Kasp marker KRN-1-KASP-411 closely linked with row number of corn kernels and application of Kasp marker KRN-1-KASP-411

Abstract

The invention relates to the technical field of plant molecular breeding, in particular to a Kasp marker KRN-1-KASP-411 closely linked with the line number of corn kernels and application of the Kasp marker KRN-1-KASP-411. The marker anchors an A / C polymorphism SNP site at the first chromosome 204067411 of corn, and a corresponding primer group comprises a forward primer 1, a forward primer 2 and a reverse primer of a specific sequence; the invention also provides application of the marker in screening corn with high and low grain row numbers, and accurate screening of target plants is realized by extracting corn genome DNA, adopting an optimized PCR reaction system and program for amplification, and performing fluorescence signal standardization treatment, genotype discrimination formula determination and chi-square test verification. The marker is high in specificity, the distinguishing accuracy rate exceeds 98%, the method does not need electrophoresis, the process is standardized, identification can be completed in the early growth stage of corn, an efficient tool is provided for corn grain line number directional breeding, high-yield corn variety cultivation is assisted, and the marker has important application value.

Description

Technical Field

[0001] This invention relates to the field of plant molecular breeding technology, and more specifically, to a Kasp marker KRN-1-KASP-411 closely linked to the number of rows of maize kernels and its application. Background Technology

[0002] As a globally important food, feed, and industrial raw material crop, the genetic improvement of maize's yield traits has always been a core research direction in crop breeding. Kernel row number is one of the key agronomic traits contributing to maize yield, a typical quantitative genetic trait controlled by multiple genes and easily influenced by environmental factors. Precise regulation of this trait is of great significance for increasing maize yield per unit area and optimizing the agronomic traits of varieties. Therefore, identifying molecular markers closely linked to maize kernel row number and establishing efficient and accurate genotyping methods have significant practical value for accelerating the high-yield breeding process and shortening the breeding cycle of maize.

[0003] Currently, molecular marker-assisted breeding has become an important technical means for maize genetic improvement. Compared with traditional phenotype-based breeding methods, it can achieve early and accurate screening of target traits and effectively avoid environmental interference. Reported molecular markers related to maize kernel row number include SSR markers, RFLP markers, and some SNP markers. However, existing markers generally suffer from weak correlation, insufficient specificity, and cumbersome detection procedures. Among them, SSR markers are highly polymorphic, but detection requires an electrophoresis step, which is time-consuming and has low throughput, making it difficult to meet the needs of large-scale breeding. Traditional SNP marker detection relies on sequencing technology, which is costly, and some markers have low linkage to kernel row number traits, resulting in insufficient accuracy in genotype-phenotype correspondence and failing to provide reliable support for breeding.

[0004] KASP markers, as a highly efficient SNP-based genotyping technique, offer advantages such as high throughput, low cost, speed, and accuracy. They eliminate the need for electrophoresis, relying solely on fluorescence signals for genotyping and have been widely applied in marker-assisted breeding for crop traits. However, no specific KASP marker closely linked to the maize kernel row number trait and validated on a large scale has yet been discovered. Existing screening methods lack standardized reaction system parameters, fluorescence signal processing algorithms, and result verification procedures, resulting in reliance on traditional phenotypic identification for kernel row number-oriented breeding, which suffers from long cycles, low efficiency, and poor screening accuracy. Therefore, developing a highly specific KASP marker closely linked to maize kernel row number and constructing a standardized and efficient screening method is an urgent need to address the current pain points in maize kernel row number breeding technology. Summary of the Invention

[0005] The purpose of this invention is to provide a Kasp marker KRN-1-KASP-411 closely linked to the number of rows of maize kernels and its application, in order to solve the problems of long breeding cycles, low efficiency and susceptibility to environmental influences in traditional maize breeding as mentioned in the background art.

[0006] To achieve the above objectives, this invention provides a Kasp marker, KRN-1-KASP-411, closely linked to the number of kernel rows in maize. This marker includes a specific SNP site and a corresponding KASP molecular marker primer set. The SNP site is located at position 204067411 on maize chromosome 1, with a polymorphism of A / C. The KASP molecular marker primer set includes forward primer 1, forward primer 2, and a reverse primer. The sequence of forward primer 1 is GAAGGTGACCAAGTTCATGCTGCAGCGTACATATCCTTCAGAGA, the sequence of forward primer 2 is GAAGGTCGGAGTCAACGGATTCAGCGTACATATCCTTCAGAGC, and the sequence of the reverse primer is CGTACTGATGCTCCAAATCGC. Using this KASP marker, the correlation between maize genotype and kernel row number is detected: genotype A:A indicates a high kernel row count, and genotype C:A indicates a low kernel row count. Genotype discrimination uses a fluorescence signal threshold algorithm, with the following formula: ; Where G represents the genotype, FAM represents the fluorescence value of the FAM fluorescent tag sequence at an excitation wavelength of 485 nm and an emission wavelength of 520 nm, HEX represents the fluorescence value of the HEX fluorescent tag sequence at an excitation wavelength of 528 nm and an emission wavelength of 560 nm, ROX represents the fluorescence value of the reference dye, and T1 and T2 are the discrimination thresholds, with T1 ≥ 0.8 and T2 ≥ 0.8.

[0007] Preferably, the concentrations of forward primer 1 and forward primer 2 are independently 4–10 μmol / L, and the concentration of the reverse primer is 4–10 μmol / L. The concentration selection needs to match the total volume of the PCR reaction system and the template DNA concentration. Specifically, a concentration of 4 μmol / L is suitable for reaction systems with a template DNA concentration ≥80 ng / μl, a concentration of 10 μmol / L is suitable for reaction systems with a template DNA concentration ≤60 ng / μl, and a concentration of 6–8 μmol / L is suitable for conventional reaction systems with a template DNA concentration of 60–80 ng / μl.

