Primer pair for detecting REP gene of parrot beak and feather disease virus and application of primer pair

Abstract

The invention discloses a primer pair for detecting a parrot beak and feather disease virus REP gene and application of the primer pair, and belongs to the technical field of biological detection. The nucleotide sequences of the forward primer and the reverse primer of the primer pair are shown as SEQ ID NO.1 and SEQ ID NO.2 in sequence. The invention provides a primer pair capable of specifically detecting the REP gene of the parrot beak and feather disease virus and an application method, the primer pair can specifically amplify the parrot beak and feather disease virus, has no cross reaction with nucleic acids of other viruses, has strong specificity, can realize rapid and accurate detection of the parrot beak and feather disease virus through a real-time fluorescence RPA detection method, and has good application prospects. The method has the advantages of simplicity and convenience in operation, low cost, high sensitivity, low false positive rate and the like, and solves the problems of high detection cost, long time, high requirements on detection personnel, need of professional training, only suitability for auxiliary diagnosis in laboratories, incapability of being popularized and applied and the like in the conventional detection method.

Description

Technical Field

[0001] This invention relates to the field of biological detection technology, specifically to a primer pair for detecting the REP gene of parrot beak feather disease virus and its application. Background Technology

[0002] Psittacine beak and feather disease (PBFD) is caused by psittacine beak and feather disease virus (PBFDV). This virus primarily induces pathological changes in the beak and feathers of parrots. Affected parrots exhibit symmetrical feather atrophy, loss, or abnormal growth; new feathers may be underdeveloped or even remain at the quill stage. Some parrots develop deformed or even blackened beaks, and their claws may show abnormal deformities. PBFD is an immunosuppressive infectious disease. Although infected parrots do not die immediately, PBFDV attacks immune organs such as the bursa of Fabricius and thymus, suppressing the body's immune function, leading to secondary or mixed infections and ultimately death. PBFDV is a single-stranded DNA virus with a genome size of approximately 1.7-2.0 kb. The genome mainly includes two open reading frames (ORFs) in opposite directions: one encoding a replication-associated protein (Rep), and the other encoding a capsid protein (Cap). To date, PBFD has been reported in approximately 40 countries worldwide, affecting both wild and captive parrots.

[0003] Currently, there are no effective methods for preventing or treating PBFD. Sick parrots can only receive preventative treatment, including creating a better living environment to slow the disease's progression. Diagnostic methods for PBFDV are still in their early stages, including conventional PCR, real-time quantitative PCR, and ELISA. However, all three methods require bulky or expensive equipment, are time-consuming, and demand highly skilled personnel requiring specialized training. Therefore, they are only suitable for auxiliary laboratory diagnosis and cannot be widely applied. Summary of the Invention

[0004] To address the aforementioned technical problems, the present invention aims to provide a primer pair for detecting the REP gene of psittacosis virus and its application, thereby solving the problems of existing psittacosis virus detection methods requiring bulky or expensive instruments and equipment, long detection times, high requirements for testing personnel, need for professional training, suitability only for laboratory auxiliary diagnosis, and inability to be widely applied.

[0005] The technical solution of the present invention to solve the above-mentioned technical problems is as follows: In a first aspect, the present invention provides a primer pair for detecting the REP gene of parrot beak feather disease virus, wherein the nucleotide sequences of the forward primer and the reverse primer are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively. SEQ ID NO.1: AGGTTGACGTCATCTATGGCCCGCCTGG; SEQ ID NO. 2: GTAGCCACCCATAGAAATCGTCCAAGA.

[0006] The beneficial effects of this invention are as follows: This invention provides a primer pair for detecting the REP gene of psittacosis virus. This primer pair can specifically amplify psittacosis virus and has no cross-reactivity with the nucleic acids of H9N2 avian influenza virus, Newcastle disease virus, avian polyomavirus and chicken infectious bronchitis virus. It has high specificity and can achieve rapid and accurate detection of psittacosis virus.

[0007] A second aspect of the present invention provides the use of the primer pair described above for detecting the REP gene of psittacosis virus in the preparation of reagents or kits for detecting psittacosis virus.

[0008] A third aspect of the present invention provides a kit for detecting parrot beak feather disease virus, comprising the primer pair described above for detecting the REP gene of parrot beak feather disease virus.

