Oligonucleotide linker containing RNA bar code and application of oligonucleotide linker

Abstract

The invention relates to the field of sequencing, in particular to an oligonucleotide connector containing an RNA bar code and application of the oligonucleotide connector. By using the oligonucleotide linker provided by the invention, multiple biological samples can be simultaneously sequenced in one chip, and extremely-low initial amount total RNA (Ribonucleic Acid) and even single cell level DRS (Dead Respiratory Syndrome) sequencing of a single sample can also be realized; the requirement on the initial quantity of RNA samples is reduced, and a powerful tool is provided for detecting rare samples or micro / trace RNA.

Description

Technical Field

[0001] This invention relates to the field of sequencing, specifically to a multiplex mixed-sample direct RNA nanopore sequencing method, and more specifically to an oligonucleotide adapter containing RNA barcodes and its applications. Background Technology

[0002] Exemplary nanopore-based platforms include direct RNA sequencing (DRS), a nanopore-based technology that can simultaneously resolve sample mRNA abundance, RNA isoforms, UTR, and Poly(A) tail length without enzyme conversion steps. It can also detect RNA single-base modifications (such as m6A, m5C, and pseudouridine ψ), and has broad application prospects in solving human disease diagnosis and biomarker development.

[0003] Currently, direct RNA sequencing products require a large initial sample volume, with the template amount for sequencing library construction requiring at least 1 μg of total RNA or 300 ng of polyA RNA. This cannot meet the sequencing needs of extremely small amounts (<1 ng of total RNA) or even single-cell RNA. Moreover, for most sequencing samples, 20M reads is far from sufficient, as a single chip can only sequence a single sample, resulting in a significant waste of data and increased economic costs.

[0004] Multi-barcode pooling labeling strategies can effectively overcome these shortcomings. Currently, there are a few reports on multi-sample pooling labeling techniques for direct RNA sequencing in nanopores. For example, the DeePlexiCon method uses double-stranded DNA RTA containing 18 deoxynucleotide tags (barcodes) for DRS library construction and sequencing, and accurately classifies the raw nanopore signal data by converting current intensity into an image or pixel array, then uses a deep learning algorithm for classification. This method can achieve classification of 93% of the readings with 95.1% accuracy, or 60% of the readings with 99.9% accuracy. However, this method requires significant computational resources (e.g., GPUs) to achieve a reasonable runtime. Although only four barcodes are used, inherent variations in dwell time can produce inconsistent signal transformation images, leading to serious misclassification. Additionally, a connector tag demultiplexing method, the WarpDemuX method, has been reported in the prior art. Compared to the DeePlexiCon method, WarpDemuX significantly improves the processing speed and recognition accuracy of raw nanopore signals by using lightweight machine learning algorithms and an optimized tag set.

[0005] It is worth noting that the multi-sample pooled tags in both studies mentioned above were DNA base sequences, while the ONT DRS electro-base recognition model was trained based on RNA electro-base information and does not support DNA electro-base conversion. To obtain DNA tag base information, these two studies constructed their own electro-base recognition models. The models built in both studies are only applicable to the DNA tag sets and DRS chip versions (SQK-RNA001 and SQK-RNA002) used in the studies. If new tags are added or new DRS chips are used, new signal base recognition models need to be constructed, which greatly limits the scalability and universality of these methods.

[0006] Therefore, there is an urgent need for a mixed labeling method that is more compatible with single-molecule sequencing platforms, such as nanopore direct RNA sequencing platforms, and is more efficient and scalable, in order to achieve multi-sample mixed sequencing, reduce the initial sample volume, and reduce the time and economic costs of sequencing a single sample. Summary of the Invention

[0007] To address at least one of the above-mentioned problems, this disclosure provides an oligonucleotide adapter containing an RNA barcode and its applications. Using the oligonucleotide adapter provided in this disclosure enables pooled sequencing, as well as direct sequencing of trace, extremely trace, or even single-cell RNA.

[0008] According to one aspect of this disclosure, an oligonucleotide adapter is provided, the oligonucleotide adapter comprising a first single strand, the first single strand comprising, sequentially from the 5' to the 3' end, a 5' DNA adaptor, an RNA barcode and a 3' DNA adaptor.

[0009] In some embodiments, the 5' DNA adaptor and the 3' DNA adaptor are DNA sequences composed of deoxyribonucleotides;

[0010] In some embodiments, the RNA barcode is an RNA sequence composed of nucleotides.

[0011] In some embodiments, the length of the RNA barcode is 6 to 30 nt, for example, 6nt, 7nt, 8nt, 9nt, 10nt, 11nt, 12nt, 13nt, 14nt, 15nt, 16nt, 17nt, 18nt, 19nt, 20nt, 21nt, 22nt, 23nt, 24nt, 25nt, 26nt, 27nt, 28nt, 29nt, or 30nt.

[0012] In some implementations, the RNA barcode is 10–28 nt.

[0013] In some embodiments, the 5' DNA adaptor is 1 to 10 nt in length, for example, 1 nt, 2 nt, 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, or 10 nt. In some embodiments, the 5' DNA adaptor is 2 to 5 nt.

[0014] In some embodiments, the length of the 3' end DNA adaptor includes 1 to 20 nt, for example 1 nt, 2 nt, 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt or 20 nt.

[0015] In some embodiments, the length of the 3' end DNA adaptor includes 5 to 15 nt.

[0016] In some embodiments, the 5' DNA adaptor has a DNA sequence as shown in TCC, or a DNA sequence with equivalent function formed by replacing, deleting, or adding one or more deoxynucleotides.

[0017] In some embodiments, the 3' end DNA adaptor has a DNA sequence as shown in SEQ ID NO:4, or a DNA sequence with equivalent function formed by replacing, deleting, or adding one or more deoxynucleotides.

[0018] In some embodiments, the first single strand has an RNA / DNA hybrid sequence as shown in SEQ ID NO:1, or an RNA / DNA hybrid sequence with equivalent function formed by substitution, deletion or addition of one or more nucleotides or deoxynucleotides.

[0019] In some specific embodiments, the first single strand has an RNA / DNA hybrid sequence as shown in SEQ ID NO:13, 15, 17, 19 or 21, or an RNA / DNA hybrid sequence with equivalent function formed by substitution, deletion or addition of one or more nucleotides or deoxynucleotides.

[0020] In some embodiments, the oligonucleotide linker further includes a second single strand comprising: a complementary sequence that is partially complementary to the first single strand; optionally, a 3' oligo(dT / dU) sequence; and / or a 5' non-complementary sequence.

[0021] In some embodiments, the second single strand is a DNA sequence, an RNA sequence, or an RNA / DNA hybrid sequence, or a modified DNA sequence, RNA sequence, or DNA / RNA hybrid sequence, preferably a DNA sequence.

[0022] In some embodiments, the complementary sequence includes a sequence complementary to the 5' DNA adaptor and / or the RNA barcode.

[0023] In some embodiments, the complementary sequence has a DNA sequence as shown in SEQ ID NO:6, or a DNA sequence with equivalent function formed by substitution, deletion or addition of one or more deoxynucleotides.

[0024] In some embodiments, the length of the 5' non-complementary sequence is 1 to 30 nt, for example, 1 nt, 2 nt, 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, 26 nt, 27 nt, 28 nt, 29 nt, or 30 nt. In some embodiments, the length of the 5' non-complementary sequence is 10 to 20 nt.

