Application of MSR1 inhibitor in preparation of anti-tumor immunopotentiator

Abstract

The invention discloses an application of an MSR1 inhibitor in preparation of an anti-tumor immunopotentiator. The MSR1 inhibitor is composed of doxylamine, trafenotide, dexrazoxane and clavulanic acid. The invention discloses application of an MSR1 inhibitor combined with an immune checkpoint inhibitor in preparation of a medicine for treating solid tumors. The MSR1 inhibitor disclosed by the invention is used as an anti-tumor immunopotentiator and is combined with an immune checkpoint inhibitor to treat solid tumors, so that the curative effect of tumor immunotherapy can be improved. The MSR1 inhibitor can induce tumor-related macrophages to be differentiated into anti-tumor subtypes, anti-tumor immunity is driven through phagocytosis and generation of cell factors, and a new method is provided for improving the curative effect of tumor immunotherapy.

Description

Technical Field

[0001] This invention belongs to the field of medicine, specifically relating to the use of macrophage scavenger receptor 1 (MSR1) inhibitors in the preparation of antitumor immune enhancers. Background Technology

[0002] Tumor immunotherapy is a treatment method that aims to eliminate tumors by restarting and maintaining the tumor-immune cycle, restoring the body's normal anti-tumor immune response. Immune checkpoints are a class of protein molecules that can regulate immune responses to prevent normal tissues from being killed by immune cells. Programmed cell death-1 (PD-1) and its ligand 1 (PD-L1) are important immune checkpoints, and their interaction promotes tumor immune escape by inhibiting effector T cell activity (Science 2018, 359, 1350-1355). Currently, monoclonal antibody drugs targeting PD1 / PDL1 are the most widely used tumor immunotherapy drugs in clinical practice. Although PD-1 and PD-L1 monoclonal antibodies have been successfully used to treat non-small cell lung cancer, breast cancer, melanoma, etc., the penetration of solid tumors and adverse reactions limit their efficacy. Studies have found that approximately 50% of patients with solid tumors do not respond to PD-1 / PD-L1 inhibitor therapy (N Engl J Med 2012, 366, 2455-2465). Therefore, in clinical practice, it is necessary to combine PD-1 monoclonal antibody and PD-L1 monoclonal antibody drugs in combination to improve their efficacy.

[0003] Tumor-associated macrophages (TAMs) play a crucial role in the tumor microenvironment. Based on their functional phenotypes, they can be divided into M1 macrophages (classical activated macrophages) and M2 macrophages (alternative activated macrophages). M1 macrophages drive anti-tumor immunity through phagocytosis and cytokine production, while M2 macrophages promote tumor immune escape, angiogenesis, and metastasis through extracellular matrix proteolytic remodeling and the secretion of immunosuppressive mediators (Nat RevCancer 2023, 23, 238-257). As an important immune component of the solid tumor microenvironment, TAMs are more similar to M2 macrophages and can promote the progression of most solid tumors. Through interactions with various lymphocytes and cytokines in vivo, they play a significant role in tumor invasion and metastasis, immunosuppression, and treatment resistance (Immunity 2014, 41, 14-20). Therefore, targeting TAMs has become an emerging strategy for tumor immunotherapy.

[0004] The dual role of tumor checkpoint inhibitors (TAMs) is a key obstacle to sustained responses to tumor immunotherapy (Cancer Res 2021, 81, 5425-5437). In most cases, TAMs rarely conform to a strict M1 and M2 distinction; instead, they often exist as hybrid or transitional phenotypes (Cell 2021, 184, 792-809.e723). The functional heterogeneity of TAMs is driven by metabolic reprogramming, epigenetic modifications, and interactions between tumor cells, but the molecular mechanisms of their differentiation remain unclear. Studies have shown that macrophage scavenger receptor 1 (MSR1, also known as CD204 or SR-A) is a key driver of TAM immunosuppressive programming. High expression of MSR1 in TAMs is significantly associated with adverse reactions to immune checkpoint inhibitor therapy and poorer patient prognosis, suggesting that this molecule plays an important role in the tumor immune microenvironment.