[0009] Furthermore, the kit also includes probes, real-time fluorescent RPA reaction powder, rehydration buffer, magnesium acetate, positive control, and negative control.

[0010] Furthermore, the nucleotide sequence of the probe is shown in SEQ ID NO.3; SEQ ID NO. 3: 5'-TAAGATGCGCGTGAATGGTGGGATGGATATGATGGAGAAGATATCGTC-3'.

[0011] Furthermore, the probe was modified as follows: the 33rd base at the 5' end was labeled with a FAM fluorescent group, a tetrahydrofuran (THF) debasement site was attached after the 34th base, the 36th T base was labeled with a BHQ1 quencher group, and the 3' end was modified with a C3-spacer blocking modification.

[0012] Further, the modified probe is shown below: SEQ ID NO.3: 5'-TAAGATGCGCGGTGAATGGTGGGATGGATA[FAM-dT][THF]A[BHQ-dT]GGAGAAGATATCGTC-[C3Spacer]-3', where [FAM-dT] is the T base labeled with the FAM fluorescent group, [THF] is the tetrahydrofuran recognition site of the recombinase, [BHQ-dT] is the T base labeled with the BHQ1 quencher group, and [C3-spacer] is a bio-blocking agent.

[0013] The beneficial effects of adopting the above-mentioned further technical solution are as follows: By modifying the probe, the modified probe is not recognized by exonuclease in the free state. When the probe and the target gene are recognized, they begin to bind. After the exonuclease recognizes the gap, it removes THF and releases the C3-spacer biological blocking agent, thereby separating the FAM group and the BHQ1 group and emitting fluorescence that can be detected by the instrument, thus detecting the amplification product.

[0014] Furthermore, the positive control includes the REP gene of parrot beak feather disease virus, the nucleotide sequence of which is shown in SEQ ID NO.4; SEQ ID NO.4: CGCGAGACGGTCACCGCGCGTTTGACGGAGCTGTTGCCGCTGTGCTTGCCGGAAGACGAATGAAAGAAGTCGCGCGAGAGTTCCCGGATATCTACGTCAGGCATGGGCGTGGTCTGCACAA TCCTCTCTTCTGATTGGCTCTCAGCCGCGCGACTTTAAAACTGAGGTTGACGTCATCTATGGCCCGCCTGGGTGTGGCAAGAGTAAATGGGCCAATGAGCAGCCGGGGTCAAAGTACTATAAGATG CGCGGTGAATGGTGGGATGGATATGATGGAGAAGATATCGTCATCTTGGACGATTTCTATGGGTGGCTACCTTATTGCGAGATGCTCCCGCCTATGTGACCGTTACCCACATAAAGTGCCAGTTAAAG GTGCCTTTGTGGAGTTTACCAGCAAGAGGATCATCATCACGAGCAATAAGGCCCCCGAGACCTGGTACAAGGAGGATTGTGACCCGAAGCCACTGTTCCGGAGATTCACTCGTGTTTGGTGGTACA.

[0015] Furthermore, the real-time fluorescent RPA reaction powder includes recombinase, single-chain binding protein, polymerase, ATP, and dNTPMix.

[0016] Furthermore, negative controls include ddH2O.

[0017] In a fourth aspect, the present invention provides the application of the primer pair for detecting the REP gene of psittacosis virus or the kit for detecting psittacosis virus in non-diagnostic purposes.

[0018] A fifth aspect of the present invention provides a method for detecting psittacosis virus for non-diagnostic purposes, using the above-described kit for detecting psittacosis virus, specifically comprising the following steps: S1: Extract DNA from the sample to be tested; S2: Using the DNA obtained in S1 as a template, perform a real-time fluorescent RPA reaction using the reagents in the kit and collect the fluorescence signal; S3: If the peak time is ≤20 min or the Ct value is ≤38, the sample is positive for psittacosis virus; if the peak time is >20 min or the Ct value is >38, the sample is negative for psittacosis virus.

[0019] Furthermore, in the reaction system of the real-time fluorescent RPA reaction, the mass-to-volume ratio of real-time fluorescent RPA reaction powder, rehydration buffer, magnesium acetate, forward primer, reverse primer, probe, DNA template and ddH2O is 15 mg:29.5 μL:2.5 μL:1.2 μL:1.2 μL:0.6 μL:2 μL:13 μL.