[0008] Preferably, the threshold T1 in the genotype discrimination formula is 0.9 and the threshold T2 is 0.9. This threshold is obtained through statistical analysis of the fluorescence values ​​of 465 maize inbred line samples. Specifically, it is determined based on the normal distribution characteristics of the sample fluorescence values ​​and the critical value of the 95% confidence interval. The genotype discrimination accuracy is ≥98% under this threshold, as verified by field trial data from Acheng, Wangkui, and Zhaodong.

[0009] Preferably, the volume ratio of forward primer 1, forward primer 2, and reverse primer in the KASP molecular marker primer set is 2:2:5. This volume ratio is optimized based on the Tm value of the primers. The Tm values ​​of forward primer 1 and forward primer 2 are both 60±2℃, and the Tm value of the reverse primer is 58±2℃. This ratio ensures that all three primers achieve optimal annealing efficiency simultaneously in the PCR reaction. The primer set is prepared by first preparing 100μmol / L stock solutions of forward primer 1, forward primer 2, and reverse primer, and then mixing them in the following ratio: 6μl forward primer 1 stock solution + 6μl forward primer 2 stock solution + 15μl reverse primer stock solution + 23μl enzyme-free ultrapure water. When using, add the mixture at a ratio of 0.14μl / 10μl reaction system.

[0010] On the other hand, the present invention also provides an application of using the above-mentioned KASP marker KNR-1-KASP-411 to screen corn with high kernel row count and corn with low kernel row count, wherein the screening of corn with high kernel row count using the KASP marker KNR-1-KASP-411 includes the following steps: Step 1: Extract maize genomic DNA; Step 2: Using the maize genomic DNA as a template, PCR amplification was performed using the KASP molecular marker primer set to obtain the amplification product; Step 3: Perform KASP genotyping on the amplified products to obtain FAM, HEX, and ROX fluorescence values; Step 4 uses a fluorescence signal normalization formula to process the fluorescence value. The normalization formula is as follows: ; in The relative fluorescence value of FAM. The relative fluorescence value is HEX. The FAM fluorescence value is without template control. The HEX fluorescence value is without template control. ROX fluorescence values ​​without template control; Step 5: Determine the maize genotype according to the genotype discrimination formula, and screen maize plants with genotype A:A, which are high-kernel-row maize. Step 6 uses the association significance test formula to verify the reliability of the screening results. The test formula is: ; in This is the chi-square statistic. Let be the actual phenotypic conformity number of the i-th genotype. Let be the theoretical phenotypic conformity number for the i-th genotype, and The screening results were highly significant when the value was ≥6.63.

[0011] Preferably, the PCR amplification reaction system in step 2 comprises, per 10 μl, 2 μL of maize genomic DNA, 0.14 μL of primer set, 5 μL of 2xProbeMixA solution, and the remainder ddH2O; the 2xProbeMixA solution contains hot-start Taq enzyme, dNTPs, and Mg. 2+ And fluorescent probes, wherein the hot-start Taq enzyme concentration is 5 U / μL, the dNTPs concentration is 2 mmol / L, and Mg 2+ The concentration is 3 mmol / L; the primer set consists of forward primer 1, forward primer 2 and reverse primer in a volume ratio of 2:2:5, and the 0.14 μL primer set contains 10.04 μL of forward primer, 0.04 μL of forward primer 2 and 0.06 μL of reverse primer; the ddH2O is ultrapure water free of enzymes and nucleic acid contamination, with a resistivity ≥18.2 MΩ·cm.

[0012] Preferably, the PCR amplification reaction program in step 2 is as follows: the first stage is pre-denaturation at 95℃ for 10 min; the second stage is denaturation at 95℃ for 20 s and annealing at 61℃ for 40 s for a total of 10 cycles; the third stage is denaturation at 95℃ for 20 s and annealing at 55℃ for 40 s for a total of 31 cycles; and the fourth stage is holding at 25℃ for 10 min. The temperature and time of the pre-denaturation stage are used to fully activate the hot-start Taq enzyme and completely unwind the template DNA double strand. The annealing temperature in the second stage starts at 61℃ and is gradient annealing, decreasing by 0.6℃ in each cycle, and then decreasing to 55℃ after 10 cycles. The third stage is annealing at 55℃ to maintain the specific binding of primers to the template. The fourth stage is holding at 25℃ to terminate the reaction and protect the amplification products.

[0013] Preferably, the concentration of maize genomic DNA in step 1 is 50–100 ng / μl, and the purity must meet the requirements of an A260 / A280 ratio between 1.8 and 2.0 and an A260 / A230 ratio ≥ 2.0. DNA extraction is performed using the CTAB method, specifically by grinding fresh leaf tissue with liquid nitrogen, followed by lysis in a 65°C water bath, chloroform / isoamyl alcohol extraction, precipitation with anhydrous ethanol, washing with 75% ethanol, and then dissolving in TE buffer. When the concentration is below 50 ng / μl, it is concentrated to the target concentration using a vacuum freeze-drying method; when it is above 100 ng / μl, it is diluted to the target concentration with enzyme-free ultrapure water.

[0014] Preferably, the degree of freedom of the association significance test formula in step 6 is 1, and the significance level α = 0.01; the degree of freedom is determined by the number of genotype groups, and since only two genotypes, A:A and C:A, are involved, the degree of freedom is 1, and the critical value corresponding to α = 0.01 is... =6.63 is derived from the chi-square distribution table; The number of samples with high kernel row count in A:A genotype maize and low kernel row count in C:A genotype maize were obtained through statistical screening. The results were calculated based on Mendel's laws of inheritance and the phenotypic distribution frequencies of 465 maize inbred lines, specifically: = Total number of samples × Probability of matching the theoretical phenotype of the corresponding genotype.

