RUBY reporter gene mediated sapium sebiferum visual genetic transformation method

Abstract

The invention discloses an RUBY reporter gene mediated sapium sebiferum visual genetic transformation method, and belongs to the technical field of plant biology. According to the method, hypocotyls, stems and cotyledons of sapium sebiferum mature embryo aseptic seedlings germinating for 2-4 weeks are taken as explants, and agrobacterium rhizogenes K599 strains carrying RUBY reporter genes are adopted for dip dyeing. By optimizing the concentration of the bacterial liquid, the dip dyeing time, the co-culture condition and the concentration of IBA, an efficient visual induction system for the hairy roots of Chinese tallow trees is established. The method has the remarkable advantages that the hypocotyl positive hairy root induction rate reaches up to 80.9%, and the comprehensive positive induction rate of different explants reaches 68.3%; the average appearance time of hairy roots is only 15 days, so that the experimental period is greatly shortened; on the basis of the RUBY reporter gene mediated betacyanin red phenotype, expensive equipment and destructive detection are not needed, lossless, real-time and high-throughput screening of transformants is achieved, multiple explants and a mixed transformation strategy are adapted, and the material utilization rate and the technical flexibility are high.

Description

Technical Field

[0001] This invention belongs to the field of plant biotechnology, specifically relating to a visual genetic transformation method for Chinese tallow tree mediated by the RUBY reporter gene. Background Technology

[0002] Chinese tallow tree ( Sapium sebiferum *Sapium sebiferum* (Roxb.) is a perennial woody, multifunctional native tree species belonging to the genus *Sapium* in the family Euphorbiaceae. It combines oil, medicinal, and landscaping value, making it an important oil crop and ecological restoration tree species in my country. Its waxy outer layer of seeds can be used to produce industrial products such as soap and candles; the kernels contain high levels of oil, making them a high-quality raw material for biodiesel production; the leaves are rich in flavonoids, terpenes, and other secondary metabolites, possessing anti-inflammatory and antioxidant medicinal activities. Furthermore, *Sapium sebiferum* has a beautiful tree shape, elegant foliage, and displays a variety of colors in autumn, including red, orange, yellow, brown, purple, and green. It is also highly adaptable, able to grow in barren, saline-alkali, and other marginal lands, making it a multifunctional tree species with both ecological restoration and ornamental value, and promising broad market application prospects. However, genetic improvement and functional genomics research on *Sapium sebiferum* are severely lagging behind, with the core bottleneck being the lack of a stable and efficient genetic transformation system. Currently used reporter genes in plant genetic transformation, such as GUS, require chemical substrate staining, and the detection process is destructive; GFP requires observation with a fluorescence microscope, which is cumbersome and costly, making it difficult to achieve rapid screening of a large number of transformants. Both methods suffer from complex operation, low screening efficiency, and high cost, severely restricting the large-scale application of genetic transformation of *Sapium sebiferum*. Furthermore, as a woody plant, *Sapium sebiferum* explants are prone to browning during Agrobacterium infection and co-culture, hindering T-DNA transfer and integration, and severely affecting transformation efficiency.

[0003] Agrobacterium rhizogenes-mediated hairy root transformation systems have been widely used in gene function research due to their advantages such as ease of operation, short cycle, and strong genetic stability. However, different strains show significant differences in their infection specificity on plants. Agrobacterium rhizogenes K599, as a cucumber alkaloid strain, exhibits unique advantages in the transformation of woody plants, with a significantly higher infection efficiency than other strains. However, its application in the genetic transformation of Sapium sebiferum has not yet been reported.

[0004] In recent years, the RUBY reporter system, derived from the betaine synthesis pathway, has gradually become an ideal tool for plant genetic transformation. The core advantage of this system lies in its expression product, red betaine, which can be directly observed with the naked eye under natural light, requiring no special equipment, chemical substrates, or staining steps. Furthermore, it is non-toxic to plant cells, enabling non-destructive, rapid, and intuitive screening of transformants. Currently, the RUBY reporter system has been successfully applied in various plants such as Arabidopsis thaliana, rice, and tomato. However, its application in Chinese tallow tree (Sapium sebiferum) has not yet been reported, and technical solutions combining this system to address the severe browning and cumbersome screening issues in Chinese tallow tree transformation remain undeveloped. Summary of the Invention

[0005] The technical problem to be solved by this invention is to provide a method for establishing a visual genetic transformation system of Sapium sebiferum mediated by the RUBY reporter gene, which improves transformation efficiency and simplifies the screening process by visualizing the reporter gene and optimizing the infection and co-culture conditions.