[0005] In conclusion, developing MSR1 inhibitors as anti-tumor immune enhancers, and combining them with immune checkpoint inhibitors such as PD-1 monoclonal antibodies and PD-L1 monoclonal antibodies to treat solid tumors, can achieve better tumor immunotherapy effects. Summary of the Invention

[0006] The purpose of this invention is to provide the use of macrophage scavenger receptor 1 (MSR1) inhibitors in the preparation of antitumor immune enhancers, in order to solve the problems in the prior art.

[0007] The objective of this invention is achieved through the following technical solution:

[0008] Use of MSR1 inhibitors in the preparation of anti-tumor immune enhancers.

[0009] Preferably, the use is that of MSR1 inhibitors in the preparation of drugs that induce macrophages to differentiate into M1 macrophages and drive anti-tumor immunity through phagocytosis and cytokine production.

[0010] Preferably, the MSR1 inhibitor is doxylamine, trofinetide, dexrazoxane, or clavulanate.

[0011] More preferably, the MSR1 inhibitor is dexrazoxane.

[0012] Another object of the present invention is to provide the use of MSR1 inhibitors in combination with immune checkpoint inhibitors in the preparation of medicaments for treating solid tumors. MSR1 inhibitors, as anti-tumor immune enhancers, combined with immune checkpoint inhibitors in the treatment of solid tumors, can achieve better efficacy in tumor immunotherapy.

[0013] Another object of the present invention is to provide a pharmaceutical composition for the treatment of tumors, said pharmaceutical composition comprising an MSR1 inhibitor, an immune checkpoint inhibitor, and pharmaceutically acceptable excipients.

[0014] The mass ratio of the MSR1 inhibitor to the immune checkpoint inhibitor is 10:1 to 2.5:1, preferably 2.5:1.

[0015] The immune checkpoint inhibitors mentioned are PD-1 inhibitors, PD-L1 inhibitors, or CTLA-4 inhibitors.

[0016] The immune checkpoint inhibitors mentioned are nivolumab, pembrolizumab, toripalimab, sintilimab, camrelizumab, tislelizumab, penpulimab, zimberelimab, serplulimab, puctenlimab, enlonstobart, and others. Durvalumab, atezolizumab, envafolimab, sugemalimab, adebrelimab, socazolimab, bemosubab, ipilimumab, candonilimab, iparomlimab / tuvorlimab, and ivonescimab.

[0017] More preferably, the immune checkpoint inhibitor is nivolumab, pembrolizumab, toripalimab, sintilimab, camrelizumab, tislelizumab, penpulimab, zimberelimab, serplulimab, puctenlimab, or enlonstobart.

[0018] The tumors mentioned are breast cancer, melanoma, liver cancer, kidney cancer, glioma, pancreatic cancer, nasopharyngeal carcinoma, head and neck cancer, esophageal cancer, urothelial carcinoma, and gastric or gastroesophageal junction cancer.

[0019] Preferably, the tumor is breast cancer. Attached Figure Description

[0020] Figure 1 To compare the expression levels of MSR1 in monocytes and macrophages of healthy individuals and breast cancer patients, and to determine the association between MSR1 expression and survival time in breast cancer patients; ****p < 0.0001.

[0021] Figure 2 Effect of MSR1 deficiency on the growth of primary mammary tumors in mice; ****p < 0.0001.

[0022] Figure 3 The effect of MSR1 deficiency on lung metastasis and survival of mouse mammary tumors; **p < 0.01, ****p < 0.0001.

[0023] Figure 4 The effect of MSR1 inhibition combined with anti-PD-1 on the growth of primary mammary tumors in mice; **p < 0.01, ***p < 0.001, ****p < 0.0001, ns, no significant effect.

[0024] Figure 5 The effect of MSR1 inhibition combined with anti-PD-1 on lung metastasis and survival of mouse mammary tumors; *p <0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0025] Figure 6 To verify the dissociation equilibrium constant (KD) between small molecule MSR1 inhibitors and MSR1 protein using SPR technology.

[0026] Figure 7 This study aims to predict the binding mode and key binding residues between small molecule MSR1 inhibitors and the SRCR domain of MSR1.

[0027] Figure 8 Effects of small molecule MSR1 inhibitors on macrophage-mediated immune escape; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0028] Figure 9The effect of the MSR1 inhibitor dexrazoxane combined with anti-PD-1 on the growth of primary mammary tumors in mice; ****p < 0.0001, ns, no significant effect.