[0020] Furthermore, the concentrations of both the forward and reverse primers were 5-20 μmol / L; the concentrations of the probes were also 5-20 μmol / L.

[0021] Preferably, the concentrations of both the forward and reverse primers are 10 μmol / L; the concentrations of both probes are 10 μmol / L.

[0022] Furthermore, the reaction program for the real-time fluorescent RPA reaction is: 41℃ for 60 s; 41℃ for 30 s, for 40 cycles.

[0023] The present invention has the following beneficial effects: 1. This invention provides a primer pair that can specifically amplify the REP gene of parrot beak feather disease virus. This primer pair has no cross-reactivity with the nucleic acids of H9N2 avian influenza virus, Newcastle disease virus, avian polyomavirus and chicken infectious bronchitis virus, and has high specificity.

[0024] 2. This invention provides a method for real-time fluorescent RPA detection of psittacosis virus based on the primer pair. The method can complete the detection within 30 minutes and can detect low-copy psittacosis virus nucleic acid. It has the advantages of simple operation, low cost, high sensitivity and low false positive rate. Attached Figure Description

[0025] Figure 1 This is a graph showing the real-time fluorescence RPA detection results of 16 primer pairs and probes in Example 1; Figure 2 This is an agarose gel electrophoresis result of the primer pair PCR amplification product for detecting the REP gene of parrot beak feather disease virus in Example 2; Figure 3 The amplification results of the neutral and negative controls in Example 3 are shown in the figure. Figure 4 The graph shows the sensitivity test results of the method for detecting parrot beak feather disease virus in Experiment Example 2; Figure 5 This is a graph showing the specificity of the detection method for parrot beak feather disease virus in Experiment Example 3. Detailed Implementation

[0026] The principles and features of the present invention are described below with reference to the accompanying drawings. The examples given are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer should be followed. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0027] Example 1: Primer design and screening I. Primer and Probe Design Using the PBFDV-REP gene sequences in the NCBI database (GenBank accession numbers: KF688550.1, KF688549.1, KF688548.1, KF850537.1, KF673336.1, KF673335.1, KM188465.1, KM188464.1, KM188463.1, KM188462.1, KM188461.1, KM188460.1, KM188459.1, KM188458.1, KM188457.1, KM188456.1, KM188455.1, KM188454.1, ... Using KM188453.1 as a reference, and based on gene alignment analysis of conserved regions, and after homology analysis, the primer and probe (P) sequences were designed as follows: Primer sequences: F1: AGGTTGACGTCATCTATGGCCCGCCTGG (SEQ ID NO.1); F2: AGTAAATGGGCCAATGAGCAGCCGGGGT (SEQ ID NO.5); F3: TAAATGGGCCAATGAGCAGCCGGGGTC (SEQ ID NO.6); F4: GCCAATGAGCAGCCGGGGTCAAAGTACT (SEQ ID NO.7); R1: GTAGCCACCCATAGAAATCGTCCAAGA (SEQ ID NO.2); R2: CGCAATAAGGTAGCCACCCATAGAAATCGT (SEQ ID NO.8); R3:GGGTAACGGTCACATAGGCGGAGCATCTCG (SEQ ID NO.9); R4: GTGGGTAACGGTCACATAGGCGGAGCATCT (SEQ ID NO. 10).

[0028] Probe sequence: P: TAAGATGCGCGTGAATGGTGGGATGGATATGATGGAGAAGATATCGTC (SEQ ID NO.3); The probe sequence was modified, specifically by: labeling the 33rd base of the 5' end with a FAM fluorescent group, attaching a tetrahydrofuran debasement site after the 34th base, labeling the 36th T base with a BHQ1 quencher group, and performing C3-spacer blocking modification at the 3' end.

[0029] The modified probe sequence is: TAAGATGCGCGGTGAATGGTGGGATGGATA[FAM-dT][THF]A[BHQ-dT]GGAGAAGATATCGTC-[C3Spacer]; Wherein, [FAM-dT] is the T base labeled with the FAM fluorescent group, [THF] is the tetrahydrofuran recognition site of the recombinase, [BHQ-dT] is the T base labeled with the BHQ1 quencher group, and [C3-spacer] is a biological blocking agent.

