in regulating salt tolerance in pumpkins, or as described above CmoMAPK3 Application of genes in regulating salt tolerance in grafted cucumbers CmoMAPK3 The nucleotide sequence of the gene is shown in SEQ ID NO:1.

[0012] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) CmoMAPK3 plays a role in the early stage of salt stress This invention performed a yeast two-hybrid screening experiment on CmoNAC1. The CmoMAPK3 gene (gene number: CmoCh01G005840) was annotated as a MAPK protein kinase in the screening results. Specific primer pairs were designed... CmoMAPK3 Real-time quantitative PCR (RT-qPCR) analysis revealed... CmoMAPK3 The expression peaked after 3 hours of salt treatment, and gradually decreased with increasing treatment time, indicating that... CmoMAPK3 It plays a role in the early stages of salt stress.

[0013] (2) Overexpression CmoMAPK3 Enhancing the salt tolerance of pumpkin Based on the above findings, root transient transformation technology was used to overexpress and knock out the expression of pumpkin roots, respectively. CmoMAPK3 Phenotypic analysis and physiological index determination were performed on pumpkin after 100 mM NaCl treatment for 10 days. Results showed that, under salt stress, the root system overexpressed [a specific gene]. CmoMAPK3 Pumpkin seedlings (OEMAPK3) exhibit better growth maintenance, lower levels of leaf yellowing, less damage, and root knockout. CmoMAPK3 The pumpkin seedlings showed the opposite behavior, indicating overexpression. CmoMAPK3 Enhance the salt tolerance of pumpkins.

[0014] (3) Overexpression CmoMAPK3 Enhance the salt tolerance of grafted cucumbers Phenotypic analysis and physiological index determination were performed on grafted cucumbers after 10 days of treatment with 100 mM NaCl. Results showed that, under salt stress, the root system overexpressed [a specific gene] compared to the control group (EV). CmoMAPK3 Grafted cucumbers (OEMAPK3) maintain growth better, exhibit lower levels of leaf yellowing, suffer less damage, and have their roots knocked out. CmoMAPK3 The grafted cucumbers showed the opposite behavior, indicating overexpression. CmoMAPK3 Enhance the salt tolerance of grafted cucumbers. Attached Figure Description

[0015] Figure 1 The present invention provided in Embodiment 1 CmoMAPK3 Gene transcription level analysis diagram; Figure 2 The root overexpression provided in Example 3 of this invention CmoMAPK3 Phenotypic diagram of salt stress in pumpkin materials; Figure 3 The root overexpression provided in Example 3 of this invention CmoMAPK3 Graph showing the determination of physiological indicators of pumpkin under salt stress; Figure 4 The root knockout provided in Embodiment 3 of the present invention CmoMAPK3 Phenotypic diagram of salt stress in pumpkin materials; Figure 5 The root knockout provided in Embodiment 3 of the present invention CmoMAPK3 Graph showing the determination of physiological indicators of pumpkin under salt stress; Figure 6 Provided for Example 4 of the present invention CmoMAPK3 Phenotypic diagrams of salt stress in genetically modified and edited grafted cucumbers; Figure 7 Provided for Example 4 of the present invention CmoMAPK3 Graphs showing the determination of physiological indicators of salt stress in genetically modified and edited grafted cucumbers. Detailed Implementation

[0016] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can more clearly understand the present invention.

[0017] Example 1 CmoMAPK3 Gene transcription level analysis 1.1 Plant materials The test material was the pumpkin variety "Fengle Jinjia," which exhibits good salt stress tolerance. Seeds were soaked in 55℃ hot water for 4 hours, then rinsed, drained, wrapped in gauze to retain moisture, and placed in a 30℃ germination chamber in the dark for germination. Once the seeds showed white sprouts, they were sown in 50-cell trays and cultured in an artificial climate chamber under the following conditions: average daytime temperature 28℃, light intensity 14000 lx, average nighttime temperature 18℃, and a photoperiod of 12 hours light / 12 hours dark. When the seedlings reached the two-leaf-one-heart stage, uniformly growing seedlings were selected and transplanted into a nutrient solution culture system for further cultivation.

[0018] The nutrient solution cultivation system was as follows: Blue hydroponic plastic pots were used as cultivation containers, each containing 5L of Hoagland nutrient solution; the pots were covered with appropriately sized polystyrene foam boards (2.5cm thick) to prevent nutrient solution evaporation; holes (2cm diameter) were evenly drilled in the foam boards, 9 holes per board, to support the plants; the nutrient solution was intermittently and evenly aerated using an air pump. The nutrient solution was changed every 5 days. When the plants reached the three-leaf stage, healthy seedlings with consistent growth were selected for salt stress treatment (adding 100mM NaCl), with a control group using nutrient solution without NaCl. Root samples from pumpkin seedlings were taken at 0h, 3h, 9h, and 24h after salt treatment, flash-frozen in liquid nitrogen, and stored at -80℃.