[0029] Figure 10 The effect of the MSR1 inhibitor dexrazoxane combined with anti-PD-1 on lung metastasis and survival of mouse mammary tumors; **p < 0.01, ***p < 0.001, ****p < 0.0001, ns had no significant effect. Detailed Implementation

[0030] To further illustrate the technical solution of the present invention, a series of embodiments are given below. These embodiments enable those skilled in the art to fully understand the present invention, but do not limit the present invention in any way.

[0031] The anti-PD-1 antibody (MedChemExpress, Cat# HY-P99144) used in the examples is an anti-PD-1 monoclonal antibody used in mouse models. Its function is to mimic the efficacy of PD-1 inhibitors in preclinical studies to validate the combination strategy of the present invention. This reagent antibody is not equivalent to any of the human therapeutic PD-1 inhibitors listed in the claims or specification (such as nivolumab, pembrolizumab, etc.).

[0032] Example 1

[0033] 1. Analysis of MSR1 mRNA levels in monocytes and macrophages of breast cancer patients

[0034] Experimental Methods: Peripheral blood samples were collected from healthy donors (Normal, n = 15) and breast cancer patients (Breast cancer, n = 51) into vacuum blood collection tubes containing the anticoagulant EDTA. Density gradient separation solution (Stem Cell, Cat# 07851) was added to SepMate. TMPeripheral blood was then slowly added to a separation device and centrifuged. The mononuclear cell (PBMC) layer on the separation membrane was transferred to a new centrifuge tube. Red blood cells were lysed and washed to collect the PBMCs, which were then cryopreserved according to standard methods for later use. This step is used to obtain a consistent and stable population of mononuclear cells, ensuring the comparability of subsequent RNA detection results. Total RNA was extracted from the PBMCs using TRIzol reagent according to the manufacturer's instructions to obtain purified RNA. Reverse transcription was then performed to generate cDNA according to the manufacturer's instructions. Real-time quantitative PCR (RT-PCR) of MSR1 was then performed using a SYBR Green-containing quantitative PCR system. All obtained Ct values ​​were normalized to an internal reference gene, and the relative expression levels were calculated using the ΔCt or 2^-ΔΔCt method.

[0035] The experimental results are shown in Figure 1 In A, the mRNA level of MSR1 in monocytes and macrophages of breast cancer patients was significantly increased, and the statistical analysis showed a significant difference (p < 0.0001), indicating that the expression of MSR1 in monocytes and macrophages of breast cancer patients was significantly increased.

[0036] 2. TCGA data analysis on the correlation between MSR1 expression levels and survival in breast cancer patients.

[0037] Experimental Methods: The relationship between MSR1 expression levels and overall survival (OS) was analyzed using BRCA (invasive breast cancer) cohort data publicly available in the TCGA (The Cancer Genome Atlas) database. Analysis included RNA-seq gene expression matrices (FPKM or TPM values) and corresponding clinical follow-up information (survival status, survival time, clinical stage, etc.). Patients were divided into high-expression and low-expression groups based on the median MSR1 expression level, and cases with invalid data or missing survival times were filtered. The Kaplan-Meier method was used to plot OS (overall survival) curves for breast cancer patients based on MSR1 expression levels. The log-rank test was used to compare the survival differences between the two groups, and the hazard ratio (HR) and its 95% confidence interval were calculated.

[0038] The experimental results are shown in Figure 1 Compared with the low MSR1 expression group, patients in the high MSR1 expression group had significantly worse survival prognosis (P = 0.0069, HR = 1.59, 95% CI: 1.13-2.24). This indicates that high MSR1 expression is significantly associated with poor prognosis in breast cancer, and high MSR1 expression is significantly associated with shortened overall survival in breast cancer patients.

[0039] 3. Construct Msr1 conditional knockout mice and breast cancer models to investigate the effects of Msr1 deficiency on breast cancer.