[0030] II. Primer Screening First, primers F1-F4 and R1-R4 were paired and divided into 16 groups, namely: F1R1, F1R2, F1R3, F1R4, F2R1, F2R2, F2R3, F2R4, F3R1, F3R2, F3R3, F3R4, F4R1, F4R2, F4R3 and F4R4.

[0031] Then, using parrot beak feather disease virus nucleic acid (SEQ ID NO.4) as a template and ddH2O as a negative control, real-time fluorescent RPA reaction was performed using the above 16 primer pairs. The real-time fluorescent RPA reaction program was: 41℃ for 60 s; 41℃ for 30 s, for 40 cycles. The results are as follows: Figure 1 As shown.

[0032] Depend on Figure 1 It can be seen that, under the same primer and probe concentration, the primer pair with a smaller Ct value and a larger amount of amplified product is F1R1, which is the primer pair for detecting the REP gene of parrot beak feather disease virus in this invention.

[0033] Example 2: Validation of primer pairs for real-time fluorescent RPA detection of the REP gene of parrot beak feather disease virus PCR was performed using the PBFDV-REP gene positive standard plasmid (GenBank accession number EF457974.1) as a template.

[0034] The reaction system consisted of 1.0 μL each of forward primer F1 (10 μmol / L) and reverse primer R1 (10 μmol / L), 6.0 μL of ddH2O, 10.0 μL of 2× Es Taq MasterMix, and 2 μL of template.

[0035] The reaction program was as follows: pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 15 s, for 35 cycles; extension at 72℃ for 2 min.

[0036] Finally, the PCR products were analyzed by 1% agarose gel electrophoresis. The experimental results are as follows: Figure 2 As shown, lanes M, P, and N, from left to right, represent the marker, the PBFDV-REP gene plasmid, and the ddH2O negative control, respectively.

[0037] The results showed that the PCR amplification fragment of primer pair F1R1 obtained by the present invention was consistent with the expected result, with a size of 153 bp, indicating that primer pair F1R1 can accurately amplify the REP gene of parrot beak feather disease virus.

[0038] Example 3: Kit for detecting parrot beak feather disease virus A kit for detecting parrot beak feather disease virus, comprising forward and reverse primers as shown in SEQ ID NO.1 and SEQ ID NO.2, and further comprising a probe, real-time fluorescent RPA reaction powder, rehydration buffer, magnesium acetate, a positive control and a negative control.

[0039] The nucleotide sequence of the probe in this kit is shown below: 5'-TAAGATGCGCGGTGAATGGTGGGATGGATA[FAM-dT][THF]A[BHQ-dT]GGAGAAGATATCGTC-[C3Spacer]-3'; Wherein, [FAM-dT] is the T base labeled with the FAM fluorescent group, [THF] is the tetrahydrofuran recognition site of the recombinase, [BHQ-dT] is the T base labeled with the BHQ1 quencher group, and [C3-spacer] is a biological blocking agent.

[0040] The real-time fluorescent RPA reaction powder in this kit includes recombinase, single-stranded binding protein, polymerase, ATP, and dNTP Mix.

[0041] In this kit, the real-time fluorescent RPA reaction powder, rehydration buffer, and magnesium acetate are all components of the real-time fluorescent RPA nucleic acid amplification reagent purchased from Hangzhou Zhongce Biotechnology Co., Ltd.

[0042] The positive control in this kit includes parrot beak feather disease virus nucleic acid, the nucleotide sequence of which is shown in SEQ ID NO.4; the negative control is ddH2O.

[0043] In this kit, the molar ratio of the forward primer, reverse primer, and probe is 1:1:1.

[0044] Example 4: Method for detecting parrot beak feather disease virus for non-diagnostic purposes This embodiment provides a method for detecting parrot beak feather disease virus for non-diagnostic purposes, using the kit from Example 3, and specifically includes the following steps: (1) Extract genomic DNA from the sample to be tested as a DNA template by following the instructions of the AxyPrep Body Fluid Virus DNA / RNA Mini Extraction Kit (purchased from Guangzhou Suyan Biotechnology Co., Ltd.).

[0045] (2) Prepare the reaction system. Each sample to be tested corresponds to one real-time fluorescent RPA reaction powder tube. The reaction system in each real-time fluorescent RPA reaction tube is 50 μL, including 15 mg of real-time fluorescent RPA reaction powder, 29.5 μL of rehydration buffer, 2.5 μL of magnesium acetate, 1.2 μL each of forward and reverse primers (concentration of 10 μmol / L), 0.6 μL of probe (concentration of 10 μmol / L), 13 μL of ddH2O and 2 μL of DNA template.