[0019] 1.2 RT-qPCR analysis RNA was extracted from pumpkins subjected to salt stress at -80℃ for different treatment times and from different tissues. After grinding in liquid nitrogen, 0.1g of the sample was used for RNA extraction. Total RNA was extracted using Trizol® reagent (Trans, China), following the instructions. Reverse transcription of RNA was performed using the HiScript II 1st Strand cDNA Synthesis Kit (+gDNAwiper) (Vazyme Cat#R212) according to the user manual to obtain cDNA templates. All obtained cDNA samples from different treatments were uniformly diluted to 250-300 ng / μL. The following primers were designed for quantitative analysis: ACTIN-F: CTGGACTCTGGTGATGTGT ACTIN-R:CGTTCAGCAGTGGTTGTGAA qCmoMAPK3-F:TCTTGCTCGTCCAACTTCGG qCmoMAPK3-R:GATGCACATGATCCCTGCCT Following the reagent instructions, the RT-qPCR system was prepared using ChamQ Universal SYBR qPCR Master Mix (Vazyme Cat#Q711), and expression level data were obtained using a QuantStudio6 flex and Thermo assay. The results are summarized as follows. Figure 1 As shown in the line graph, after 3 hours of salt treatment, CmoMAPK3 The expression level reached its peak, and then gradually decreased with increasing salt treatment time, indicating that... CmoMAPK3 It functions in the early stages of salt stress. Each value is the mean ± SD (n=3). Relative Expression of CmoMAPK3 in root means CmoMAPK3 Relative expression levels in pumpkin roots; Hours after salt treatment indicates the duration of salt treatment.

[0020] Example 2 Pumpkin CmoMAPK3 CAS9 gene editing and overexpression vector construction and transformation 2.1 Pumpkin CmoMAPK3 Construction of the CAS9 gene editing vector Design and synthesize according to the sgRNA design principles. CmoMAPK3 The sgRNA sequence of the gene is as follows: SgCmoMAPK3-F: CGAACTACAAACAAACCAAATCCAAC SgCmoMAPK3-R:CACAAACGGAAGAAATCAAAATCGC Prepare the following mixture in a 200 μL PCR tube: (sgCmoMAPK3F / R: 15 μL, rCutsmart: 5 μL, ddH2O: 15 μL). Place the tube in a 1L boiling water container and allow it to cool naturally to room temperature to complete primer annealing. Then, establish the following enzyme digestion and ligation simultaneous system: (primer annealing product: 5 μL, pBSE403R: 200 ng, rCutsmart: 1.5 μL, 10xBSA: 1.5 μL, BsaI-HF(NEB): 1 μL, T4 ligase(NEB) 1 μL, T4 ligase buffer: 2 μL, ddH2O: 20 μL). In a PCR instrument, react as follows: (37℃-3 min, 16℃-4 min, 50 cycles, 50℃-5 min, 80℃-3 min). CmoMAPK3 The sgRNA was constructed into the pBSE403R linearized vector.

[0021] 2.2 Pumpkin CmoMAPK3 Construction of gene overexpression vectors Use the following primer sequence: OE CmoMAPK3 -F:CTCGAGTAATCTAGAATGGCTGATGTTGGTCAGAACA OE CmoMAPK3 -R:GAAAGCTCTGAGCTCTCATGCAAATTCTGGATTGAGTGC The coding sequence of CmoMAPK3 was amplified according to the instructions of 2 × Phanta Flash Master Mix (Dye Plus) (Vazyme Cat# P520). The PCR product was assembled into the pBSE403R XbaI / SacI linearized vector using the ClonExpress II One Step Cloning Kit (Vazyme Cat# C112).

[0022] 2.3 Transformation Following the DH5α (Vazyme Cat# C502) instructions, the product from step 2.2 was transformed into *E. coli*, and positive clones were picked from LB agar medium containing kana resistance. These clones were then sent to a sequencing company for next-generation Sanger sequencing to retrieve the correct sequence plasmid. Following the instructions, *Agrobacterium* K599 competent cells (WeiDi, CAT#: AC1080) were used to transform the correct sequence plasmid into *Agrobacterium*. Positive clones were then selected from LB agar medium containing kana and strep resistance.