[0015] Preferably, the screening of low-kernel-row maize using the KASP marker KNR-1-KASP-411 includes the following steps: after processing using the methods in steps 1 to 4, maize plants with genotype C:A are screened according to the genotype discrimination formula, which are then considered low-kernel-row maize. In the genotype discrimination formula, T1 is set to 0.7 and T2 is set to 0.7. This threshold is determined statistically by analyzing the fluorescence distribution of low-kernel-row maize samples, and the discrimination accuracy is verified to be ≥97% using field data from three locations. The association significance test formula... The screening results were highly significant when the value was ≥6.63. After screening, the candidate plants were required to be verified in the field. The mean number of grain rows of 5 representative plants was calculated, and plants with a value between 10 and 14 were identified as target plants.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: 1. The KASP marker KNR-1-KASP-411 provided by this invention possesses extremely high specificity and correlation, providing an efficient tool for accurate genotypic identification of maize kernel row number. This marker anchors to the A / C specific SNP site at 204067411 on maize chromosome 1, which is closely linked to the maize kernel row number trait. Combined with an optimized primer set and fluorescence signal discrimination algorithm, it achieves a precise correspondence between genotype and kernel row number phenotype. Through setting scientific threshold parameters and verification using 465 maize inbred line samples and field trials in multiple locations, the genotype discrimination accuracy can reach over 98%. Compared to traditional molecular markers, it eliminates the need for electrophoresis detection. Relying on standardized fluorescence signal processing and the chi-square test formula, it significantly improves the accuracy and reliability of detection, while avoiding errors caused by cumbersome operations. It is adaptable to different concentrations of template DNA and diverse reaction systems, exhibiting strong stability and applicability.

[0017] 2. The screening method of this invention significantly optimizes the maize kernel row number-oriented breeding process, reducing breeding costs and shortening the breeding cycle. Based on the aforementioned KASP markers, this method constructs a complete standardized process from DNA extraction to result verification, clearly defining the component ratios, concentration parameters, and reaction procedure details of the PCR reaction system. Through gradient annealing design and the application of hot-start enzymes, it ensures amplification specificity and efficiency, enabling large-scale sample detection without complex instruments. Compared to traditional screening methods relying on field phenotypic observation, this method allows for genotyping in the early stages of maize growth, rapidly screening for target plants with high or low kernel row numbers, reducing the sample size and workload of later field trials. Simultaneously, the screening results are verified using a significance test formula, ensuring the rigor of the screening. This effectively solves the technical problems of phenotypic identification in traditional breeding, which is susceptible to environmental influences, has a long cycle, and low efficiency, providing precise and efficient technical support for maize breeding.

[0018] 3. The application of this invention has a significant driving effect on the maize breeding industry, possessing both significant economic and practical value. The number of kernel rows in maize is a key agronomic trait affecting yield. This invention, through precise labeling and screening methods, can directionally breed maize varieties with high kernel row counts, thereby increasing maize yield per unit area and meeting the agricultural demand for high-yielding maize varieties. Simultaneously, it can also screen for maize varieties with low kernel row counts according to breeding needs, adapting them to specific planting scenarios and uses. This labeling and method can be widely applied to various breeding stages, including maize inbred line selection, hybridization, and germplasm resource identification, adapting to maize materials from different regions and with different genotypes, and is easily promoted and applied on a large scale in breeding units. Its widespread use can accelerate the popularization of maize molecular breeding technology, promote the transformation of maize breeding from traditional experience-based to precise molecular-based methods, help cultivate more high-quality, high-yielding new maize varieties, and provide technical support for ensuring food security and sustainable agricultural development. Attached Figure Description

[0019] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are explained in detail together with the embodiments of the invention, but do not constitute a limitation thereof.

[0020] Figure 1 This is a normal distribution diagram of the maize kernel row number trait in an embodiment of the present invention; Figure 2 This is a chromosome distribution diagram of SNP markers according to an embodiment of the present invention; Figure 3 Manhattan plot and QQ plot of genome-wide association analysis of maize kernel row number in embodiments of the present invention; Figure 4 Regional correlation analysis and LD heatmap of candidate factor Zm00001eb038110 in embodiments of the present invention; Figure 5 This is a phenotypic analysis diagram of haplotype grain row number in an embodiment of the present invention; Figure 6 This is a graph showing the KASP molecular marker typing results of 465 maize kernel rows in Example 4 of this invention; Figure 7 This is a correlation analysis diagram of KASP marker genotype and grain row number phenotype in an embodiment of the present invention. Detailed Implementation

[0021] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments and accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0022] The purpose of this invention is to provide an SNP locus for identifying the number of rows of maize kernels, a KASP molecular marker primer set, and their applications, enabling rapid screening and identification of maize kernel row count traits and improving the breeding efficiency of maize germplasm. The invention also provides an SNP locus for identifying the number of rows of maize kernels, located at chromosome 1, 204067411, with a polymorphism of A / C. Furthermore, it provides a KASP molecular marker primer set for identifying the aforementioned SNP locus, comprising forward primer 1 with the sequence KNR-1-KASP-411F1, forward primer 2 with the sequence KNR-1-KASP-411F2, and reverse primer with the sequence KNR-1-KASP-411R. The concentrations of forward primer 1 and forward primer 2 in the primer set are independently 4–10 μmol / L; the concentration of the reverse primer in the primer set is also 4–10 μmol / L.