[0046] (3) Place the reaction tube in the fluorescence quantitative instrument, 41℃ for 60 s; 41℃ for 30 s, for 40 cycles, and collect the fluorescence signal.

[0047] (4) After amplification, the results of the test sample are determined based on the peak time or Ct value. The judgment criteria are as follows: Positive control: The appearance of an amplification curve, or the peak time ≤20 min or the Ct value ≤38, indicates a valid result; Negative control: No amplification curve appears, or the peak time is >20 min or the Ct value is >38, which is a valid result; For samples to be tested: if the elution time is ≤20 min or the Ct value is ≤38, the sample can be judged to be positive for psittacosis virus; if the elution time is >20 min or the Ct value is >38, the sample can be judged to be negative for psittacosis virus.

[0048] The total experimental time was 21 min. When the peak appeared within 20 min, the Ct value was ≤38. When the peak appeared after 20 min, the Ct value was >38. The specific judgment index was determined based on the horizontal axis of the fluorescence spectrum of the real-time fluorescence RPA.

[0049] In this embodiment, the amplification results of the positive and negative controls are as follows: Figure 3 As shown, from top to bottom are the positive control, baseline, and negative control.

[0050] Depend on Figure 3 It is evident that both the positive and negative controls of this invention yield valid results. The negative control design effectively verifies whether the reagents used are contaminated, avoiding false positives, while the positive control design effectively verifies the effectiveness of the reagents used, avoiding false negatives.

[0051] Experiment 1: Verification of Detection Accuracy Thirty tissue samples suspected of being infected with psittacosis virus were provided by a parrot breeding farm in South China as test samples. The samples were detected by qPCR using the publicly available primers PBFDV-F / R (SEQ ID NO.11 and SEQ ID NO.12) and by the real-time fluorescence RPA method of Example 4 of this invention, and the results were compared.

[0052] SEQ ID NO.11: 5'-GCTACCTTATTGCGAGHTGCT-3'; SEQ ID NO. 12: 5'-GGTCACAGTCCTCCTTGTACCA-3'.

[0053] The qPCR detection method specifically includes the following steps: Genomic DNA was extracted from the sample according to the instructions of the Animal Tissue Total DNA / RNA Extraction Kit (DP431) (Guangzhou Sijia Biotechnology Co., Ltd.), and then qPCR detection was performed.

[0054] The qPCR reaction program was as follows: 95℃ for 30 s; denaturation at 95℃ for 5 s, annealing at 55℃ for 30 s, extension at 60℃ for 34 s, for 40 cycles.

[0055] The qPCR reaction system was as follows: PBFDV-F (10 µmol / L) 1 µL, PBFDV-R (10 µmol / L) 1 µL, ddH2O 11 µL, Premix Ex Taq 10 µL, and template 2 μL.

[0056] The results of qPCR and real-time fluorescence RPA detection are shown in Table 1.

[0057] Table 1 Sample test results

[0058] As shown in Table 1, the real-time fluorescence RPA detection results and qPCR detection results used in this invention are highly consistent, indicating that the method of this invention has good specificity and stability. Moreover, the method of this invention can complete the detection within 30 minutes, which has the characteristics of simple operation and low cost, making it more suitable for on-site mobile detection and having advantages that the qPCR detection method does not have.

[0059] Experimental Example 2: Verification of Detection Sensitivity A positive standard plasmid for the REP gene of parrot beak feather disease virus was constructed by Sangon Biotech (GenBank accession number EF457974.1). The constructed positive standard plasmid was serially diluted 10-fold and diluted with 10... 5 copies / μL, 10 4copies / μL, 10 3 copies / μL, 10 2 Using five positive standard plasmids at concentrations of 10 copies / μL and 10 copies / μL as templates, and ddH2O as a negative control, 2 μL of each plasmid was taken as the reaction template, and nucleic acid amplification was performed according to the steps described in Example 4 to test the sensitivity of the method for detecting parrot beak feather disease virus of the present invention. The detection results are as follows: Figure 4 As shown.