[0040] Experimental methods:

[0041] Msr1 floxed mice carrying the loxP sequence flanking exons 3-5 of the Msr1 gene (B6.Cg-Msr1 / J, Strain #006096) were crossed with mice expressing LysM-Cre (B6.129P2-Lyz2tm1(cre)Ifo / J, Strain #004781). From the offspring, the following were obtained: 1) Msr1 fl / fl Lyz2-Cre T (Msr1 cko 1) Mice: Macrophage lineage-specific knockout Msr1 mice. 2) Msr1 fl / fl Lyz2-Cre W (Msr1 wt Mice: Litterstock control mice. Female Msr1 mice aged 4–8 weeks. cko Mice, Msr1 wt Mice, including C57B6J mice (200 in total), were used to establish subsequent orthotopic or metastatic breast tumor models. All mice were housed under SPF conditions, and age- and sex-matched animals were used in subsequent experiments.

[0042] Establishment of the Py8119-GFP-Luc cell line: Py8119 cell lines were transfected with lentiviral particles carrying both firefly luciferase and GFP (containing puromycin resistance). Stress selection was performed using complete puromycin medium (2 μg / mL) to identify Py8119 mouse breast cancer cell lines stably expressing both luciferase and GFP. An orthotopic breast cancer model was established by transfecting Py8119-GFP-Luc breast cancer cells (1.5 × 10⁻⁶ cells) with GFP-Luc luciferase and GFP-containing lentiviral particles. 6 Py8119-GFP-Luc cells (2.5 × 10⁻⁶) were injected into the fourth mammary fat pad of 6-8 week old female C57BL / 6J mice to establish a breast cancer lung metastasis model: Py8119-GFP-Luc cells (2.5 × 10⁻⁶) were injected via tail vein. 5 Female C57BL / 6J mice aged 6–8 weeks were used. Animal ethics principles were followed during the experiment to minimize animal suffering and the number of mice.

[0043] Monitoring primary tumor volume: From the time the tumor becomes palpable, measure the tumor's long axis (L) and short axis (W) every two days using calipers, and calculate the tumor volume V = (L × W) 2The tumor growth curve was plotted based on the Msr1 deletion. The monitoring period was set at approximately three weeks until the preset endpoint was reached. Primary tumor weight was recorded: at the experimental endpoint, mice were euthanized, the primary tumor was removed, and its weight was measured. The obtained data were used to assess the impact of Msr1 deletion on breast tumor growth.

[0044] In vivo bioluminescence imaging (BLI) of lung metastasis burden in breast tumors: To assess changes in lung metastasis burden in breast tumors, mice were intraperitoneally injected with 150 μg / mL D-fluorescein potassium substrate. Using a small animal in vivo imaging system (IVISSpectrum), mice injected with Py8119-GFP-Luc tumor cells via tail vein were evaluated using visible light in vivo imaging technology, and fluorescence signals at the tumor sites were monitored. Photon flux (photons / sec) in the lung region was quantitatively recorded for comparison with Msr1. wt With Msr1 cko The extent of tumor metastasis in mice.

[0045] Survival statistical analysis: Survival of mice with lung metastasis model was monitored from the modeling date, and the time of death was recorded. Kaplan-Meier survival curves were plotted, and Msr1 was compared using the log-rank test. wt With Msr1 cko Survival differences in mice.

[0046] Experimental results:

[0047] (1) With Msr1 wt Compared to the previous group, Msr1 cko The growth of primary tumor volume in the group of mice was significantly slowed down. Figure 2 (B). At the end of the experiment, Msr1 cko The tumor volume in mice was significantly lower than that in the control group, accompanied by a significantly lower tumor weight (p < 0.0001). Figure 2 (A). The results suggest that Msr1 plays a promoting role in the growth of breast tumors, and Msr1 deficiency significantly inhibits the growth of primary breast tumors.

[0048] (2) BLI imaging shows Msr1 cko The photon flux of lung metastases from breast tumors in mice was significantly reduced. Figure 3 (A), while the lung weight / body weight ratio was also significantly reduced ( Figure 3 Both (B) and (C) indicate a significant reduction in lung metastasis burden, with statistically significant differences (p < 0.01–0.0001). In the survival analysis of the breast cancer lung metastasis model, Msr1 cko The lifespan of mice was significantly prolonged compared to Msr1. wtThe group showed a clear survival advantage (p < 0.0001). Figure 3 (C). This result further indicates that Msr1 plays a role in promoting tumor development and reducing survival during breast cancer metastasis, and that Msr1 deficiency significantly reduces the lung metastasis burden of breast tumors and improves survival.