[0006] The present invention solves the above-mentioned technical problems through the following technical means:

[0007] This invention provides a method for visualizing genetic transformation of Sapium sebiferum mediated by the RUBY reporter gene, comprising the following steps: (1) Obtaining explant materials: The mature embryos of *Sapium sebiferum* obtained through germination culture were used as the material source, and the hypocotyl, stem segments and cotyledon organs were cut as explants; (2) Activation culture of Agrobacterium rhizogenes: Agrobacterium rhizogenes carrying the RUBY reporter gene was cultured to the logarithmic phase, centrifuged and resuspended in liquid medium supplemented with acetylsyringone for activation culture; (3) Infection and co-culture of Agrobacterium: The explants from step (1) were infected with the bacterial solution from step (2); then they were inoculated into a medium supplemented with acetylsuccinone and DTT and co-cultured. (4) Induction culture of hairy roots: Wash the explants after co-culture in step (3) and transfer them to hairy root induction medium; (5) Visual screening of positive root systems: The hairy roots that have been transformed to positive roots were screened by observing the red betaine pigment produced by the RUBY reporter gene; (6) Molecular verification: The positive hairy roots screened in step (5) were molecularly verified by PCR technology.

[0008] This invention simplifies the screening process by introducing the RUBY visualization reporting system, optimizes the co-culture microenvironment by adding the small molecule reducing agent dithiothreitol (DTT) to inhibit browning, and selects Agrobacterium rhizogenes K599 to improve infection efficiency. It constructs an integrated technology system of efficient infection-browning protection-visual screening, which has important theoretical significance and practical application value for breaking through the genetic transformation bottleneck of Sapium sebiferum, accelerating its molecular breeding process, and elucidating the molecular mechanism of important trait formation.

[0009] Preferably, in step (1), the germination medium is MS medium supplemented with 28-30 g / L sucrose and 6.5-7.0 g / L agar, and the germination time is 3-4 weeks; more preferably, it is MS medium with 30 g / L sucrose and 6.8 g / L agar.

[0010] Preferably, in step (1), the length of the hypocotyl is 0.5-1.0 cm.

[0011] Preferably, in step (1), the stem segment is a stem segment with axillary buds or terminal buds.

[0012] Preferably, in step (1), the cotyledon size is 0.25-1.0 cm. 2 .

[0013] Preferably, in step (2), Agrobacterium rhizogenes is strain K599.

[0014] Preferably, in step (2), the OD of the resuspended Agrobacterium rhizogenes bacterial solution is... 600 The value is 0.4-0.8, and more preferably 0.6.

[0015] Preferably, in step (2), the final concentration of acetylsuccinone is 80-100 μM, and more preferably 100 μM.

[0016] Preferably, in step (2), the activation culture is carried out in a shaker at a temperature of 28-30℃ and a rotation speed of 100-150 r / min for 2.5-3 h; more preferably, the activation culture is carried out in a shaker at a temperature of 28℃ and a rotation speed of 100 r / min for 2.5 h.

[0017] Preferably, in step (2), the RUBY reporter gene contains CYP76AD1S , DODA and GT Three key enzyme genes are responsible for synthesizing red betalains in plant cells.

[0018] Preferably, in step (2), the method for preparing Agrobacterium rhizogenes carrying the RUBY reporter gene is to construct a recombinant expression vector containing the RUBY reporter gene and transform it into Agrobacterium rhizogenes. The recombinant expression vector is 35S:: RUBY containing streptomycin and spectinomycin resistance marker genes.

[0019] Preferably, in step (3), the infection time is 5-20 min; more preferably 10 min.

[0020] Preferably, in step (3), the amount of acetylsuccinone added is 50-150 μM.

[0021] Preferably, in step (3), the amount of DTT added is 50-200 mg / L; more preferably 150 mg / L.

[0022] Preferably, in step (3), the co-culture method is dark culture for 1-4 days; more preferably, it is 3 days.

[0023] Preferably, in step (4), the cleaning method is to clean with sterile water containing 300-500 mg / L cefotaxime sodium.

[0024] Preferably, in step (4), the hairy root induction medium is MS medium supplemented with 300-400 mg / L cefotaxime sodium and 0.1-0.9 mg / L indolebutyric acid (IBA).