[0023] 2.3.1 Infection from root sprouts of pumpkin Pumpkins were cultured in the environment described in Example 1.1 until the cotyledons fully expanded. PCR tests were then performed to detect overexpression and knockout of successfully transformed K599 agroscissors. CmoMAPK3 100 μL of the positive bacterial suspension was added to 50 mL of LB liquid medium containing 50 mg / L Strep and 50 mg / L Kana, and cultured at 28 °C and 200 rpm for 14–18 h on a shaker. The culture was then centrifuged at 6000 rpm for 8 min, and resuspended in MS liquid medium containing 200 mM AS and 0.1% sucrose to OD0.05. 600=0.8-1.0. Next, 1 mL of the resuspended bacterial solution was added to a 1.5 mL centrifuge tube for infection. Then, an explant was formed by oblique cutting about 2 cm below the pumpkin cotyledon, and the cut end was immersed in the bacterial solution in the 1.5 mL centrifuge tube. It was then kept in the dark and moist for 1 hour to complete the infection. Subsequently, the infected cut end of the pumpkin explant was inserted into a 500 mL culture box containing sterilized vermiculite moistened with MS liquid medium and cultured in the dark at 23°C for 4 days (co-culture). After the co-culture, the hypocotyl cut end of the explant was inserted into a 50-well seedling tray containing sterilized substrate (vermiculite: perlite = 3:1) moistened with 1 / 2 Hoagland's nutrient solution, covered to maintain moisture, and managed. Non-fluorescent roots were removed every week. For seedlings with fluorescent roots longer than 2 cm, they were transferred to 1 / 2 Hoagland's nutrient solution for hydroponics. During this period, non-fluorescent roots were removed weekly. Successful overexpression and knockout of fully fluorescent roots were obtained in about 2-3 weeks. CmoMAPK3 Material.

[0024] 2.3.2 Root infection of grafted cucumbers Pumpkin and cucumber were cultured in the environment described in Example 1.1 (5 days in advance) until the pumpkin cotyledons fully expanded. Following the same method as the pumpkin self-rooted seedling infection, after co-culture, cucumber was grafted onto the pumpkin explants using the top grafting method. The hypocotyl cut of the explant was inserted into a 50-well seedling tray containing a sterilized substrate (vermiculite:perlite = 3:1) moistened with 1 / 2 Hoagland's nutrient solution. The tray was covered to maintain moisture, and grafting management was carried out. After successful grafting, non-fluorescent roots were removed once. Non-fluorescent roots were removed every week. For seedlings with fluorescent roots longer than 2 cm, they were transferred to 1 / 2 Hoagland's nutrient solution for hydroponics, with non-fluorescent roots removed weekly during this period. Overexpression and knockout of fully fluorescent roots were obtained in approximately 2-3 weeks. CmoMAPK3 Material.

[0025] Example 3 CmoMAPK3 Salt stress evaluation of genetically modified pumpkin materials 3.1 Root overexpression CmoMAPK3 Pumpkin material salt stress phenotype When the pumpkin had grown to four leaves and one bud, it was treated with 100mM NaCl, and samples were taken 10 days later. The results are as follows: Figure 2 As shown, under salt stress, compared to the control group (EV), the root system overexpressed [the substance]. CmoMAPK3 Pumpkin seedlings (OEMAPK3) can maintain growth better, with lower levels of leaf yellowing and less damage.

[0026] 3.2 Root overexpression CmoMAPK3 Determination of physiological indicators of salt stress in pumpkin materials Overexpression after 100 mM salt treatment for 10 days CmoMAPK3Samples were taken from transgenic pumpkin materials, and leaf photosynthetic performance (maximum photosynthetic efficiency Fv / Fm), malondialdehyde (MDA) content, relative conductivity (REC), ABA content, H2O2 content, and antioxidant enzyme (POD and CAT) activities were measured. The results are as follows: Figure 3 The results showed that, compared to the control group (EV), overexpression CmoMAPK3 This treatment significantly improved the maximum photosynthetic efficiency, ABA and H2O2 content, and antioxidant enzyme activity of pumpkin seedlings, while reducing relative conductivity (REC) and malondialdehyde (MDA) content, thereby enhancing the pumpkin's tolerance to salt stress. In the bar chart, ABAcontent represents ABA content; H2O2content represents hydrogen peroxide content; Leaf MDA content represents leaf MDA content; Root MDA content represents root MDA content; Root REC represents root relative conductivity; Leaf REC represents leaf relative conductivity; POD activity of root represents root peroxidase activity; POD activity of leaf represents leaf peroxidase activity; and CAT activity in root represents root catalase activity. Each value is the mean ± SD (n=3), and different lowercase letters indicate significant differences between treatments (P<0.05). This indicates that p < 0.05. This indicates that p < 0.01. This indicates that p < 0.001.