[0060] Depend on Figure 4 It can be seen that the detection results of the positive standard plasmids at the five concentration gradients were all Ct values ​​≤38, which can be judged as positive for parrot beak feather disease virus. The results show that the primer pair and probe of the present invention can detect a minimum template concentration of 10 copies / μL, and the detection sensitivity is high.

[0061] Experimental Example 3: Validation of Detection Specificity Using psittacosis virus nucleic acid (SEQ ID NO.4) as a positive control and ddH2O as a negative control, nucleic acids of H9N2 avian influenza virus, Newcastle disease virus, avian polyomavirus, and infectious bronchitis virus were detected. Nucleic acid amplification was performed according to the steps described in Example 4 to test the specificity of the method for detecting psittacosis virus of this invention. The detection results are as follows: Figure 5 As shown.

[0062] Depend on Figure 5 It was found that only the experimental group corresponding to the positive control template of psittacosis beak feather disease virus showed a normal fluorescence detection curve, while no amplification curve was observed in the experimental groups and negative control group of other viruses. The results indicate that the primer pairs and probes of this invention can achieve specific detection of psittacosis beak feather disease virus, and there is no cross-reactivity with the nucleic acids of H9N2 avian influenza virus, Newcastle disease virus, avian polyomavirus, and chicken infectious bronchitis virus.

[0063] In summary, the primer pairs and kits provided by this invention can achieve rapid, convenient, efficient and specific detection of psittacosis virus in samples, and can assist in the diagnosis of whether it is psittacosis virus infection. They are suitable for clinical differential detection, animal disease detection and purification.

[0064] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A primer pair for detecting the REP gene of parrot beak feather disease virus, characterized in that, The nucleotide sequences of the forward and reverse primers are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

2. The use of the primer pair for detecting the REP gene of psittacosis virus as described in claim 1 in the preparation of reagents or kits for detecting psittacosis virus.

3. A kit for detecting parrot beak feather disease virus, characterized in that, Includes the primer pair for detecting the REP gene of parrot beak feather disease virus as described in claim 1.

4. The kit for detecting parrot beak feather disease virus according to claim 3, characterized in that, It also includes probes, real-time fluorescent RPA reaction powder, rehydration buffer, magnesium acetate, positive control and negative control.

5. The kit for detecting parrot beak feather disease virus according to claim 4, characterized in that, The nucleotide sequence of the probe is shown in SEQ ID NO.3; The positive control includes the REP gene of parrot beak feather disease virus, the nucleotide sequence of which is shown in SEQ ID NO.4; The real-time fluorescent RPA reaction powder includes recombinase, single-chain binding protein, polymerase, ATP, and dNTP Mix; The negative control includes ddH2O.

6. The use of the primer pair for detecting the REP gene of psittacosis virus as described in claim 1 or the kit for detecting psittacosis virus as described in any one of claims 3-5 in the non-diagnostic detection of psittacosis virus.

7. A method for detecting parrot beak feather disease virus for non-diagnostic purposes, characterized in that, The kit for detecting parrot beak feather disease virus according to any one of claims 3-5 specifically includes the following steps: S1: Extract DNA from the sample to be tested; S2: Using the DNA obtained in S1 as a template, perform a real-time fluorescent RPA reaction using the reagents in the kit and collect the fluorescence signal; S3: If the peak time is ≤20 min or the Ct value is ≤38, the sample is positive for psittacosis virus; if the peak time is >20 min or the Ct value is >38, the sample is negative for psittacosis virus.

8. The method for detecting parrot beak feather disease virus for non-diagnostic purposes according to claim 7, characterized in that, The reaction system for the real-time fluorescent RPA reaction consists of the following components: real-time fluorescent RPA reaction powder, rehydration buffer, magnesium acetate, forward primer, reverse primer, probe, DNA template, and ddH2O in a mass-to-volume ratio of 15 mg: 29.5 μL: 2.5 μL: 1.2 μL: 1.2 μL: 0.6 μL: 2 μL: 13 μL.

9. The method for detecting parrot beak feather disease virus for non-diagnostic purposes according to claim 8, characterized in that, The concentrations of both the forward and reverse primers are 5-20 μmol / L; the concentrations of both probes are 5-20 μmol / L.

10. The method for detecting parrot beak feather disease virus for non-diagnostic purposes according to claim 7, characterized in that, The reaction program for the real-time fluorescent RPA reaction is: 41℃ for 60 s; 41℃ for 30 s, for 40 cycles.

Images