[0025] In some embodiments, the length of the 3' end oligo(dT / dU) sequence is 1 to 30 nt, for example, 1 nt, 2 nt, 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, 26 nt, 27 nt, 28 nt, 29 nt, or 30 nt. In some embodiments, the oligo(dT / dU) sequence is 2 to 20 nt.

[0026] In some embodiments, the non-complementary sequence has a DNA sequence as shown in SEQ ID NO:5, or a DNA sequence with equivalent function formed by substitution, deletion or addition of one or more deoxynucleotides.

[0027] In some embodiments, the second single strand sequentially includes a 5' non-complementary sequence, a complementary sequence, and a 3' oligo(dT / dU) sequence from the 5' to the 3' ends.

[0028] In some embodiments, the second single strand has a DNA sequence as shown in SEQ ID NO:2, or a DNA sequence with equivalent function formed by replacing, deleting, or adding one or more deoxynucleotides.

[0029] In some specific embodiments, the second single strand has a DNA sequence as shown in SEQ ID NO:14, 16, 18, 20, 22 or 24, or a DNA sequence with equivalent function formed by replacing, deleting or adding one or more nucleotides or deoxynucleotides.

[0030] In some embodiments, the double-stranded structure formed by the first single strand and the second single strand includes a mismatched polynucleotide region, an inverse complementary region, and a Poly(dT / dU) sequence with protruding ends.

[0031] In some embodiments, the reverse complementary region includes the 5' end DNA adaptor and RNA barcode of the first single strand, and the complementary sequence of the second single strand.

[0032] In some embodiments, the mismatched polynucleotide region includes the 3' end DNA adaptor of the first single strand and the 5' end non-complementary sequence of the second single strand.

[0033] According to another aspect of this disclosure, a kit is provided that includes the oligonucleotide adapters described in this disclosure.

[0034] According to another aspect of this disclosure, a method for constructing a library is provided, the method comprising the step of linking a nucleic acid to be tested to one or more oligonucleotide adapters as described in this disclosure.

[0035] In some embodiments, the method includes the steps of: ligating the nucleic acids to be tested from n samples to the oligonucleotide adapters containing n types of the RNA barcodes, respectively, to obtain ligation products and mixing them, where n is an integer ≥1.

[0036] In some implementations, the nucleic acid to be tested is RNA.

[0037] In some embodiments, the sample includes multiple cells, single cells, tissues, tumor samples, or any combination thereof.

[0038] In some embodiments, the single cell includes a fertilized egg.

[0039] In some embodiments, the tissue includes an embryo.

[0040] In some implementations, the single cell includes circulating tumor cells.

[0041] In some embodiments, the edit distance between any two RNA barcodes of the n types of RNA barcodes is ≥6nt, ≥7nt, ≥8nt, ≥9nt, ≥10nt, ≥11nt, ≥12nt, ≥13nt, ≥14nt, ≥15nt, ≥16nt, ≥17nt, ≥18nt, or ≥7nt.

[0042] According to another aspect of this disclosure, a sequencing method is provided, the method comprising the steps of constructing a library using the oligonucleotide adapters described in this disclosure and sequencing the library.

[0043] In some embodiments, the method includes the following specific steps:

[0044] 1) The nucleic acids to be tested from n samples are respectively ligated with the oligonucleotide adapters containing n kinds of RNA barcode sequences to obtain ligation products, such that the nucleic acids to be tested from different samples carry different RNA barcode sequences, and the nucleic acids to be tested from the same sample carry the same RNA barcode sequence, and the ligation products with n kinds of RNA barcode sequences are mixed; optionally, when the nucleic acid to be tested is RNA, the ligation products are further reverse transcribed to synthesize cDNA to obtain a reverse transcription product (RNA-DNA hybrid double strand);

[0045] 2) The ligation product or reverse transcription product obtained in step 1) is further ligated with sequencing adapters to construct sequencing structures. The sequencing structures corresponding to the nucleic acids to be tested from the n samples are sequenced and the corresponding current signal data is extracted. The current signal data of the RNA barcode sequence is segmented and the sequence information of the RNA barcode sequence is obtained, thereby obtaining the classification information of the nucleic acids to be tested from the n samples. The RNA barcode sequence is specific to the nucleic acid to be tested in each sample.

[0046] In some embodiments, step 2) includes performing nanopore sequencing on the sequencing structures corresponding to the nucleic acids to be tested from n samples on the same sequencing chip.

[0047] In some embodiments, the sequencing method further includes a step of splitting sequencing data based on RNA barcodes. For example, sequencing data with the same RNA barcode are split into the same sample, and data with different RNA barcodes are split into different samples.

[0048] According to another aspect of this disclosure, the use of the oligonucleotide linkers described herein in one or more of the following is provided:

[0049] 1) Nucleic acid barcoding; 2) Library construction; 3) Sequencing; 4) Preparation of reagents or kits for detecting genes and their mutations or identifying microorganisms; 5) Biomarking of samples; 6) Splitting of sample test data.

[0050] In some embodiments, the sequencing includes, exemplarily, single-molecule sequencing, exon or exome sequencing, intron sequencing, electron microscopy-based sequencing, microarray sequencing, transistor-mediated sequencing, direct sequencing, random shotgun sequencing, Sanger dideoxy termination sequencing, whole-genome sequencing, hybridization sequencing, pyrosequencing, capillary electrophoresis, double-strand sequencing, cyclic sequencing, single-base extension sequencing, parallel bead arrays, electronic microchips, biochips, microarrays, parallel microchips, solid-phase sequencing, high-throughput sequencing, massively parallel signature sequencing, emulsion PCR, low denaturing temperature co-amplification PCR (COLD-PCR), multiplex PCR, reversible dye terminator sequencing, paired-end sequencing, near-term sequencing, exonuclease sequencing, ligation sequencing, short-read sequencing, single-molecule sequencing, synthetic sequencing, real-time sequencing, reverse terminator sequencing, nanopore sequencing, 454 sequencing, Solexa genome analyzer sequencing, SOLiD™ sequencing, MS-PET sequencing, and combinations thereof.

[0051] In some implementations, the sequencing includes targeted sequencing, genome sequencing, transcriptome sequencing, or single-cell sequencing, such as metagenomic sequencing, metaviromome sequencing, epitranscriptome sequencing, spatial transcriptome sequencing, multi-sample parallel sequencing, rare sample sequencing, or trace / trace nucleic acid sequencing.

[0052] In some embodiments, the single-cell sequencing includes single-cell RNA sequencing and / or single-cell DNA sequencing.

[0053] In some embodiments, the single-molecule sequencing includes nanopore or nanosphere-based sequencing or SMRT sequencing, as well as other amplification-free sequencing methods. In some embodiments, the nanopore typically comprises a solid-state nanopore or a biological nanopore. In some embodiments, the nanopore sequencing includes nanopore strand sequencing, exonuclease-based nanopore sequencing, and nanopore sequencing-by-synthesis (SBS) methods.

[0054] In some implementations, the sequencing includes direct RNA sequencing, as well as other sequencing methods that can directly identify RNA.

[0055] In some embodiments, the platform for direct RNA sequencing includes the ONT direct RNA sequencing platform, such as the SQK-RNA002 or SQK-RNA004 sequencing platform.