[0027] 3.3 Root removal CmoMAPK3 Pumpkin material salt stress phenotype When the pumpkin had grown to four leaves and one bud, it was treated with 100mM NaCl, and samples were taken 10 days later. The results are as follows: Figure 4 As shown, root knockout under salt stress compared to the control group (EV) CmoMAPK3 Pumpkin seedlings (KOMAPK3) showed severe chlorosis and significant damage to their leaves, which is related to overexpression. CmoMAPK3 The materials exhibit the opposite characteristics.

[0028] 3.4 Root removal CmoMAPK3 Determination of physiological indicators of salt stress in pumpkin materials Knockout after 100mM salt treatment for 10 days CmoMAPK3Samples were taken from transgenic pumpkin materials, and leaf photosynthetic performance (maximum photosynthetic efficiency Fv / Fm), malondialdehyde (MDA) content, relative conductivity (REC), ABA content, H2O2 content, and antioxidant enzyme (POD and CAT) activities were measured. The results are as follows: Figure 5 As shown, compared to the control group (EV), knockout CmoMAPK3 The knockout significantly reduced the maximum photosynthetic efficiency, ABA and H2O2 content, and antioxidant enzyme activity of pumpkin rooted seedlings, while increasing relative conductivity (REC) and malondialdehyde (MDA) content, thereby reducing the pumpkin's tolerance to salt stress. This indicates that knocking out... CmoMAPK3 Pumpkin materials and overexpression CmoMAPK3 The results of the physiological index measurements of the pumpkin materials were completely opposite.

[0029] Example 4 CmoMAPK3 Evaluation of salt stress in genetically modified and edited grafted cucumbers 4.1 CmoMAPK3 Salt stress phenotype in genetically modified and edited grafted cucumbers When the grafted seedlings reached the stage of four leaves and one bud, they were treated with 100mM NaCl, and samples were taken 7 days later. The results are as follows: Figure 6 As shown, under salt stress, compared to the control group (EV), the root system overexpressed [the substance]. CmoMAPK3 The grafted seedlings (OEMAPK3) showed better growth and lower levels of leaf yellowing, while the root-knockout seedlings... CmoMAPK3 The grafted seedlings, on the other hand, showed the opposite behavior.

[0030] 4.2 CmoMAPK3 Determination of physiological indicators of salt stress in genetically modified and edited grafted cucumbers Samples were taken from OEMAPK3 and KOMAPK3 transgenic grafted cucumbers treated with 100 mM salt for 7 days. Leaf photosynthetic performance (maximum photosynthetic efficiency Fv / Fm), malondialdehyde (MDA) content, relative conductivity (REC), ABA content, H2O2 content, and antioxidant enzyme (SOD and CAT) activities were measured. The results are as follows: Figure 7 As shown, compared to the control group (EV), overexpression CmoMAPK3 It significantly improved the maximum photosynthetic efficiency, ABA and H2O2 content, and antioxidant enzyme activity of grafted cucumbers under salt stress, while reducing relative conductivity (REC) and malondialdehyde (MDA) content, thereby improving the tolerance of grafted cucumbers to salt stress; while knocking out CmoMAPK3The materials are the opposite. In the bar chart, SOD activity in root represents root superoxide dismutase activity; SOD activity in leaf represents leaf superoxide dismutase activity. Each value is the mean ± SD (n=3), and different lowercase letters indicate significant differences between different treatments (P<0.05). This indicates that p < 0.05. This indicates that p < 0.01. This indicates that p < 0.001.

[0031] gene sequence SEQ ID NO:1:

[0032] Unless otherwise specified, all raw materials used in this invention are existing substances that can be purchased directly from the market.

[0033] The above are merely preferred embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A kind CmoMAPK3 Application of genes in regulating salt tolerance in pumpkins.

2. The application according to claim 1, characterized in that, when CmoMAPK3 When the gene is overexpressed, the salt tolerance of pumpkin increases.

3. The application according to claim 1, characterized in that, when CmoMAPK3 When the gene is knocked out, the pumpkin's salt tolerance decreases.

4. A kind CmoMAPK3 Application of genes in regulating salt tolerance in grafted cucumbers.

5. The application according to claim 4, characterized in that, when CmoMAPK3 When the gene is overexpressed, the salt tolerance of grafted cucumbers increases.

6. The application according to claim 4, characterized in that, when CmoMAPK3 When the gene is knocked out, the salt tolerance of grafted cucumbers is reduced.

7. The application according to claim 4, characterized in that, Pumpkin is used as rootstock for grafting cucumbers.

8. The claim 1-3 CmoMAPK3 The application of genes in regulating salt tolerance in pumpkins, or as described in any one of claims 4-7. CmoMAPK3 The application of genes in regulating salt tolerance in grafted cucumbers is characterized by, CmoMAPK3 The nucleotide sequence of the gene is shown in SEQ ID NO:1.