[0023] The SNP locus provided by this invention is located at position 204067411 on chromosome 1 of maize, with a polymorphism of A / C. When the base is A:A, the maize kernel row count trait is high; when the base is C:A, the maize kernel row count trait is low. Using this SNP locus, high and low kernel row count maize can be distinguished.

[0024] This invention uses a KASP molecular marker primer set to select for the kernel row number trait in maize. The identification of samples can be completed simply by DNA extraction, PCR-specific amplification, and KASP genotyping detection, which can yield maize with high kernel row number. This molecular marker is effective in identifying maize kernel row number. Using the molecular marker-assisted selection of this invention can improve the breeding efficiency of maize with high kernel row number, provide a basis for utilizing superior allelic variations related to maize kernel row number, and accelerate the breeding process.

[0025] This invention utilizes 465 phenotypic and representative DH lines, planted in 2025 in experimental fields in Guangxing Village, Yangshu Street, Acheng District, Harbin City, Heilongjiang Province (126°53′8.73″E, 45°29′39.88″N); Huojian Town, Wangkui County, Suihua City, Harbin City (126°20′23″E, 46°35′34″N); and Changfu Village, Liming Town, Zhaodong City, Harbin City (125°22′28″E, 45°11′24″N). Each material was planted in two rows, 2.5m long. The 21 main agronomic traits and yield traits were investigated according to standards, and data such as the number of grain rows were recorded and compiled. After 5* genome resequencing of each material, the genome was assembled by comparison with a reference genome to obtain SNP polymorphic markers. GWAS association analysis using multi-site grain row number trait data identified significant SNPs associated with grain row number. These significant SNPs were located within genes. Genotypic data at the SNP markers were extracted from 465 materials. Marker effect analysis combining genotypic and multi-site phenotypic data showed a very strong correlation between this SNP marker and grain row number. KASP primers were designed based on this SNP, and grain row number in maize inbred lines could be distinguished using gel-free fluorescent polymerase chain reaction. Example 1: Investigation and Phenotypic Data Analysis of Kernel Row Count Trait in Maize Inbred Lines

[0026] Using 465 high-quality maize inbred lines selected over the past 15 years from the Shenzhen Genome Institute of the Chinese Academy of Agricultural Sciences, these lines were planted in 2025 in experimental fields in Guangxing Village, Yangshu Street, Acheng District, Harbin City, Heilongjiang Province (126°53′8.73″E, 45°29′39.88″N), Huojian Town, Wangkui County, Suihua City, Harbin City (126°20′23″E, 46°35′34″N), and Changfu Village, Liming Town, Zhaodong City, Harbin City (125°22′28″E, 45°11′24″N).

[0027] The experiment employed a randomized block design, with each variety planted in two rows, each row 3m long, with a row spacing of 0.65m and a plant spacing of 0.2m. Fertilization and irrigation were managed as usual in conventional field operations. After maize maturity, the number of kernel rows per ear was counted. The first plant in each row was excluded, and five representative plants from each variety were selected to count the number of kernel rows. Data on kernel rows and other traits were recorded and compiled. Statistical analysis of the maize phenotypic data was performed using Microsoft Excel 2022 and IBM SPSS Statistics V27.0. The normality of the distribution was evaluated based on the coefficient of variation, skewness, and kurtosis. Finally, a frequency distribution histogram was plotted using Origin 2021 software to test the normality of the phenotypic data.

[0028] Statistical analysis of the kernel row number trait in maize showed that the mean value ranged from 14.50 to 14.70 under the three environmental conditions, with a phenotypic variation range of 10 and a coefficient of variation ranging from 14.48% to 14.63%. The coefficient of variation exceeded 14% in all environmental conditions, indicating relatively rich phenotypic variation in the kernel row number trait among maize inbred lines. The absolute values ​​of skewness and kurtosis for the kernel row number trait were both less than 1. Figure 1 The figure shows the distribution of grain row number phenotypic data, where a, b, and c represent the field phenotypic data of grain row number in Acheng, Harbin in 2025, Wangkui, Harbin in 2025, and Zhaodong, Harbin in 2025, respectively. The horizontal axis represents the number of grain rows, and the vertical axis represents the number of samples.

[0029] The phenotypic data of maize kernel row number were analyzed using the 1me4 package in R language, and the generalized heritability was estimated by analyzing the variance of various influencing factors. The mean heritability of kernel row number in multiple environments was 87.5%, indicating that it is mainly affected by genetic factors. Example 2: Maize genomic DNA extraction, library construction, and sequencing

[0030] The specific method for constructing a library for the maize inbred lines in Example 1 is as follows: (1) Weigh 1.0g of fresh leaves, cut them into small pieces and put them into a mortar. Grind them with liquid nitrogen and then add 3mL of 1.5×CTAB. Grind them into a homogenate and transfer it into a 15mL centrifuge tube. Then add 1mL of 1.5×CTAB to the mortar to rinse and transfer it into the centrifuge tube. Mix well and incubate in a 65℃ water bath for 30min, shaking slowly from time to time.

[0031] The 1.5×CTAB formulation is as follows (1L): CTAB 15g 1 mol / L Tris.Cl (EH 8.0) 75mL 0.5 mol / L EDTA 30mL NaCl 61.4g Add deionized water to a final volume of 1L, and add mercaptoethanol to a final concentration of 0.2% (2ml) before use.

[0032] (2) After cooling to room temperature, add an equal volume of chloroform / isoamyl alcohol (24:1), mix gently until the lower layer turns dark green.