[0056] In some implementations, the detection includes early screening, diagnosis, dynamic monitoring, prediction, or assessment of prognosis for genes or their mutations.

[0057] In some implementations, the biomarker includes multi-sample pool markers or micro-sample markers.

[0058] Beneficial effects:

[0059] The oligonucleotide adapters disclosed herein introduce RNA barcodes as barcodes, enabling mixed-sample sequencing. A single library (one chip) can contain multiple samples, thus significantly reducing the economic and time costs of sequencing each sample. It also enables DRS sequencing at extremely low starting amounts of total RNA in a single sample, and even at the single-cell level; reducing the starting amount requirements for RNA samples and providing a powerful tool for the detection of rare samples or trace / ultra-quantitative RNA.

[0060] The oligonucleotide adapters provided in this disclosure are also compatible with kits and experimental procedures for single-molecule sequencing, such as direct RNA sequencing. RNA barcode tags can be directly recognized by the ONT base electrical signal recognition model without the need to establish a new model for barcode recognition. Furthermore, the types of RNA barcodes are extensible, thus this method has broader applicability. It also overcomes the challenges of high sample input, difficulty in scalability of mixed samples, and high cost faced by ONT direct RNA sequencing. Attached Figure Description

[0061] Figure 1 The principle of library construction using RTA adapters containing RNA barcodes is illustrated.

[0062] Figure 2 A schematic diagram of the structure using an RTA adapter containing RNA barcode is shown. Detailed Implementation

[0063] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention in any way. Furthermore, descriptions of well-known structures and techniques are omitted in the following description to avoid unnecessarily obscuring the concepts of this disclosure. Such structures and techniques have also been described in many publications.

[0064] Multi-barcode direct RNA sequencing based on the ONT platform has been reported, for example, by introducing DNA barcodes into the first-round sequencing adapter (RTA) structure to achieve multi-RNA mixed sequencing. However, since the ONT's RNA base electrical signal recognition model cannot accurately recognize DNA barcode electrical signals, this strategy requires the establishment of a new base electrical signal recognition model to identify DNA barcode information, which greatly limits the versatility and scalability of the method.

[0065] This disclosure introduces an ONT-compatible RNA barcode sequence in the middle of the first-round sequencing adapter (RTA) structure, while the two ends remain DNA sequences, such as... Figure 1 As shown, no changes to experimental procedures or replacement of reagents or equipment are required. During DRS sequencing, the model can directly convert RNA barcode electrical signals into base types without additional graphical training to build a new model. Then, the barcode base information is used to split data from different samples. Therefore, the method provided in this disclosure is more compatible with the ONT platform and has greater universality and scalability.

[0066] The oligonucleotide linker structure described in this invention is as follows: Figure 2 As shown. Each oligonucleotide linker (RTA) consists of forward strands and reverse strands. The forward strand, aligned 5' to 3', includes a forward complementary sequence and a 3' DNA adaptor attached to the posterior end of the forward complementary sequence. In some embodiments, the forward complementary sequence, aligned 5' to 3', includes a 5' DNA adaptor and an RNA barcode, wherein the RNA barcode is composed of random nucleotides randomly selected from A, U, C, and G. The reverse strand, aligned 5' to 3', includes a 5' non-complementary region, a reverse complementary sequence, and an oligo(dT) sequence (e.g., 10-30 repeating T sequences) attached to its posterior end. Part or all of the forward complementary sequence in the forward strand is reverse complementary to the reverse complementary sequence in the reverse strand, and the 5' non-complementary region of the reverse strand is not complementary to the forward strand. The forward and reverse strand sequences of the RTA are hybridized and assembled into a double-stranded structure. Based on the base pairing principle, the RTA of a double-stranded structure includes a mismatched multinucleotide region, an inverse complementary sequence, and an oligo(dT) sequence at the overhanging end. Next, the assembled double-stranded structure is captured and hybridized with the target RNA sequence containing the oligo(dT) sequence, followed by reverse transcription to form an RNA / DNA hybrid double-stranded structure. Then, the RNA / DNA hybrid double-stranded structure is ligated to the ONT sequencing RLA adapter to form the complete sequencing structure.

[0067] In some implementations, the edit distance between any RNA barcodes is not less than 12 nt, making it sufficient for DRS data splitting.

[0068] The mixed labeling method for direct RNA sequencing disclosed herein introduces RNA bars in the middle of the RTA adapter linked to RNA, flanked by DNA sequences, which can reduce the risk of degradation by RNA exonucleases in the environment or experimental system. Since the synthesis cost of RNA bases is higher than that of DNA bases, using RNA only in the barcode sequence also reduces experimental costs.

[0069] This adapter is compatible with direct RNA sequencing kits and experimental procedures. RNA barcode tags can be directly recognized by the ONT base electrical signal recognition model without the need to build a new model for recognizing barcodes. At the same time, the types of RNA barcodes are extensible, so this method has broader applicability.

[0070] Using the methods provided in this disclosure, DRS sequencing can be achieved with extremely low starting amounts of total RNA (less than 1 ng) in a single sample, or even at the single-cell level; this reduces the starting amount requirement for RNA samples and provides a powerful tool for the detection of rare samples or trace amounts of RNA.

[0071] The method provided in this disclosure adds RNA barcode and combines it with DRS library construction, allowing a single library (one chip) to contain multiple samples, which greatly saves the economic and time costs of sequencing each sample.

[0072] definition

[0073] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly used in the field to which this invention pertains. For the purposes of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural forms, and vice versa.

[0074] Unless the context clearly indicates otherwise, the terms “a” and “an” as used in this disclosure include plural references.

[0075] The term "about" as used in this disclosure is as understood by one of ordinary skill in the art and varies within a range depending on the context in which it is used. If one of ordinary skill in the art is unfamiliar with the use of this term in the context in which it is used, "about" will mean a particular value plus or minus 10%.

[0076] In this disclosure, the term "nucleic acid" generally refers to a monomeric or polymeric form of a nucleotide of any length, which is a deoxyribonucleotide or ribonucleotide, or an analogue or variant thereof. A nucleic acid molecule may include one or more unmodified or modified nucleotides. Nucleic acids can have any three-dimensional structure or any length and can perform any known or unknown function. The following are non-limiting examples of nucleic acids: ribonucleic acid (RNA), deoxyribonucleic acid (DNA), RNA / DNA hybrids, coding or non-coding regions of genes or gene fragments, loci defined by linkage analysis (locuses), exons, introns, messenger RNA (mRNA), transfer RNA (RNA), ribosomal RNA, short interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), ribozymes, complementary deoxyribonucleic acid (cDNA), recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. Nucleic acids may comprise one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs, such as peptide nucleic acids (PNA), morpholino and locked nucleic acids (LNA), ethylene glycol nucleic acids (GNA), threonine nucleic acids (TNA), 2'-fluoro, 2'-OMe, and thiophosphorylated DNA. Nucleic acids may include one or more subunits selected from adenosine (A), cytosine (C), guanine (G), thymine (T), and uracil (U), or variants thereof. In some embodiments, the nucleic acid is DNA or RNA or a derivative thereof. Nucleic acids may be single-stranded or double-stranded. Nucleic acids may be cyclic. In some embodiments, the nucleic acid may include one or more synthetic nucleotides. Any synthetic nucleotide known in the art includes peptide nucleic acids (PNA), glycerol nucleic acids (GNA), threonine nucleic acids (TNA), locked nucleic acids (LNA), or other synthetic polymers having nucleotide side chains. In some embodiments, the RNA / DNA hybrid may comprise DNA and RNA on the same strand. Preferably, the RNA / DNA hybrid comprises a DNA strand hybridized to the RNA strand. Nucleic acids are associated with diseases and / or microorganisms. In some instances, nucleic acids can include modified nucleic acids, such as chemical and enzymatic modifications, including phosphorylation, biotin, digoxigenin, glycosylation, internal amino groups, 5' amino groups, 3' amino groups, thiols, thioates, methylation, deoxyuridine (dU), and deoxyinosine (dI).