[0025] Preferably, in step (5), visual screening is performed 7 days after infection. Performed over 28 days.

[0026] Preferably, in step (6), the PCR detection uses RUBY gene-specific primers RUBY-F and RUBY-R, with sequences SEQ ID No: 1 and SEQ ID No: 2, respectively.

[0027] Preferably, the culture conditions for steps (1), (2), and (4) are as follows: temperature 22-25℃, light intensity 40-50 μmol m -2 s -1 The photoperiod is 16 / 8 h (light / dark).

[0028] Preferably, the co-culture conditions in step (3) are as follows: temperature 22-25℃, light intensity 40-50 μmol m - 2 s -1 It is protected from light throughout the entire process.

[0029] The entire process is conducted in the dark to ensure the infective activity of Agrobacterium.

[0030] The beneficial effects of this invention are as follows: The method for establishing a RUBY reporter gene-mediated visual genetic transformation system for Sapium sebiferum provided by this invention has the following outstanding advantages: 1. High conversion efficiency: This invention achieves high efficiency by systematically optimizing the Agrobacterium infection concentration (OD). 600 The study investigated the effects of culturing the explants of *Sapium sebiferum* on the induction of browning, infection time, and co-culture time. It also innovatively introduced DTT into the co-culture medium, which effectively inhibited browning of *Sapium sebiferum* explants, resulting in a hypocotyl-positive hairy root induction rate of up to 80.9% and a comprehensive positive induction rate of hairy roots from different explants of up to 68.3%.

[0031] 2. Fast rooting speed: This invention adds IBA to the induction medium to accelerate the differentiation and development of hairy root primordia by regulating the auxin signaling pathway, shortening the average appearance time of hairy roots from 23 days to about 15 days, which significantly shortens the experimental cycle.

[0032] 3. Achieving Visualized and Efficient Screening: This invention introduces the RUBY visualization reporting system. Successfully transformed hairy roots exhibit a distinct red phenotype due to the accumulation of betalains. This phenotype is visible to the naked eye under natural light, eliminating the need for expensive equipment such as fluorescence microscopes or destructive detection methods like chemical color development. This achieves non-destructive, real-time, and high-throughput screening of transformants, significantly reducing experimental costs and operational barriers.

[0033] 4. Wide range of explant applications: This invention confirms that various explants (hypocotyl, stem segment, cotyledon, etc.) from germinated *Sapium sebiferum* seedlings can serve as highly efficient recipient materials for transformation. Among them, hypocotyl, stem segment buds, and cotyledons with stems show better performance. Furthermore, this invention supports a transformation strategy using mixed explants, effectively improving the comprehensive utilization rate of materials and enhancing the flexibility of the technical system.

[0034] Of course, implementing any product or method of the present invention does not necessarily require achieving all of the advantages described above at the same time. Attached Figure Description

[0035] Figure 1 This is a plasmid map carrying the RUBY reporter gene in Example 1 of the present invention; Figure 2 The images show robust red hairy roots obtained after 25 days of infection in Example 1 of this invention. A is a diagram showing the distribution and growth of hairy roots from the front view of the culture dish, and B is a diagram showing the extension and attachment of hairy roots from the back view of the same culture dish. Figure 3 This is an electrophoresis image of the PCR molecular identification of RUBY transgenic hairy roots in Example 1 of the present invention (M: Marker; PC: Positive control; 1-8: Positive hairy roots). Figure 4 The effect of adding DTT on explant browning rate and transformation efficiency in Example 4 of this invention; Figure 5 The effect of different transformation conditions on the induction efficiency of hairy roots of *Sapium sebiferum* in Examples 2, 3, 5, and 6 of this invention (A: OD) 600 B: Infection time, C: Co-culture time, D: IBA concentration); Figure 6 This is an example of the effect of different explant types on the induction of hairy roots of Sapium sebiferum in Example 7 of the present invention. The left figure is a statistical chart of the positive rate of hairy root induction of different explants, and the right figure is a physical picture of the hairy root growth status after induction of each explant. in, Figure 4 , Figure 5 , Figure 6 In the text, different letters such as a, b, c, etc., indicate that the differences between groups reached a statistical significance (P<0.05). Detailed Implementation

[0036] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise defined, the technical terms used below have the same meaning as understood by those skilled in the art.