[0049] In summary, MSR1 expression was significantly elevated in monocytes and macrophages of breast cancer patients, and its high expression was significantly associated with shortened overall survival in these patients. Macrophage-derived MSR1 plays a crucial role in breast cancer progression, potentially exerting its effects by regulating the pro-tumor phenotype of tumor-associated endothelial cells (TAMs). Therefore, MSR1 is an important driver of breast cancer progression and a potential drug target for breast cancer immunotherapy.

[0050] Example 2

[0051] Experimental methods:

[0052] Construction and validation of siMSR1 in vivo: Specific siRNA oligonucleotides (1#CGTGAATCTACAGCAAAGCAA; 2#GCAACTGACCAAAGACTTAAT; 3#GCAGTTCAGAATCCGTGAAAT) were designed based on highly conserved regions in the Msr1 gene coding sequence, and effective sequences that significantly reduced Msr1 expression in vitro were screened. Screening via in vitro macrophage transfection showed that sequence 1# had the most significant inhibitory effect on Msr1 mRNA and protein levels; therefore, sequence 1# (hereinafter referred to as siMSR1) was used in subsequent studies. To achieve stable in vivo delivery of siMSR1, this invention prepares it as a nanocomposite. The specific preparation method is as follows: siMSR1 is dissolved in RNase-free water to prepare a siMSR1 solution; using the cationic polymer polyethyleneimine (PEI) as the delivery carrier, the above siMSR1 solution and PEI solution are mixed at an N / P ratio (amino / phosphate ratio) of 10:1 and incubated at room temperature for 20-30 minutes, forming a stable nanotransfection complex through electrostatic self-assembly. In in vivo validation experiments, macrophages derived from peripheral tissue or tumor tissue were extracted after administration to tumor-bearing mice. RT-qPCR and Western blotting confirmed that the delivery system constructed in this invention can effectively downregulate the Msr1 transcription and protein expression levels of TAMs in vivo.

[0053] The construction of the Py8119-GFP-Luc cell line is described in Example 1. An orthotopic breast cancer model was established according to Example 1, using Py8119-GFP-Luc breast cancer cells (1.5 × 10⁻⁶). 6The cells were injected into the fourth mammary fat pad of 6-8 week old female C57BL / 6J mice. A breast cancer metastasis model was established according to Example 1: Py8119-GFP-Luc cells (2.5 × 10⁻⁶) were injected via tail vein. 5 Female C57BL / 6J mice aged 6–8 weeks were used.

[0054] Dosage Regimen: To assess the impact of MSR1 downregulation on immunotherapy sensitivity, 6-8 week old female C57BL / 6J mice were used to establish orthotopic or metastatic breast tumor models. Based on the intervention method, mice were divided into four groups: control group (Ctrl, administered via tail vein injection of PBS solution equal to siMSR1 and intraperitoneal injection of PBS solution equal to anti-PD-1 antibody), siMSR1 monotherapy group (tail vein injection of siMSR1), anti-PD-1 monotherapy group (anti-PD-1, intraperitoneal injection of anti-PD-1 antibody), and siMSR1 and anti-PD-1 combined treatment group (siMSR1 + anti-PD-1, simultaneous administration of both treatments). Interventions were administered at different time points to systematically evaluate the effects of different strategies on tumor growth, metastasis, and survival.

[0055] Specifically, siMSR1 was dissolved in 100 μL of sterile phosphate-buffered saline (PBS) solution at a dose of 10 nmol / dose. It was administered via tail vein starting one week before tumor modeling, repeated every 2–3 days until the third week after modeling. The anti-PD-1 antibody (MedChemExpress, Cat# HY-P99144) was prepared as a working solution using sterile PBS and administered intraperitoneally at a dose of 10 mg / kg every two days, starting approximately one week after tumor modeling, to maintain a stable immune checkpoint blockade state.

[0056] Monitoring primary tumor volume: From the time the tumor becomes palpable, measure the tumor's long axis (L) and short axis (W) every two days using calipers, and calculate the tumor volume V = (L × W) 2 The tumor growth curve was plotted based on the Msr1 deletion. The monitoring period was set at approximately three weeks until the preset endpoint was reached. Primary tumor weight was recorded: at the experimental endpoint, mice were euthanized, the primary tumor was removed, and its weight was measured. The obtained data were used to assess the impact of Msr1 deletion on breast tumor growth.