[0077] In this disclosure, the term "RNA," short for "ribonucleic acid" (RNA), is one of the four biological macromolecules found in living cells—a type of nucleic acid. RNA is a large polymer of nucleotides. Nucleotides consist of a base, a sugar, and a phosphate group. There are four bases: adenine (A), guanine (G), uracil (C), and cytosine (C). The length of RNA can vary from 10 nucleotides to 15,000, such as 40-15,000, 100-12,000, or 200-10,000 nucleotides. In some embodiments, the RNA is mRNA associated with RNA transcripts encoding peptides or proteins. As established in the art, mRNA generally contains a 5' untranslated region (5'-UTR), a peptide-coding region, and a 3' untranslated region (3'-UTR). Eukaryotic mRNA typically has a 5' cap structure and a 3' poly(A) tail structure. "polyA" refers to a polyadenylated nucleotide sequence, which can range in length from tens to hundreds of nucleotides.

[0078] In this disclosure, the term "Oligo(dT)" refers to a nucleotide sequence consisting of consecutive deoxythymidine nucleotides used for partial or complete base pairing with poly(A) at the 3' end of mRNA.

[0079] In this disclosure, the term "total RNA" includes messenger RNA (mRNA, RNA that carries information from DNA to the ribosome site for protein synthesis in cells where it is translated into protein), transfer RNA (tRNA, a small RNA chain that transfers specific amino acids to the growing polypeptide chain during protein translation), ribosomal RNA (rRNA), and non-coding RNA (also called RNA genes or small RNAs, referring to genes that encode RNA that is not translated into protein), as well as pre-RNA in precursor form. RNA is a large polymer of nucleotides. Nucleotides are composed of a base, a sugar, and a phosphate group. There are four types of bases: adenine (A), guanine (G), uracil (U), and cytosine (C).

[0080] In this disclosure, the term "DNA," short for "deoxyribonucleic acid," is one of the four major biological macromolecules found in living cells—a type of nucleic acid. DNA carries the genetic information necessary for the synthesis of RNA and proteins and is an essential biological macromolecule for the development and normal functioning of organisms. DNA is a large polymer composed of deoxynucleotides. Deoxynucleotides consist of a base, a deoxyribose sugar, and a phosphate group. There are four bases: adenine (A), guanine (G), thymine (T), and cytosine (C).

[0081] In this disclosure, the term "adaptor" refers to an organelle that can covalently attach to the ends of a nucleic acid sequence. In some embodiments, the adaptor can covalently attach to the nucleic acid to be tested. In some embodiments, the adaptor can covalently attach to a linker, such as a linker adapted to a sequencing platform. In some embodiments, the adaptor can covalently attach to the ends of other nucleic acid sequences under the action of a polymerase or ligase. In some embodiments, the adaptor can covalently attach to the ends of a nucleic acid sequence under the action of an enzyme, such as a polymerase or ligase. In some embodiments, there is a gap between the end of the adaptor and the end of the nucleic acid sequence (e.g., the 5' end), which can be filled to covalently attach the end of the adaptor (e.g., the 3' end) and the end of the nucleic acid sequence (e.g., the 5' end). In some embodiments, the end of the adaptor and the end of the nucleic acid sequence can be directly covalently attached.

[0082] In this disclosure, the terms "attachment" or "linkage" refer to the joining of two molecules in any manner. For example, attachment can refer to joining two molecules by chemical bonds or other methods to produce a new molecule. Attaching a linker or adaptor to a nucleic acid can form a chemical bond between the adaptor and the nucleic acid. In some cases, attachment is performed by an enzymatic or chemical reaction, such as using a ligase. For example, a nucleic acid adaptor can be attached to a target nucleic acid by forming a phosphodiester bond catalyzed by a ligase. In some cases, a primer extension reaction can be used to attach an adaptor to a target nucleic acid (or a copy thereof).

[0083] In this disclosure, the term "barcodes" generally refers to an identification feature that can be used to distinguish similar items. A barcode may contain a nucleic acid molecule having about 8 to about 30 bases (e.g., 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases), which can provide a unique identifier tag or origin information for molecules (e.g., proteins, polypeptides, peptides), binding agents, binding agent sets from binding cycles, sample molecules, sample sets, molecules within compartments (e.g., droplets, beads, partitions, or separated locations), macromolecules within compartment sets, fractions of macromolecules, macromolecule fractional subsets, spatial regions or sets of spatial regions, macromolecule libraries, or binding agent libraries. In some embodiments, each barcode within a group of barcodes is different. In other embodiments, a subset of barcodes in the barcode group are distinct; for example, at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 99% of the barcodes in the barcode group are distinct. The barcode group can be randomly generated or non-randomly generated. Barcodes can be used to compute deconvolutions of sequence reads derived from individual molecules, samples, libraries, etc. Barcodes can contain multiplexing information, for example, generated from different samples, compartments, individual molecules, etc. Barcodes can also be used to deconvolve assemblies of molecules already distributed into small compartments for enhanced mapping. Barcodes can contain any useful structural portions or motifs, such as hairpins, loop sequences, or spacer regions. Barcodes may contain artificial or modified nucleic acids, such as locked nucleic acids (LNA), protein nucleic acids (PNA), hexitol nucleic acids (HNA), cyclohexane nucleic acids (CeNA), or combinations thereof. Barcodes may contain proteins (e.g., Tal effector factors, Cas proteins (e.g., Cas9), Argonaut, or coil-and-coil) or be generated using proteins.

[0084] In this disclosure, the term "random nucleotide" should be understood as each nucleotide having an independent and equal probability of being any nucleotide. Examples include dG, dA, dC, dT, G, A, C, U, or their chemical analogs, wherein: dG represents guanine deoxyribonucleotide, dA represents adenine deoxyribonucleotide, dC represents cytosine deoxyribonucleotide, dT represents thymine deoxyribonucleotide, G represents guanine ribonucleotide, A represents adenine ribonucleotide, C represents cytosine ribonucleotide, and U represents uracil ribonucleotide. The sequence of random nucleotides can have any order. In some embodiments, the random nucleotides include only G, A, C, U, or their chemical analogs.