[0037] Unless otherwise specified, the test materials and reagents used in the following examples are commercially available or prepared by known methods.

[0038] Unless otherwise specified, all techniques or conditions described in the embodiments can be performed in accordance with the techniques or conditions described in the literature in this field or in the product manual. Unless otherwise specified, the quantitative experiments in the following embodiments are all repeated three times or more, and the results are averaged.

[0039] Example 1: A method for establishing a visualized genetic transformation system of *Sapium sebiferum* mediated by the RUBY reporter gene, the specific operation of which is as follows: (1) The Chinese tallow tree (Sapium sebiferum) bred in the experimental field Sapium sebiferum Using sterile mature embryos of superior (Roxb.) strains as material, sterile seedlings were obtained by germination culture for 3 weeks on MS medium supplemented with 30 g / L sucrose and 6.8 g / L agar. Then, 1.0 cm hypocotyls, stem segments with buds, and 1.0 cm segments were cut. 2 The cotyledons are reserved; (2) The plasmid carrying the RUBY reporter gene (such as...) Figure 1 Agrobacterium rhizogenes K599 strain (as shown) was streaked onto TY plates containing 50 mg / L streptomycin and 50 mg / L spectinomycin and incubated at 28°C for 2 days. Single colonies were picked and inoculated into 50 mL of TY liquid medium containing 50 mg / L streptomycin and 50 mg / L spectinomycin, and cultured at 28°C with shaking at 200 rpm for approximately 20 hours until OD reached [insert OD value here]. 600 The value was 0.6. Centrifuge at 6000 r / min for 10 min, discard the supernatant, and then resuspend in liquid MS medium supplemented with 100 μM acetylsalicylic acid and 30 g / L sucrose. Incubate at 28℃ and 100 r / min for 2.5 h for cell activation. (3) Immerse the different types of explants in step (1) in the Agrobacterium rhizogenes solution in step (2) for 10 minutes, shaking continuously during the infection.

[0040] (4) Co-culture of explants with Agrobacterium: After the infected explants were removed, the surface bacterial solution was blotted dry with sterile filter paper, and the explants were inoculated onto MS medium (pH=5.8) supplemented with a final concentration of 100 μM acetylsalicylic acid, 150 mg / L DTT, 30 g / L sucrose and 6.8 g / L agar. The culture was carried out at a temperature of 25℃ and a light intensity of 50 μmol / L. -2 s -1 They were cultured in darkness for 3 days in a greenhouse with a photoperiod of 16 / 8 h (light / dark).

[0041] (5) After co-culturing the explants in step (4), wash them 5-8 times with sterile water containing 300 mg / L cefotaxime sodium, dry the surface of the explants, and inoculate them into MS medium (pH=5.8) containing 300 mg / L cefotaxime sodium, 0.5 mg / L IBA, 30 g / L sucrose and 6.8 g / L agar for induction culture of hairy roots; after 10 days of culture, red root primordia form at the explant cut, and after 5 more days of culture, visible red hairy roots can be obtained. After 1 week of culture, robust red hairy roots are obtained at the explant cut, forming a sharp contrast with a small number of white non-transformed roots. Figure 2 ).

[0042] (6) Genomic DNA was extracted from 8 randomly selected red hairy roots. RUBY gene-specific primers (RUBY-F (SEQ ID No: 1): 5'CACTCCTCCAGTTCTTCAACTGGAAG3'; RUBY-R (SEQ ID No: 2): 5'GAGGAGTAGGAATGGTGGTGAAGGA3') were designed, and the obtained red hairy roots were molecularly verified using PCR technology. The expected amplified fragment size was 1291 bp. PCR reaction system: 20 μL, containing 1 μL Template DNA, 10 μL 2× HieffCanace® Plus PCR Master Mix (With Dye), 1 μL each of Primers, and ddH2O to make up the volume. Reaction program: 98℃ pre-denaturation for 2 min; (98℃ 10 sec, 60℃ 5 sec, 72℃ 10 sec) × 30 cycles; 72℃ extension for 2 min. Electrophoresis results are as follows: Figure 3 As shown, PCR molecular identification was performed on eight red hairy roots, and all results yielded specific amplified bands of the expected size. The negative control (untransformed seedlings) showed no amplified product. Simultaneous PCR identification using the original plasmid and water as templates served as controls to eliminate other interferences. These results indicate that the exogenous RUBY gene has been stably integrated into the *Sapium sebiferum* genome and successfully expressed, conferring a visible red mark on the hairy roots.