[0057] In vivo bioluminescence imaging (BLI) of lung metastasis burden in breast tumors: To assess changes in lung metastasis burden in breast tumors, a small animal in vivo imaging system (IVIS Spectrum) was used. Visible light in vivo imaging technology was employed to perform bioluminescence imaging on mice injected with tumor cells via the tail vein, monitoring fluorescence signals at the tumor sites. Quantitative recording of photon flux (photons / sec) in the lung region was used for comparison with Msr1. wt With Msr1 cko The extent of tumor metastasis in mice.

[0058] Survival statistical analysis: In the breast cancer lung metastasis model, mouse survival was monitored from the modeling date, and the time of death was recorded. Kaplan-Meier survival curves were plotted, and Msr1 was compared using the log-rank test. wt With Msr1 cko Survival differences in mice.

[0059] Experimental results:

[0060] (1) Compared with the control group, both siMSR1 and anti-PD-1 treatments alone showed varying degrees of tumor growth inhibition. However, compared with the single treatment group, the siMSR1 / anti-PD-1 combined treatment group showed the slowest tumor volume growth. Figure 4 (B), and the endpoint tumor weight showed a significant decreasing trend (p < 0.0001) ( Figure 4 (A) This indicates that siMSR1 combined with anti-PD-1 significantly inhibits the growth of the primary tumor, suggesting that downregulation of MSR1 can significantly enhance the anti-tumor effect of immune checkpoint inhibitors.

[0061] (2) Bioluminescence imaging (BLI) analysis showed that ( Figure 5 A): The control group had the highest lung tumor signal. Both siMSR1 and anti-PD-1 alone reduced lung photon flux. In the siMSR1 / anti-PD-1 combined treatment group, the tumor signal almost completely disappeared, and the lung weight / body weight ratio was significantly reduced (p < 0.0001). Figure 5 (B). These results suggest that downregulation of MSR1 significantly reduces the lung metastasis burden of breast tumors, and inhibiting MSR1 significantly improves the ability of immunotherapy to control metastatic lesions.

[0062] (3) In the survival analysis of the breast tumor lung metastasis model, the control group had the shortest survival time; both siMSR1 and anti-PD-1 alone showed some survival benefit; the survival time of the siMSR1 / anti-PD-1 combined treatment group was significantly prolonged, and the survival curve was significantly better than that of each single-drug treatment group (p < 0.0001), indicating that siMSR1 combined with anti-PD-1 significantly prolonged the survival time of mice. Figure 5(C). The results show that MSR1 downregulation not only enhances the anti-tumor effect of immunotherapy, but also significantly improves overall survival prognosis.

[0063] The above results indicate that MSR1 is a key molecule affecting immunotherapy sensitivity. Inhibiting MSR1 can significantly enhance the anti-tumor effect of anti-PD-1, manifested in multiple aspects such as primary tumor suppression, reduction of lung metastases, and prolongation of survival. MSR1 may be an important driving factor for immunotherapy tolerance.

[0064] In summary, macrophage-derived MSR1 plays a core regulatory role in immunotherapy response, and inhibiting MSR1 can significantly enhance the anti-tumor effect of anti-PD-1, which may be the basis for a new strategy to enhance the efficacy of tumor immunotherapy.

[0065] Example 3

[0066] Discovery and on-target validation of MSR1 inhibitors

[0067] Given that macrophages with high MSR1 expression are significantly associated with tumor invasiveness, metastasis, and treatment resistance, MSR1 can suppress anti-tumor immune responses by promoting the polarization of M2-type macrophages, thus helping tumors evade immune surveillance. MSR1 expression in tumor-associated lymphoid tissue and vascular endothelial cells may further promote tumor cell metastasis and spread. Furthermore, inhibiting MSR1 function may induce macrophage differentiation into M1-type macrophages, potentially reversing the immunosuppressive state of the tumor microenvironment and enhancing anti-tumor immune responses. Therefore, developing MSR1 inhibitors as anti-tumor drugs may enhance the efficacy of tumor immunotherapy.

[0068] Virtual screening and docking studies of small molecule MSR1 inhibitors were conducted using the LibDock and CDOCKER modules of Discovery Studio, and target confirmation was performed using surface plasmon resonance (SPR) technology. The experimental methods and results are as follows:

[0069] 1. The crystal structure of the SRCR domain of human MSR1 (PDB: 7DPX) was downloaded from the Protein Data Bank (PDB) as the receptor protein; the ligand library was selected from the FDA-approved Drug Library (covering 1729 compounds) in the Topscience Database.