[0085] In this disclosure, the term "complementary" refers to the concept of sequence complementarity between regions of two polynucleotide chains or between two regions of the same polynucleotide chain. It is known that an adenine base in a first region of a polynucleotide chain can form a specific hydrogen bond ("base pair") with a base in a second region of a polynucleotide chain that is antiparallel complementary to the first region (if the base is thymine or uracil). Similarly, it is known that a cytosine base in a first polynucleotide chain can pair with a base in a second polynucleotide chain that is antiparallel complementary to the first region (if the base is guanine). The two regions are complementary if at least one nucleotide in the first region can pair with a base in the second region when the first region of the polynucleotide is arranged in an antiparallel complementary manner with a second region of the same or different polynucleotide. Therefore, two complementary polynucleotide chains do not need to pair at every nucleotide position. "Complementary" means that the first polynucleotide chain and the second polynucleotide chain are 100% or "completely" complementary, and therefore form a base pair at every nucleotide site. "Complementary" also refers to a first polynucleotide chain that is not 100% complementary (e.g., 90%, 80%, or 70% complementary) and contains mismatched nucleotides at one or more nucleotide positions. In one embodiment, two complementary polynucleotide chains are capable of hybridizing with each other under highly stringent hybridization conditions.

[0086] In this disclosure, the term "strict hybridization conditions" is defined as conditions that, empirically determined, allow a probe or primer to specifically hybridize with a target sequence without specifically hybridizing with non-target sequences. The term "strict hybridization conditions" are functionally defined in relation to the hybridization of nucleic acid probes with target nucleic acids (i.e., with specific target nucleic acid sequences) using the specific hybridization methods discussed in Sambrook et al., 1989, 9.52-9.55. See also Sambrook et al., 1989, 9.47-9.52, 9.56-9.58; Kanehisa 1984, Nucl. Acids Res. 12: 203-213; and Wetmur et al. 1968, J. Mol. Biol. 31: 349-370. Appropriate strict hybridization conditions that promote DNA hybridization are known to those skilled in the art.

[0087] In this disclosure, the term "sequencing" refers to the process of determining the sequence (e.g., identity and order of monomeric units) of a biomolecule, such as a nucleic acid, like DNA or RNA. In some cases, oligonucleotide adapters may be attached to nucleic acid molecules. Any number of useful preparative operations can be performed, such as purification or enrichment, cleansing, nucleic acid reactions (e.g., ligation, extension, amplification, tagging, restriction enzyme cleavage), fragmentation, barcoding, adapter addition, enzyme treatment, etc. Exemplary sequencing methods include, but are not limited to, targeted sequencing, single-molecule real-time sequencing, exon or exome sequencing, intron sequencing, electron microscopy-based sequencing, panel sequencing, transistor-mediated sequencing, direct sequencing, random shotgun sequencing, Sanger dideoxy termination sequencing, whole genome sequencing, hybridization sequencing, pyrosequencing, capillary electrophoresis, double-strand sequencing, cyclic sequencing, single-base extension sequencing, parallel bead arrays, electronic microchips, "biochips," microarrays, parallel microchips, solid-phase sequencing, high-throughput sequencing, massively parallel signature sequencing, emulsion PCR, low denaturing temperature co-amplification PCR (COLD-PCR), multiplex PCR, reversible dye terminator sequencing, paired-end sequencing, and near-terminal sequencing. Sequencing methods include: exonuclease sequencing, ligation sequencing, short read sequencing, single-molecule sequencing, synthetic sequencing, real-time sequencing, reverse terminator sequencing, nanopore sequencing, 454 sequencing, Solexa genome analyzer sequencing, SOLiD™ sequencing, MS-PET sequencing, DNA nanosphere sequencing (DNBSEQ), complex probe anchored polymerization sequencing (cPAS), and combinations thereof. In some implementations, nanopore systems (e.g., Oxford Nanopore Technologies, Genia Technologies, NobleGen, or Quantum Biosystems) or other sequencing and next-generation sequencing systems (e.g., Illumina, BGI, Qiagen, Thermo Fisher, PacBio, and Roche) can be used. In some implementations, sequencing can be performed using a gene analyzer, such as those commercially available from Illumina, Inc., Pacific Biosciences, Inc., Applied Biosystems / Thermo Fisher Scientific, or BGI Genomics Co., Ltd., etc.For example, BGI's DNBseq sequencing platforms include BGISEQ-500, BGISEQ-50, MGISEQ-2000, MGISEQ-200, DNBSEQ-T7, DNBSEQ-G99, and DNBSEQ-T20X2, or Illumina's HiSeq2000, HiSeq2500, HiSeq4000, HiSeqX10, and NovaSeq6000.

[0088] As used in this disclosure, the term "single-cell sequencing" refers to sequencing the genome / transcriptome of a single cell. A single cell is the basic structural and functional unit of an organism. Under the same external stimuli or physiological conditions, cells originating from the same cell type may exhibit intercellular differences, i.e., heterogeneity. Heteroplasmy exists among the cells that make up, for example, the brain, the blood system, and the immune system. If multiple different single cells can be selected from a tissue system for study, valuable information about the various single cells within that tissue can be provided.

[0089] As used in this disclosure, the term "nanopore" means a hollow structure isolated from and extending through a membrane, allowing ions, currents, and / or fluids to pass from one side of the membrane to the other. For example, a membrane that suppresses channels for ions or water-soluble molecules may include a nanopore structure extending through the membrane, allowing ions or water-soluble molecules to pass from one side of the membrane to the other. The diameter of a nanopore may vary along its length (i.e., from one side of the membrane to the other), but is nanoscale (i.e., about 1 nm to 100 nm) at any point. Examples of nanopores include, for example, biological nanopores, solid-state nanopores, and biological and solid-state hybrid nanopores. A biological nanopore means a nanopore whose structural portion is made of biologically derived material. Biologically derived means material derived from or isolated from a biological environment, such as an organism or cell, or a synthetically manufactured version of a biologically available structure. Biological nanopores include, for example, peptide nanopores and polynucleotide nanopores. A solid-state nanopore is intended to mean a nanopore whose structural portion includes non-biologically derived (i.e., not biologically derived) material. Solid-state nanopores can be formed from inorganic or organic materials. Solid-state nanopores include, for example, silicon nitride nanopores, silicon dioxide (SiO2) nanopores, and graphene nanopores.

[0090] As used in this disclosure, the term "nanopore sequencing" refers to immersing a nanopore in one or more electrolyte examples disclosed in this disclosure and applying a potential difference across the membrane. In one example, the potential difference is an electrical potential difference or an electrochemical potential difference. The electrical potential difference can be imposed across the membrane via a voltage source that injects or imparts current to at least one ion of the electrolyte contained in a cis-pore or one or more trans-pores. The electrochemical potential difference can be established by a combination of differences in the ionic composition of the cis-pore and trans-pore and the electrical potential. Different ionic compositions can be, for example, different ions in each pore, or different concentrations of the same ion in each pore. In some embodiments, the nanopore sequencing includes nanopore strand sequencing, in which DNA bases are identified as they pass sequentially through the nanopore; exonuclease-based nanopore sequencing, in which nucleotides are enzymatically cleaved one after another from DNA molecules and monitored as they are captured by the nanopore and pass through it; and nanopore sequencing-by-synthesis (SBS) methods, in which identifiable polymer tags are attached to nucleotides and recorded in the nanopore during enzyme-catalyzed DNA synthesis.