[0043] Example 2: This embodiment tested the OD of Agrobacterium rhizogenes inoculum. 600 The influence of the value on the infection effect. The specific steps are as follows: Adjusting the OD of the bacterial solution 600 The values ​​were 0.4, 0.6, 0.8, and 1.0, respectively. Different explants of the sterile seedlings obtained after 3 weeks of culture in Example 1 were mixed and placed in various bacterial solutions. The remaining steps were the same as in Example 1. The results showed (e.g.) Figure 5 As shown in Figure A), the concentration of the bacterial solution significantly affects the transformation efficiency of *Sapium sebiferum* explants. When the OD of the bacterial solution... 600 At a coefficient of performance (COP) of 0.6, the transformation efficiency was highest, with an average positive rate of 41.5% in three independent replicate experiments, significantly higher than that of OD. 600 Treatment groups with concentrations of 0.4 (23.0%), 0.8 (26.2%), and 1.0 (17.1%). Excessively high bacterial concentrations (OD) 600 >0.8) leads to browning and even death of explants, while excessively low concentrations (OD) 600 A value <0.4) indicates insufficient infection and a low positive rate. Therefore, determining OD... 600 =0.6 is the optimal infection concentration.

[0044] Example 3: This example tested the effect of Agrobacterium rhizogenes infection time on transformation efficiency. The specific steps are as follows: In Example 2, the optimal bacterial concentration (OD) 600 Under conditions of 0.6, different explants of the sterile seedlings obtained in Example 1 after 3 weeks of culture were mixed and placed in bacterial solution. Four groups were set up with inoculation times of 5 min, 10 min, 15 min, and 20 min, respectively. The remaining steps were the same as in Example 1. The results showed (e.g., Figure 5 As shown in Figure B, the infection time significantly affected the transformation efficiency of *Sapium sebiferum* explants. The highest transformation efficiency was observed at an infection time of 10 min, with an average positive rate of 59.4% across three independent replicates, significantly better than the treatments with infection times of 5 min (20.9%), 15 min (40.1%), and 20 min (33.3%). The data indicate that a 10-min infection time is sufficient to ensure effective contact between *Agrobacterium rhizogenes* and the explants, as well as T-DNA transfer. Extending the infection time not only failed to improve the transformation rate but also increased the risk of *Agrobacterium* overgrowth and explant contamination. Therefore, 10 min was determined to be the optimal infection time.

[0045] Example 4: This example tested the effect of DTT concentration in the co-culture medium on transformation. The specific steps are as follows: The Agrobacterium rhizogenes K599 strain carrying the RUBY reporter gene from Example 1 was cultured to OD. 600 After reaching a concentration of 0.6, centrifuge at 6000 r / min for 10 min, discard the supernatant, and then resuspend in liquid MS medium supplemented with 100 μM acetylsalicylic acid and 30 g / L sucrose to adjust the OD of the bacterial culture. 600 The value was 0.6. Pre-induction was performed at 28℃ for 2.5 hours. Then, different explants (hypocotyl, stem segment, and cotyledon) of the sterile seedlings obtained after 3 weeks of culture in Example 1 were mixed and placed in the above bacterial solution for 10 min of infection. The mixture was then inoculated onto MS medium (pH=5.8-6.0) supplemented with a final concentration of 100 μM acetylsylcholine, 30 g / L sucrose, and different concentrations of DTT, 6.8 g / L agar. Five groups were established with DTT concentration gradients of 0, 50, 100, 150, and 200 mg / L. The inoculation was performed at 25℃ and a light intensity of 50 μmol / m². -2 s -1 The cells were cultured in darkness for 2 days in a greenhouse with a photoperiod of 16 / 8 h (light / dark). The remaining steps were the same as in Example 1. The results showed ( Figure 4 During the co-culture stage, the addition of an appropriate amount of DTT significantly reduced the browning rate of explants and effectively improved transformation efficiency. Experiments showed that with increasing DTT concentration, the browning rate first decreased and then increased; when the DTT concentration was 150 mg / L, the browning rate reached its lowest point (average only 12.5%), and at this point, the hairy root positivity rate reached its peak, with an average positivity rate of 42.3% in three independent replicate experiments. Comparison of the data from each group showed that the control group without DTT exhibited severe browning (37.2%) and a low positivity rate (16.7%); transformation efficiency increased with DTT concentrations of 50 mg / L and 100 mg / L; however, at a concentration of 200 mg / L, the excessively high concentration of DTT caused cytotoxicity, leading to a rebound in the browning rate to 20.6% and a decrease in the positivity rate to 33.5%. Therefore, the optimal concentration of DTT in the co-culture medium was determined to be 150 mg / L.