[0033] (3) Centrifuge at 4200 rpm for 10 min, transfer the upper aqueous phase to a new 15 mL centrifuge tube, add 2 volumes of pre-cooled anhydrous ethanol, mix and let stand for 5 min. Incubate at -20℃ for 30 min to precipitate DNA.

[0034] (4) Centrifuge at 4200 rpm for 10 min, discard the supernatant, add 1 mL of 75% ethanol to wash the precipitate once, invert the centrifuge tube to dry the DNA, and add 50 μL of TE to dissolve the DNA.

[0035] (5) Detect the concentration of DNA and adjust it with water to 20 ng / ul.

[0036] (6) Libraries were constructed using a simplified AIO-seq method (Zhao et al., 2020). Multiple samples were fragmented using Tn5 transposase and ligated with MGI® sequencing adapters during PCR amplification.

[0037] After mixing the samples, fragment sizes were screened, and the selected mixed samples were circularized using the Hieff NGS® Fast-Pace DNA Circulation Kit (Yisheng Biotechnology, Shanghai, China, catalog number 13341ES96). The enzyme digestion products were quantified using the Qubit® ssDNA Detection Kit (Thermo Fisher Scientific, catalog number Q10212). Finally, the circularized library was sequenced on an MGI® DNBSEQ-T1 sequencer, producing 150 bp paired-end reads and yielding approximately 5× data from resequencing. Example 3: GWAS analysis of maize kernel row count to obtain significant SNPs and candidate genes

[0038] All sequencing data were processed and analyzed using a high-performance computer server. Raw data processing: After quality assessment of the raw PE (Pair-end) sequencing data using FastQC, BWA was used for quality control. Sequencing reads were aligned to a reference genome (B73v5), and SNP detection was performed using GATK. After quality control filtering at both the sample and variant levels, 6,945,041 high-quality SNP markers (minimum allele frequency > 0.05, missing data < 20%) were identified, ensuring the accuracy and reliability of the analysis results.

[0039] To better understand population structure and genetic background, a phylogenetic tree was constructed using iqTree software. Principal component analysis (PCA) was performed on the genome-wide SNP data using Plink software, and population structure analysis was conducted using Faststructure software to clarify the genetic structure within the population. Genome-wide association analysis was performed on the grain row number trait using high-quality SNPs selected in the earlier stage. A mixed linear model of genotype + phenotype + population structure + phylogenetic relationship matrix in GEMMA was used to analyze the association between SNP markers and various traits.

[0040] All SNPs satisfying p < 1.7286e-5 were extracted from the GWAS results file using awk and converted to BED format files (Chr, Start, End). A significant SNP associated with the grain row number trait was obtained from GWAS analysis of the three locations, located at position 204067411 on chromosome 1 of maize, with polymorphism A / C. The significant SNP and its upstream and downstream 100 kb regions were compared with the B73 RefGen_v5 GFF gene annotation file using the bedtools intersect tool to screen candidate genes. Genes with significant SNPs and non-synonymous mutations were prioritized. Zm00001eb038110 was selected as the final candidate gene, located at position 204067411 on chromosome 1 of maize, with polymorphism A / C. (See results for chr1). Figures 2-4 ,in: Figure 2 To map the chromosome distribution of SNP markers, the raw PE (Pair-end) sequencing data were quality-assessed using FastQC and then quality-controlled using BWA. Sequencing reads were aligned to a reference genome (B73v5), and SNPs were detected using GATK. After quality control filtering at both the sample and variant levels, 6,945,041 high-quality SNP markers (minimum allele frequency > 0.05, missing data < 20%) were identified. The SNP chromosome distribution was relatively uniform, ensuring the accuracy and reliability of the analysis results. Figure 3 Manhattan plots and QQ plots for genome-wide association analysis of maize kernel rows are provided, where a and b are the Manhattan plots and QQ plots for kernel rows in Acheng in 2025; c and d are the Manhattan plots and QQ plots for kernel rows in Wangkui in 2025; and e and f are the Manhattan plots and QQ plots for kernel rows in Zhaodong in 2025. Figure 4 To conduct regional association analysis and LD heatmap of candidate gene Zm00001eb038110, 106 SNP markers were extracted from the region of candidate gene Zm00001eb038110. Association analysis was performed in conjunction with phenotype to obtain significant markers, including SNP A / C mutation located at exon 204067411 of the gene. Example 4: Association analysis of candidate genes for maize kernel row number and development and validation of KASP markers

[0041] Based on the candidate genes obtained in step 3, all SNPs within the candidate gene intervals of 465 maize samples were extracted for candidate gene regional association analysis. Simultaneously, all SNPs and Indel markers within the intervals were extracted for haplotype inference, resulting in two haplotypes: HAP1 and HAP2. The significant SNP at position 204067411 was located within one of these haplotypes. Combining the phenotypic data from the three locations, the differences in grain row number phenotypes among the different haplotypes were analyzed. Figure 5The results show the phenotypic differences in grain row count among haplotypes, where AC represents Acheng; WK represents Wangkui; and ZD represents Zhaodong. It was found that the grain row count of HAP1 was significantly higher than that of HAP2, with the mean difference between HAP1 and HAP2 ranging from 1.15 to 2.74. The significant SNP at 204067411, consistent with the B73 reference genome, indicated that the grain row count of A:A maize was significantly higher than that of C:A maize, and this was highly significant in all three locations. Based on the association analysis results, KASP molecular markers were developed using 100bp sequences upstream and downstream of the significant SNP at 204067411 on chromosome 1. KASP molecular marker scanning was then used for validation.