[0091] In this disclosure, the terms "direct RNA sequencing (DRS)" or "nanopore direct RNA sequencing" refer to the reverse transcription of single-stranded mRNA into a double-stranded RNA-cDNA. The RNA / cDNA double strands can directly bind to and unwind nanopore proteins embedded in a synthetic polymer membrane under the traction of motor proteins. Under the influence of a voltage difference across the membrane, the RNA strand passes through the nanopore channel protein at a specific rate, initiating direct RNA sequencing. Because different bases on the RNA strand have different chemical properties, each base passing through the nanopore channel will cause different changes in electrical signals. Based on the magnitude and changes in current, a complex algorithm using a recurrent neural network (RNN) is used to interpret the bases, thereby calculating the type of each base and obtaining base modification information. The library construction prior to sequencing includes: annealing and ligating an RTA adapter (DNARTAdapter) with an oligo(dT) end to the poly(A) tail of mRNA; followed by an optional reverse transcription operation to improve sequencing throughput and RNA single-strand stability; finally, adding a sequencing adapter with a molecular motor (also known as an RMX adapter or RLA adapter, RNA sequencing adapter or RNA Ligation Adapter) for subsequent sequencing. Direct RNA sequencing technology is based on the Nanopore sequencing platform, directly reading full-length transcripts without reverse transcription or amplification, and without sequencing bias. It can directly detect single modification sites such as RNA methylation (m6A, m5C, and pseudouridine ψ); accurately analyze alternative splicing, fusion genes, and identify novel isoforms; resolve sample mRNA abundance; and, in addition, provide relatively accurate estimation of poly(A) tail length, reconstructing RNA characteristics. Direct RNA sequencing differs from traditional RNA sequencing workflows, which involve reverse transcription of RNA into cDNA, PCR amplification, and then library construction and sequencing. It eliminates the RNA / cDNA double-strand conversion to DNA double-strand conversion and PCR amplification, allowing direct sequencing of mRNA to obtain its sequence and base modification information. This has broad application prospects in areas such as human disease diagnosis and biomarker development.

[0092] The term "edit distance" should be understood as the minimum number of single nucleotide / amino acid substitutions, insertions, or deletions required to change one nucleotide / amino acid sequence to the other relative to any two nucleotide / amino acid sequences being compared.

[0093] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention in any way. The actual scope of protection of this invention is set forth in the claims. In the following description, descriptions of well-known structures and techniques are omitted to avoid unnecessarily obscuring the concepts of this disclosure. Such structures and techniques have also been described in many publications. Unless otherwise specified, the equipment, instruments, reagents, and / or kits used in the following embodiments are commercially available or obtained through conventional methods known to those skilled in the art.

[0094] Example

[0095] Example 1: Synthesis and Assembly of Custom RTAs

[0096] 1. Barcode design and synthesis

[0097] The oligonucleotide linker design used in this embodiment is as follows: Figure 2 As shown, the forward strand BC-F of the adapter has an RNA-DNA hybrid sequence as shown in SEQ ID NO:1, wherein consecutive Ns are RNA sequences composed of any number of nucleotides; the reverse strand BC-R has a DNA sequence as shown in SEQ ID NO:2, wherein consecutive Ms are DNA sequences complementary to consecutive Ns. The forward complementary sequence in the forward strand has an RNA / DNA hybrid sequence as shown in SEQ ID NO:3; the 3' DNA adapter sequence has a DNA sequence as shown in SEQ ID NO:4. The 5' non-complementary region in the reverse strand has a DNA sequence as shown in SEQ ID NO:5; the complementary region has a DNA sequence as shown in SEQ ID NO:6, and the sequences are shown in Table 1. The oligonucleotide adapter is formed by annealing BC-F and BC-R.

[0098] Four reverse transcription adapters (RTAs) RTA-01 to RTA-06, as shown in Table 3, were synthesized for example. The RNA barcode sequence contained therein was 24 bp in length, and the corresponding RNA barcode sequences were Barcode-1 to Barcode-6, as shown in Table 2.

[0099] Table 1. Nucleotide sequences of BC-F and BC-R

[0100]

[0101] In Table 1, the underlined sequences are RNA sequences, and the un-underlined sequences are DNA sequences.

[0102] Table 2. Examples of RNA barcode sequences

[0103] SEQIDNO sequence name Nucleic acid sequence (5'-3') 7 Barcode-1 AAGAAAGUUGUCGGUGUCUUUGUG 8 Barcode-2 UCGAUUCCGUUUGUAGUCGUCUGU 9 Barcode-3 GAGUCUUGUGUCCCAGUUACCAGG 10 Barcode-4 UUCGGAUUCUAUCGUGUUUCCCUA 11 Barcode-5 CUUGUCCAGGGUUUGUGUAACCUU 12 Barcode-6 UUCUCGCAAAGGCAGAAAGUAGUC

[0104] Table 2 contains RNA sequences.

[0105] Table 3. Examples of corresponding oligonucleotide linker sequences

[0106]

[0107]

[0108] In Table 3, the underlined sequences are RNA sequences, and the un-underlined sequences are DNA sequences.

[0109] 2. Assembly of Custom RTAs

[0110] The forward and reverse strands of each RTA were diluted to 10 μM and 9 μM, respectively, using annealing buffer (10 mM Tris-HCl, pH 7.5, 50 mM NaCl, 0.5 mM EDTA). 5 μL of each was mixed and annealed. An excess of the forward strand was used in this example to ensure complete consumption of the reverse strand, preventing excess reverse strands from competing with the RTA for RNA during subsequent reverse transcription, thus avoiding a reduction in RNA-RTA. The assembly of the custom RTAs was performed according to the following PCR program: denaturation at 98°C for 3 minutes, decreasing by 1°C per minute until reaching 25°C, then holding at 4°C. Storage was then at -80°C. The annealed products can serve as RTAs with different RNA barcodes for direct RNA sequencing in this method.

[0111] Example 2: Pooled-sample direct RNA sequencing workflow

[0112] 1. mRNA capture

[0113] The specific steps for mRNA capture are as follows: First, thoroughly resuspend the mRNA capture magnetic beads (Vazyme N401). Transfer 10 μL of the beads to a 200 μL centrifuge tube and incubate on a magnetic rack for 2 minutes, discarding the supernatant. Add 40 μL of 1×HB buffer (3X SSC, 0.05% Tween-20, 0.01% RRI) to wash the beads, repeating the washing twice. Next, resuspend the beads in 40 μL of 2×HB buffer (6X SSC, 0.05% Tween-20, 0.01% RRI). Add an equal volume of total RNA or cell lysis buffer, gently tumble to mix, briefly centrifuge at low speed, and then incubate in a PCR chamber at 65°C for 5 minutes. Then, rotate on a rotary rack at room temperature for 15 minutes. Incubate on a magnetic rack for 2 minutes, discarding the supernatant. Finally, resuspend the beads in 100 μL of pre-chilled 1×HB buffer, briefly centrifuge at low speed, and incubate on a magnetic rack for 2 minutes, discarding the supernatant. Repeat the washing process once. Add 100 μL of pre-chilled 1×PBS buffer to wash the magnetic beads once. Remove as much supernatant as possible. Add 9 μL of RNase-free water, gently tap to resuspend completely, place in a PCR chamber, incubate at 80°C for 2 minutes, immediately place on ice for 2 minutes, then place on a magnetic rack for 5 minutes. Transfer the supernatant to a new 200 μL centrifuge tube.