[0046] Example 5: This embodiment tested the effect of co-culture time on conversion efficiency. The specific steps are as follows: At the optimal bacterial concentration (OD) 600 Under the conditions of optimal infection time (10 min) and optimal DTT concentration (150 mg / L), the infected explants were co-cultured separately, with four groups of co-culture time gradients of 1 d, 2 d, 3 d, and 4 d (corresponding to groups 1 to 4 in the data table). The remaining steps were the same as in Example 1. Data showed (e.g.) Figure 5As shown in Figure C, the co-culture time significantly affected the transformation efficiency of *Sapium sebiferum* explants. The highest transformation efficiency was observed with a co-culture time of 3 days, with an average positive rate of 68.3% in three independent replicate experiments, significantly better than the treatments with co-culture times of 2 days (60.2%), 4 days (61.2%), and 1 day (17.4%). Although a high positive rate was maintained even after 4 days of co-culture, severe *Agrobacterium* growth on the culture medium surface increased the difficulty of subsequent cleaning and the risk of contamination; while 1 day of co-culture resulted in insufficient transformation due to the short time. Therefore, 3 days was determined to be the optimal co-culture duration.

[0047] Example 6: This example tested the effect of IBA concentration in the culture medium on conversion efficiency. The specific steps are as follows: In step (5) the antibacterial induction stage, six groups of IBA concentration gradients in the culture medium were set at 0, 0.1, 0.3, 0.5, 0.7, and 0.9 mg / L. The average number of days required for the first appearance of hairy roots in each group was counted. The remaining steps are as in Example 1. The results show (e.g. Figure 5 As shown in Figure D, during the antibacterial induction phase, the addition of the plant growth regulator IBA significantly promoted the development of hairy roots and shortened the emergence time. The control group without IBA showed slow and sparse hairy root development. The fastest hairy root emergence rate was observed at an IBA concentration of 0.5 mg / L, with an average emergence time of only 15.1 days in three independent replicates, significantly faster than the control group without IBA (23.3 days) and other concentration groups (0.1 mg / L: 21.1 days, 0.3 mg / L: 17.8 days, 0.7 mg / L: 17.0 days, 0.9 mg / L: 19.4 days). With increasing IBA concentration, the average hairy root emergence time gradually shortened, reaching its shortest at 0.5 mg / L; however, when the IBA concentration continued to increase to 0.9 mg / L, the emergence time actually lengthened. Therefore, the optimal IBA concentration in the induction medium was determined to be 0.5 mg / L.

[0048] Example 7: This embodiment tested the effect of different explant types on induction efficiency. The specific steps are as follows: Under optimal conversion conditions (OD) 600 =0.6, infection for 10 min, co-culture for 3 days, co-culture medium containing 150 mg / L DTT) and under optimal induction conditions (IBA 0.5 mg / L), three types of explants, hypocotyl, cotyledon, and stem segment, were selected for transformation experiments, and the average positive rate of each group was calculated. The experimental results show that ( Figure 6The type of explant significantly affected the induction efficiency of hairy roots in *Sapium sebiferum*. Hypocotyl showed the best induction effect, with an average positive rate of 80.9% in three independent replicate experiments, significantly higher than cotyledons (66.1%) and stem segments (58.1%). Hypocotyl cuts showed less callus tissue, rapid hairy root emergence, and a distinct red phenotype; while stem segments could induce hairy roots, the rate was slower and the transformation efficiency was relatively low, with some showing browning. This system showed good adaptability to various explants, but hypocotyl was the optimal material. Therefore, hypocotyl was determined to be the best explant type. Experiments demonstrated that this system has good adaptability to various explants, and the mixed culture strategy effectively ensured the acquisition of sufficient positive material.

[0049] Example 8: The difference between this embodiment and Embodiment 1 is that: a 0.5 cm long hypocotyl, a stem segment with axillary buds, and a 0.25 cm long section are cut. 2 The cotyledons were used as explants, and the rest was the same as in Example 1. The results were almost identical to those in Example 1.