[0042] Specifically as follows: (1) DNA was extracted from 465 maize inbred lines using the CTAB method; (2) Using DNA as a template, fluorescent polymerase chain reaction (PCR) genotyping was performed using KASP primers. The KASP primers were designed based on the SNP at position 204067411 on chromosome 1 of maize. The primers are shown in the table below:

[0043] The PCR amplification reaction system, in 10 μl increments, consisted of: 2 μl of 4-50 ng / μl genomic DNA, 0.14 μl of primer mix (prepared by mixing 6 μl of forward primer 1, 6 μl of forward primer 2, 15 μl of reverse primer, and 23 μl of ddH2O), 5 μl of 2x ProbeMix A solution, and 3 μl of ddH2O. The PCR amplification program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, 61℃ annealing for 40 s, 10 cycles; 95℃ denaturation for 20 s, 55℃ annealing for 40 s, 31 cycles; 25℃ for 10 min; 4℃ for storage.

[0044] After amplification, KASP detection was performed based on the AQP genotyping system operating instructions. The PCR program on the ABI 7500 qPCR instrument was set to 35℃ for 30 seconds. The results file was exported, and the genotypes were further determined according to the sample clusters. Results analysis was performed using Taqman Genotyper Software. The fluorescence values ​​of HEX and FAM for each PCR reaction well were obtained and divided by the value of the reference dye (ROX) for that well. The fluorescence values ​​were standardized to obtain the relative fluorescence values ​​of HEX and FAM for each PCR reaction well (FAM fluorescent tag sequences were observed at excitation wavelengths of 485 nm and emission wavelengths of 520 nm, and HEX fluorescent tag sequences were observed at excitation wavelengths of 528 nm and emission wavelengths of 560 nm). Based on the relative fluorescence values, the samples were clustered. The KASP molecular marker genotyping results for 465 maize kernel rows are shown below. Figure 6 As shown, green represents C:A, blue represents A:A, and gray represents NTC control. KASP primers were designed based on the SNP at Chr1:204067411 in maize, and KASP molecular markers were used to genotype 465 maize accessions. The results showed that KASP markers can distinguish between the two genotypes at Chr1:204067411.

[0045] Depend on Figure 6 It can be seen that this locus has two genotypes: blue dots represent genotype A:A, and green dots represent genotype C:A. This KASP marker can distinguish between the two genotypes. The correlation between the kernel row number trait and the genotyping results in maize materials was analyzed. The correspondence between the kernel row number trait and the genotyping results in maize materials is shown in Table 1 and... Figure 7 As shown, Figure 7 middle: A:A-AC: KASP marker genotype A:A in the number of grain rows in Acheng; The number of grain rows in samples with the C:A-AC:KASP marker genotype C:A in Acheng; A:A-WK: KASP marker genotype A:A in the number of grain rows in Wangkui; The number of grain rows in Wangkui for samples with the C:A-WK:KASP marker genotype C:A; A:A-ZD: Number of grain rows in samples with the KASP marker genotype A:A in Zhaodong; The number of grain rows in samples with the C:A-ZD:KASP marker genotype C:A in Zhaodong; In Acheng, 338 samples were A:A and 79 samples were C:A, with a mean difference of 1.47 in the number of kernel rows between the two types, which was highly significant. In Wangkui, 344 samples were A:A and 82 samples were C:A, with a mean difference of 1.19 in the number of kernel rows between the two types, which was highly significant. In Zhaodong, 344 samples were A:A and 82 samples were C:A, with a mean difference of 1.30 in the number of kernel rows between the two types, which was highly significant. The KASP marker KNR-1-KASP-411, designed based on the SNP at position 204067411 on chromosome 1 of maize, can distinguish between two genotypes. When the base is A:A, the maize kernel row count trait is high; when the base is C:A, the maize kernel row count trait is low. The phenotypic data for all three locations are extremely significant.

[0046] The table below shows the KASP molecular marker scanning results for the number of rows in 465 maize kernels:

[0047]

[0048]

[0049]

[0050]

[0051]

[0052]

[0053]

[0054]

[0055]

[0056]

[0057]

[0058] Note: Blue indicates homozygous (A:A), green indicates heterozygous (C:A), magenta indicates signal but no clear genotype "Uncallable", no signal or weak signal indicates "?", and gray is NTC control.

[0059] According to Table 1, Figure 6 , Figure 7 It can be seen that when the fluorescence signal of the amplification product is blue, the kernel row count trait of maize is identified as high kernel row count, and the corresponding genotype is homozygous A:A; when the fluorescence signal of the amplification product is green, the kernel row count trait of maize is identified as low kernel row count, and the corresponding genotype is heterozygous C:A. The KASP experiment results in Example 4 are consistent with the actual kernel row count trait of the sample to be tested, indicating that the KASP experiment using this molecular marker can effectively detect the genotype of the test material, thereby completing the identification of germplasm.

[0060] This invention has many significant beneficial effects on maize breeding and other aspects, as detailed below: The KASP marker KNR-1-KASP-411 provided by this invention exhibits extremely high specificity and correlation, offering an efficient tool for precise genotypic identification of maize kernel row number. This marker anchors to the A / C specific SNP locus at 204067411 on maize chromosome 1, and is closely linked to the maize kernel row number trait. Combined with an optimized primer set and fluorescence signal discrimination algorithm, it achieves a precise correspondence between genotype and kernel row number phenotype. Through setting scientific threshold parameters and verification using 465 maize inbred line samples and field trials in multiple locations, the genotype discrimination accuracy reaches over 98%. Compared to traditional molecular markers, it eliminates the need for electrophoresis detection, and relies on standardized fluorescence signal processing and the chi-square test formula, significantly improving the accuracy and reliability of the detection. It also avoids errors caused by cumbersome operations, is adaptable to different concentrations of template DNA and diverse reaction systems, and possesses extremely strong stability and applicability.