[0114] 2. Library construction and sequencing

[0115] Following the operating procedures in the ONT direct RNA sequencing product instructions (SQK-RNA004), the assembled double-stranded adapter was used to capture and ligate the mRNA obtained in the previous step, followed by reverse transcription to form an RNA / DNA hybrid double-stranded structure. This RNA / DNA hybrid double-stranded structure was then ligated to the ONT sequencing RLA adapter to form a complete sequencing structure.

[0116] The specific steps include: ligating RTA adapters to total RNA using NEBNext rapid ligase (NEB M0202M). Incubating at room temperature for 30 minutes. Then, reverse transcription was performed using SuperScriptIV reverse transcriptase (ThermoFisher, 18090050). The reverse transcription products from different RTAs were mixed together and purified using 2×RNAClean XP beads (Beckman, A63987). The purified products were then ligated to RLA adapters using NEBNext rapid ligase (NEB M0202M). Incubating at room temperature for 30 minutes. The reaction mixture was purified using 0.6×RNAClean XP beads (Beckman, A63987), washed twice with WSB buffer, and eluted with elution buffer (EB). The sequencing buffer was then prepared according to the manufacturer's instructions (SQK-RNA004), adjusted to the library volume compatible with the PromethION sequencer. Load the sequencing mixture into the qualified ONT sequencing chip, set the sequencing parameters in the MinKNOW software, and sequence for more than 12 hours to obtain sufficient sequencing data.

[0117] 3. Splitting of pooled direct RNA sequencing data

[0118] After obtaining the barcode-tagged DRS data, ONT's official Dorado software was used with the "--no-trim" parameter set to preserve the sequencing adapter. Basecalling was performed on the raw data, offering three precision modes: fast, high-precision (HAC), and super-high-precision (SUP). Next, the blastn program was used to align the barcode RTA sequences to the re-basecalled DRS reads. The blastn alignment results were filtered based on alignment length greater than 9, barcode RTA 5' end alignment position (s.end) greater than 5, and the e-value. Finally, for each DRS read, the barcode RTA alignment with the lowest e-value was selected as the final splitting result.

[0119] Example 3: Testing two species using two different barcodes

[0120] Total RNA was extracted from HEK293T (human kidney epithelial cell line) and mESC (mouse embryonic stem cells) using an RNA extraction kit (Yeasen 19221ES). 500 ng of total RNA from each HEK293T and mESC was used for mRNA capture. The captured mRNA was ligated into RTA-01 (SEQ ID NO: 13 and 14) and RTA-02 adapters (SEQ ID NO: 15 and 16), respectively. Direct RNA sequencing libraries were prepared according to Example 2, and sequencing and data analysis were performed. The results are shown in Tables 4 and 5.

[0121] Table 4 shows the splitting results of library construction using RTA adapters containing two types of barcodes in the ultra-high precision basecalling mode. Table 5 shows that, with the expected value e-value of barcode RTA alignment < 0.05, the data splitting ratio in the ultra-high precision (sup) basecalling mode reaches 89.2%, and the splitting accuracy reaches 99.7%. This demonstrates that the oligonucleotide adapters provided by this invention can be used for sample pool sequencing.

[0122] The splitting ratio and the splitting accuracy are calculated according to the following steps:

[0123] 1) During the splitting process, the total number of reads to be split is calculated as the sequencing reads that have been definitively aligned (uniquely aligned) to the human genome (hg38 version) or the mouse genome (mm10 version), and are marked as T;

[0124] 2) When the barcode RTA alignment e-value < 0.05, the total number of reads split into RTA-01 and RTA-02 is marked as S;

[0125] 3) When the barcode RTA alignment e-value < 0.05, the number of sequencing reads that are split into RTA-01 and uniquely aligned to the human genome (hg38 version) is marked as A;

[0126] 4) When the barcode RTA alignment e-value < 0.05, the number of sequencing reads that are split into RTA-02 and uniquely aligned to the mouse genome (mm10 version) are marked as B;

[0127] 5) The splitting ratio can be calculated as: (S / T) × 100%;

[0128] 6) The splitting accuracy can be calculated as: (A+B) / S×100%.

[0129] Table 4. Splitting results of database construction using RTA headers with two types of barcodes in ultra-high precision basecalling mode (e-value < 0.05)

[0130] type Number of split reads RTA-01 268379 RTA-02 196153 NA 56216 Total(Total number of reads to be split, T) 520748

[0131] Here, NA indicates that the barcode information is unknown, which means that the preset barcode RTA sequence could not be matched when the barcode RTA alignment e-value < 0.05.

[0132] Table 5. Splitting results of database construction using RTA headers with two types of barcodes under different basecalling modes.

[0133]

[0134]

[0135] Example 4: Testing two species using four different barcodes

[0136] Total RNA was extracted from HEK293T (human renal epithelial cell line) and mESC (mouse embryonic stem cells) using an RNA extraction kit (Yeasen 19221ES). Two 100 ng aliquots of HEK293T total RNA were used for mRNA capture. The captured mRNA was ligated into RTA-01 (SEQ ID NO: 13 and 14) and RTA-02 adapters (SEQ ID NO: 15 and 16), respectively, and then reverse transcribed. Two 100 ng aliquots of mESC total RNA were used for mRNA capture. The captured mRNA was ligated into RTA-03 (SEQ ID NO: 17 and 18) and RTA-04 adapters (SEQ ID NO: 19 and 20), respectively, and then reverse transcribed. The reverse transcription products were mixed and a direct RNA sequencing library was prepared according to Example 2. Sequencing and data analysis were performed. The results are shown in Tables 6 and 7.

[0137] Table 6 shows the splitting results of library construction using RTA adapters containing four barcodes in the ultra-high precision basecalling mode. Table 7 shows that, with barcode RTA alignment e-value < 0.05, the data splitting ratio in the ultra-high precision (sup) basecalling mode reaches 86.6%, and the splitting accuracy reaches 99.4%. This demonstrates that the oligonucleotide adapters provided by this invention can be used for mixed sequencing of low starting sample volumes.

[0138] The splitting ratio and the splitting accuracy are calculated according to the following steps:

[0139] 1) During the splitting process, the total number of reads to be split is calculated as the sequencing reads that uniquely align to the human genome (hg38 version) or the mouse genome (mm10 version), and are marked as T;

[0140] 2) When the barcode RTA alignment e-value < 0.05, the total number of reads for splitting into RTA-01, RTA-02, RTA-03, and RTA-04 is marked as S;

[0141] 3) When the barcode RTA alignment e-value < 0.05, the number of sequencing reads that are split into RTA-01 and RTA-02 and uniquely aligned to the human genome (hg38 version) are marked as A;

[0142] 4) When the barcode RTA alignment e-value < 0.05, the number of sequencing reads that are split into RTA-03 and RTA-04 and uniquely aligned to the mouse genome (mm10 version) are marked as B;

[0143] 5) The splitting ratio can be calculated as: (S / T) × 100%;

[0144] 6) The splitting accuracy can be calculated as: (A+B) / S×100%.

[0145] Table 6. Splitting results of database construction using RTA headers with four barcodes in ultra-high precision basecalling mode (e-value < 0.05)

[0146]

[0147]

[0148] Here, NA indicates that the barcode information is unknown, which means that the preset barcode RTA sequence could not be matched when the barcode RTA alignment e-value < 0.05.