[0050] In summary, this invention establishes the optimal process parameters for efficient induction of hairy roots in *Sapium sebiferum*: bacterial solution OD... 600 =0.6, immersion time 10 min, co-culture time 3 days (with 150 mg / L DTT added), and IBA concentration in induction medium 0.5 mg / L. Under the optimal system, the average positive rate of mixed explants reached 68.3%, with the highest positive rate (80.9%) observed in hypocotyl explants, which also exhibited the fastest rooting speed (average 15.1 days), thus achieving the construction of an efficient and rapid genetic transformation system.

[0051] RUBY reporter gene contains CYP76AD1S , DODA and GT The three key enzyme genes are shown below in their specific sequences (SEQ ID No: 3), in the following order: CYP76AD1S—P2A--DODA—P2A—GT (P2A is the linker sequence). The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for visualizing genetic transformation of *Sapium sebiferum* mediated by the RUBY reporter gene, characterized in that, Includes the following steps: (1) Obtaining explant materials: The mature embryos of *Sapium sebiferum* obtained through germination culture were used as the material source, and the hypocotyl, stem segments and cotyledon organs were cut as explants; (2) Activation culture of Agrobacterium rhizogenes: Agrobacterium rhizogenes carrying the RUBY reporter gene was cultured to the logarithmic phase, centrifuged and resuspended in liquid medium supplemented with acetylsyringone for activation culture; (3) Infection and co-culture of Agrobacterium: The explants from step (1) were infected with the bacterial solution from step (2); then they were inoculated into a medium supplemented with acetylsuccinone and DTT and co-cultured. (4) Induction culture of hairy roots: Wash the explants after co-culture in step (3) and transfer them to hairy root induction medium; (5) Visual screening of positive root systems: The hairy roots that have been transformed to positive roots were screened by observing the red betaine pigment produced by the RUBY reporter gene; (6) Molecular verification: The positive hairy roots screened in step (5) were molecularly verified by PCR technology.

2. The method for visual genetic transformation of *Sapium sebiferum* according to claim 1, characterized in that, In step (1), the germination medium is MS medium supplemented with 28-30 g / L sucrose and 6.5-7.0 g / L agar, and the germination time is 3-4 weeks.

3. The method for visual genetic transformation of *Sapium sebiferum* according to claim 1, characterized in that, In step (1), the hypocotyl length is 0.5-1.0 cm; the stem segment is a stem segment with axillary buds or terminal buds; the cotyledon size is 0.25-1.0 cm. 2 .

4. The method for visual genetic transformation of *Sapium sebiferum* according to claim 1, characterized in that, In step (2), the Agrobacterium rhizogenes strain was K599; the OD of the Agrobacterium rhizogenes bacterial solution after resuspension was... 600 The value is 0.4-0.

8.

5. The method for visual genetic transformation of *Sapium sebiferum* according to claim 1, characterized in that, In step (2), the final concentration of acetylsuccinone is 80-100 μM; the activation culture method is to carry out cell activation culture for 2.5-3 h in a shaker at a temperature of 28-30℃ and a rotation speed of 100-150 r / min.

6. The method for visual genetic transformation of *Sapium sebiferum* according to claim 1, characterized in that, In step (3), the infection time is 5-20 min; the amount of acetylsuccinone added is 50-150 μM; the amount of DTT added is 50-200 mg / L; and the co-culture method is dark culture for 1-4 days.

7. The method for visualizing genetic transformation of *Sapium sebiferum* according to claim 1, characterized in that, In step (4), the cleaning method is to clean with sterile water containing 300-500 mg / L cefotaxime sodium.

8. The method for visual genetic transformation of *Sapium sebiferum* according to claim 1, characterized in that, In step (4), the hairy root induction medium is MS medium supplemented with 300-400 mg / L cefotaxime sodium and 0.1-0.9 mg / L indolebutyric acid.

9. The method for visual genetic transformation of *Sapium sebiferum* according to claim 1, characterized in that, In step (5), visual screening is performed 7 days after immersion. Performed over 28 days.

10. The method for visual genetic transformation of *Sapium sebiferum* according to claim 1, characterized in that, In step (6), PCR detection uses RUBY gene-specific primers RUBY-F and RUBY-R, with sequences SEQ ID No: 1 and SEQ ID No: 2, respectively.

Images