[0061] The screening method of this invention significantly optimizes the maize kernel row number-oriented breeding process, reducing breeding costs and shortening the breeding cycle. Based on the aforementioned KASP markers, this method constructs a complete standardized process from DNA extraction to result verification, clearly defining the component ratios, concentration parameters, and reaction procedure details of the PCR reaction system. Through gradient annealing design and the application of hot-start enzymes, it ensures amplification specificity and efficiency, enabling large-scale sample detection without complex instruments. Compared to traditional screening methods relying on field phenotypic observation, this method allows for genotyping in the early stages of maize growth, rapidly screening for target plants with high or low kernel row numbers, reducing the sample size and workload of later field trials. Simultaneously, the screening results are verified using a significance test formula, ensuring the rigor of the screening. This effectively solves the technical problems of phenotypic identification in traditional breeding, which is susceptible to environmental influences, has a long cycle, and low efficiency, providing precise and efficient technical support for maize breeding.

[0062] The application of this invention has a significant driving effect on the maize breeding industry, possessing both substantial economic and practical value. The number of kernel rows in maize is a key agronomical trait affecting yield. This invention, through precise labeling and screening methods, can directionally breed maize varieties with high kernel row counts, thereby increasing maize yield per unit area and meeting the agricultural demand for high-yielding maize varieties. Simultaneously, it can also screen for maize varieties with low kernel row counts based on breeding needs, adapting them to specific planting scenarios and applications. This labeling and method can be widely applied to various breeding stages, including maize inbred line selection, hybridization, and germplasm resource identification, adapting to maize materials from different regions and with different genotypes, and is easily promoted and applied on a large scale in breeding units. Its widespread use can accelerate the popularization of maize molecular breeding technology, promote the transformation of maize breeding from traditional experience-based to precise molecular-based methods, help cultivate more high-quality, high-yielding new maize varieties, and provide technical support for ensuring food security and sustainable agricultural development.

[0063] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely preferred examples and are not intended to limit the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the claimed invention.

Claims

1. A Kasp marker KRN-1-KASP-411 closely linked to the number of kernel rows in maize, characterized in that, The study included a specific SNP locus and its corresponding KASP molecular marker primer set. The SNP locus was located at position 204067411 on chromosome 1 of maize, with a polymorphism of A / C. The KASP molecular marker primer set included forward primer 1, forward primer 2, and a reverse primer. The sequence of forward primer 1 was GAAGGTGACCAAGTTCATGCTGCAGCGTACATATCCTTCAGAGA, the sequence of forward primer 2 was GAAGGTCGGAGTCAACGGATTCAGCGTACATATCCTTCAGAGC, and the sequence of the reverse primer was CGTACTGATGCTCCAAATCGC. The KASP marker was used to detect the correspondence between maize genotype and kernel row number: genotype A:A indicated a high kernel row number, while genotype C:A indicated a low kernel row number. Genotype discrimination was performed using a fluorescence signal threshold algorithm, with the following formula: ； Where G represents the genotype, FAM represents the fluorescence value of the FAM fluorescent tag sequence at an excitation wavelength of 485 nm and an emission wavelength of 520 nm, HEX represents the fluorescence value of the HEX fluorescent tag sequence at an excitation wavelength of 528 nm and an emission wavelength of 560 nm, ROX represents the fluorescence value of the reference dye, and T1 and T2 are the discrimination thresholds, with T1 ≥ 0.8 and T2 ≥ 0.

8.

2. The KASP marker KNR-1-KASP-411 according to claim 1, characterized in that, The concentrations of forward primer 1 and forward primer 2 are independently 4–10 μmol / L, and the concentration of the reverse primer is 4–10 μmol / L. The concentration selection needs to match the total volume of the PCR reaction system and the template DNA concentration. Specifically, a concentration of 4 μmol / L is suitable for reaction systems with a template DNA concentration ≥80 ng / μl, a concentration of 10 μmol / L is suitable for reaction systems with a template DNA concentration ≤60 ng / μl, and a concentration of 6–8 μmol / L is suitable for conventional reaction systems with a template DNA concentration of 60–80 ng / μl.

3. The KASP marker KNR-1-KASP-411 according to claim 1, characterized in that, The threshold T1 in the genotype discrimination formula is 0.9, and the threshold T2 is 0.

9. This threshold was obtained through statistical analysis of the fluorescence values ​​of 465 maize inbred line samples. Specifically, it was determined based on the normal distribution characteristics of the sample fluorescence values ​​and the critical value of the 95% confidence interval. The genotype discrimination accuracy under this threshold was verified by field trial data from Acheng, Wangkui, and Zhaodong.

4. The KASP marker KNR-1-KASP-411 according to claim 1, characterized in that, The volume ratio of forward primer 1, forward primer 2, and reverse primer in the KASP molecular marker primer set is 2:2:

5. This volume ratio is optimized based on the Tm value of the primers. The Tm value of forward primer 1 and forward primer 2 is 60±2℃, and the Tm value of the reverse primer is 58±2℃. This ratio ensures that all three primers achieve the best annealing efficiency in the PCR reaction. The primer set is prepared by first preparing 100μmol / L stock solutions of forward primer 1, forward primer 2, and reverse primer, and then mixing them in the following ratio: 6μl forward primer 1 stock solution + 6μl forward primer 2 stock solution + 15μl reverse primer stock solution + 23μl enzyme-free ultrapure water. When using, add the mixture at a ratio of 0.14μl / 10μl reaction system.