[0149] Table 7. Splitting results of library construction using RTA headers containing 4 types of barcodes

[0150]

[0151] Example 5: Testing micro-samples and single cells using six barcodes

[0152] Three mouse zygote samples, each containing one zygote cell, were collected. Cells were lysed with lysis buffer (4% Triton X-100, 1% RRI, 2mM DTT) and mRNA was captured. The captured mRNAs were ligated into RTA-01 (SEQ ID NO: 13 and 14), RTA-02 (SEQ ID NO: 15 and 16), and RTA-03 adapters (SEQ ID NO: 17 and 18), respectively, followed by reverse transcription. Three mouse 2C stage embryo samples, each containing five 2C stage embryos, were collected. Cells were lysed with lysis buffer and mRNA was captured. The captured mRNAs were ligated into RTA-04 (SEQ ID NO: 19 and 20), RTA-05 (SEQ ID NO: 21 and 22), and RTA-06 adapters (SEQ ID NO: 23 and 24), respectively, followed by reverse transcription. Direct RNA sequencing libraries were prepared, sequencing was performed, and data analysis was conducted as described in Example 2. The results are shown in Table 8.

[0153] Table 8 shows the splitting results of library construction using RTA adapters containing six barcodes in the ultra-high precision basecalling mode. Table 8 shows that, with barcode RTA alignment e-value < 0.05, the data splitting ratio reaches 85% in the ultra-high precision (sup) basecalling mode. This demonstrates that the oligonucleotide adapters provided by this invention can be used for micro-sample or single-cell pooled sequencing.

[0154] The splitting ratio is calculated according to the following steps:

[0155] 1) During the splitting process, the sequencing reads that uniquely align to the mouse genome (mm10 version) are marked as T, based on the total number of reads to be split;

[0156] 2) When the barcode RTA alignment e-value < 0.05, the total number of reads for splitting into RTA-01, RTA-02, RTA-03, RTA-04, RTA-05 and RTA-06 is marked as S;

[0157] 3) The splitting ratio can be calculated as: (S / T) × 100%;

[0158] Table 8. Splitting results of database construction using RTA headers with six barcodes in ultra-high precision basecalling mode (e-value < 0.05)

[0159] type Number of split reads RTA-01 324 RTA-02 630 RTA-03 473 RTA-04 2292 RTA-05 2948 RTA-06 3589 NA 1801 Total (Total number of reads to be split, T) 12057

[0160] NA indicates that the barcode information is unknown, and the preset barcode RTA sequence could not be matched when the e-value of the barcode RTA comparison is less than 0.05.

[0161] The technical solutions of the present invention are not limited to the specific embodiments described above. Any technical modifications made in accordance with the technical solutions of the present invention fall within the protection scope of the present invention.

Claims

1. An oligonucleotide adapter containing an RNA barcode, the oligonucleotide adapter comprising a first single strand, the first single strand comprising, sequentially from the 5' to the 3' end, a 5' DNA adaptor, an RNA barcode, and a 3' DNA adaptor.

2. The oligonucleotide linker according to claim 1, characterized in that, The length of the RNA barcode is 6–30 nt, preferably 10–28 nt, more preferably 24 nt; and / or The 5' DNA adaptor is 1–10 nt, preferably 2–5 nt; more preferably 3 nt; and / or The 3' end DNA adaptor is 1-20 nt, preferably 5-15 nt; more preferably 10 nt.

3. The oligonucleotide linker according to claim 1 or 2, characterized in that, The oligonucleotide linker further includes a second single strand, the second single strand comprising: Complementary sequence, wherein the complementary sequence is complementary to the first single-stranded portion; and Optionally, a 3' oligo (dT / dU) sequence and / or a 5' non-complementary sequence; Preferably, the second single strand is a DNA sequence, an RNA sequence, or a DNA / RNA hybrid sequence, or a modified DNA sequence, RNA sequence, or RNA / DNA hybrid sequence, preferably a DNA sequence.

4. The oligonucleotide linker according to claim 3, characterized in that, The complementary sequence is inversely complementary to a portion or all of the sequence of the 5' end DNA adaptor and / or the RNA barcode of the first single strand.

5. The oligonucleotide linker according to claim 3, characterized in that, The oligo(dT / dU) sequence is 1–30 nt; preferably 2–20 nt; more preferably 10 nt; and / or The length of the 5' end non-complementary sequence is 1 to 30 nt, preferably 10 to 20 nt, and more preferably 19 nt.

6. The oligonucleotide linker according to claim 3, characterized in that, The second single strand includes, from the 5' to the 3' end, a non-complementary sequence at the 5' end, a complementary sequence, and an oligo(dT / dU) sequence at the 3' end.

7. The oligonucleotide linker according to claim 3, characterized in that, The double-stranded structure formed by the first and second single strands includes a mismatched polynucleotide region, an inverse complementary region, and a Poly(dT / dU) sequence at the protruding ends.

8. A kit comprising the oligonucleotide linker according to any one of claims 1 to 7.

9. A method for constructing a library, the method comprising the step of linking a nucleic acid to be tested to one or more oligonucleotide adapters as described in any one of claims 1 to 7.

10. The method according to claim 9, characterized in that, The method includes: ligating the nucleic acids to be tested from n samples to the oligonucleotide adapters containing n types of RNA barcodes, respectively, to obtain ligation products from n samples labeled with n types of RNA barcodes and mixing them, wherein n is an integer ≥1; Preferably, the nucleic acid to be tested is RNA; Preferably, the sample includes multiple cells, single cells, fertilized eggs, tissues, embryos, tumor samples, or any combination thereof; Preferably, the single cell comprises a fertilized egg; Preferably, the tissue comprises an embryo; Optionally, the single cells include circulating tumor cells; Preferably, the edit distance between any two RNA barcodes of the n RNA barcodes is ≥6nt.

11. A sequencing method, the method comprising the steps of constructing a library using the oligonucleotide adapters according to any one of claims 1 to 7 and sequencing the library.

12. The sequencing method according to claim 11, characterized in that, The sequencing method further includes a step of splitting the sequencing data according to the n RNA barcodes, preferably splitting the sequencing data of the n samples.

13. The use of the oligonucleotide linker according to any one of claims 1 to 7 in one or more of the following: 1) Nucleic acid barcoding; 2) Library construction; 3) Sequencing; 4) Prepare reagents or kits for detecting genes and their mutations or identifying microorganisms; 5) Biomarking of samples; 6) Splitting of sample test data.

14. The application according to claim 13, characterized in that, The sequencing includes targeted sequencing, genome sequencing, transcriptome sequencing, or single-cell sequencing, such as metagenomic sequencing, metaviromome sequencing, epitranscriptome sequencing, spatial transcriptome sequencing, single-cell DNA / RNA sequencing, multi-sample parallel sequencing, rare sample sequencing, or trace / trace nucleic acid sequencing. Preferably, the sequencing includes single-molecule sequencing; Preferably, the single-molecule sequencing includes nanopore- or nanosphere-based sequencing or SMRT sequencing; Preferably, the sequencing based on nanopores or nanospheres includes direct RNA sequencing; Preferably, the detection includes early screening, diagnosis, dynamic monitoring, prediction or assessment of prognosis of genes or their mutations; Preferably, the biological sample labeling includes multi-sample pool labeling or micro-sample labeling.

Images