5. An application of using the KASP marker KNR-1-KASP-411 as described in any one of claims 1-4 to screen corn with high kernel row count and corn with low kernel row count, characterized in that, The method of screening high-kernel-row-count maize using the KASP marker KNR-1-KASP-411 includes the following steps: Step 1: Extract maize genomic DNA; Step 2: Using the maize genomic DNA as a template, PCR amplification was performed using the KASP molecular marker primer set to obtain the amplification product; Step 3: Perform KASP genotyping on the amplified products to obtain FAM, HEX, and ROX fluorescence values; Step 4 uses a fluorescence signal normalization formula to process the fluorescence value. The normalization formula is as follows: ； in The relative fluorescence value of FAM. The relative fluorescence value is HEX. The FAM fluorescence value is without template control. The HEX fluorescence value is without template control. ROX fluorescence values ​​without template control; Step 5: Determine the maize genotype according to the genotype discrimination formula, and screen maize plants with genotype A:A, which are high-kernel-row maize. Step 6 uses the association significance test formula to verify the reliability of the screening results. The test formula is: ； in This is the chi-square statistic. Let be the actual phenotypic conformity number of the i-th genotype. Let be the theoretical phenotypic conformity number for the i-th genotype, and The screening results were highly significant when the value was ≥6.

63.

6. The application of the KASP marker KNR-1-KASP-411, which is closely linked to the number of maize kernel rows, as described in claim 5, is characterized in that... The PCR amplification reaction system in step 2, per 10 μl, includes 2 μL of maize genomic DNA, 0.14 μL of primer set, 5 μL of 2xProbeMixA solution, and the remainder ddH2O; the 2xProbeMixA solution contains hot-start Taq enzyme, dNTPs, and Mg. 2+ And fluorescent probes, wherein the hot-start Taq enzyme concentration is 5 U / μL, the dNTPs concentration is 2 mmol / L, and Mg 2+ The concentration is 3 mmol / L; the primer set consists of forward primer 1, forward primer 2 and reverse primer in a volume ratio of 2:2:5, and the 0.14 μL primer set contains 10.04 μL of forward primer, 0.04 μL of forward primer 2 and 0.06 μL of reverse primer; the ddH2O is ultrapure water free of enzymes and nucleic acid contamination, with a resistivity ≥18.2 MΩ·cm.

7. The application of the KASP marker KNR-1-KASP-411, which is closely linked to the number of corn kernel rows, as described in claim 5, is characterized in that... The PCR amplification reaction program described in step 2 is as follows: the first stage is pre-denaturation at 95℃ for 10 min; the second stage is denaturation at 95℃ for 20 s and annealing at 61℃ for 40 s for a total of 10 cycles; the third stage is denaturation at 95℃ for 20 s and annealing at 55℃ for 40 s for a total of 31 cycles; and the fourth stage is holding at 25℃ for 10 min. The temperature and time of the pre-denaturation stage are used to fully activate the hot-start Taq enzyme and completely unwind the template DNA double strand. The annealing temperature in the second stage starts at 61℃ and is gradient annealing, decreasing by 0.6℃ in each cycle, and then decreasing to 55℃ after 10 cycles. The third stage is annealing at 55℃ to maintain the specific binding of primers to the template. The fourth stage is holding at 25℃ to terminate the reaction and protect the amplification products.

8. The application of the KASP marker KNR-1-KASP-411, which is closely linked to the number of corn kernel rows, as described in claim 5, is characterized in that... The concentration of maize genomic DNA in step 1 is 50–100 ng / μl, and the purity must meet the requirements of an A260 / A280 ratio between 1.8 and 2.0 and an A260 / A230 ratio ≥2.

0. DNA extraction is performed using the CTAB method, specifically by grinding fresh leaf tissue with liquid nitrogen, followed by lysis in a 65°C water bath, chloroform / isoamyl alcohol extraction, precipitation with anhydrous ethanol, washing with 75% ethanol, and then dissolving in TE buffer. When the concentration is below 50 ng / μl, it is concentrated to the target concentration using a vacuum freeze-drying method; when it is above 100 ng / μl, it is diluted to the target concentration with enzyme-free ultrapure water.

9. The application of the KASP marker KNR-1-KASP-411, which is closely linked to the number of maize kernel rows, as described in claim 5, is characterized in that... The association significance test formula described in step 6 has 1 degree of freedom and a significance level of α = 0.

01. The degree of freedom is determined by the number of genotype groups; since it only involves two genotypes, A:A and C:A, the degree of freedom is 1. The critical value corresponding to α = 0.01 is... =6.63 is derived from the chi-square distribution table; The number of samples with high kernel row count in A:A genotype maize and low kernel row count in C:A genotype maize were obtained through statistical screening. The results were calculated based on Mendel's laws of inheritance and the phenotypic distribution frequencies of 465 maize inbred lines, specifically: = Total number of samples × Theoretical phenotype matching probability of the corresponding genotype.

10. The application of the KASP marker KNR-1-KASP-411, which is closely linked to the number of maize kernel rows, as described in claim 5, is characterized in that... The screening of low-kernel-row maize using the KASP marker KNR-1-KASP-411 includes the following steps: After processing using the methods in steps 1 to 4, maize plants with genotype C:A are selected as low-kernel-row maize according to the genotype discrimination formula; in the genotype discrimination formula, T1 is set to 0.7 and T2 is set to 0.

7. This threshold is determined by statistical analysis of the fluorescence value distribution of low-kernel-row maize samples, and the discrimination accuracy is verified to be ≥97% by field data from three locations; the association significance test formula includes... The screening results were highly significant when the value was ≥6.

63. After screening, the candidate plants were required to be verified in the field. The mean number of grain rows of 5 representative plants was calculated, and plants with a value between 10 and 14 were identified as target plants.

Images