[0070] 2. Remove the water of crystallization from the receptor protein structure, optimize under default parameters, and find three different binding sites in the receptor cavity (site 1: X, Y, Z = 33.3862, 38.9294, 24.8168; site 2: X, Y, Z = 33.3863, 28.4294, 23.8168; site 3: X, Y, Z = 35.6362, 40.1794, 31.0668).

[0071] 3. The Smart Minimizer algorithm and CHARMM force field were used to optimize 1729 compounds in the ligand library.

[0072] 4. Using LibDock, all optimized ligand molecules were docked to three active sites, and virtual screening was performed. The results are shown in Table 1, yielding 23 compounds (LibDock score b > 85). Based on the LibDock score, all docked ligand molecules were sorted and grouped. Ligand molecules with a LibDock score greater than 85 were selected for CDOCKER docking studies. The results are shown in Table 2, yielding 7 compounds (CDOCKER Energy < -12), namely doxylamine, abacavir, trofinetide, dexrazoxane, entecavir, guanethidine, and clavulanate.

[0073] 5. Ligand molecules with CDOCKER energies less than -12 were selected for further target confirmation using SPR technology. SPR achieves real-time, label-free monitoring of intermolecular binding events by detecting the refractive index change caused by small molecules in contact with the MSR1 fixed surface. Its response signal is expressed in response units (RU) and can be used to obtain the equilibrium dissociation constant KD (reflecting binding affinity), directly characterizing the specific binding ability and strength of candidate molecules to MSR1. Using SPR technology, four potential MSR1 inhibitors were identified (…). Figure 6The MSR1 inhibitors, namely doxylamine, trafinone, dexrazoxane, and clavulanic acid, were selected. Dexrazoxane exhibited the strongest binding affinity, with an equilibrium dissociation constant (KD) of 74.59 nM. Different concentrations of these MSR1 inhibitors were injected into the surface of an SPR chip immobilized with MSR1, and their affinity for MSR1 was assessed by monitoring real-time binding signals. Predicted binding simulations of doxylamine, trafinone, dexrazoxane, and clavulanic acid with the SRCR domain of MSR1 showed that all the aforementioned ligands could stably embed into the MSR1 binding pocket and form hydrogen bonds, electrostatic interactions, or hydrophobic interactions with key sites such as ARG31, ARG35, GLU85, VAL36, and VAL70. Figure 7 Among them, dexrazoxane forms key hydrogen bonds with ARG31 and ARG35.

[0074] In summary, four small molecule compounds that can directly target MSR1 were identified through virtual screening and SPR technology. Among them, dexrazoxane binds most tightly to MSR1 (KD = 74.59 nM) and can be used as a small molecule MSR1 inhibitor in tumor immunotherapy research.

[0075] Table 1. Virtual screening results of small molecule inhibitors targeting the SRCR domain of human MSR1 (LibDock score)

[0076] Serial Number compound CAS number LibDock Score 1 Sapropterin 69056-38-8 96.92 2 Methocarbamol 532-03-6 93.92 3 Levomilnacipran 96847-55-1 93.46 4 Duloxetine 116539-59-4 93.35 5 Abacavir 188062-50-2 91.61 6 Acyclovir 59277-89-3 91.34 7 Zileuton 111406-87-2 91.23 8 Naphazoline 835-31-4 91.21 9 Penciclovir 39809-25-1 91.15 10 Antazoline 91-75-8 91.1 11 Doxylamine 562-10-7 88.33 12 Ganciclovir 107910-75-8 88.11 13 Entecavir 142217-69-4 87.91 14 Felbamate 25451-15-4 87.74 15 Guanethidine 645-43-2 87.41 16 Tetrahydrozoline 522-48-5 87.4 17 Clavulanate 61177-44-4 86.69 18 Levalbuterol 661464-94-4 86.12 19 Cidofovir 149394-66-1 86.08 20 Rufinamide 106308-44-5 86.06 21 Trofinetide 853400-76-7 86.03 22 Dexrazoxane 24584-09-6 85.96 23 Tasimelteon 609799-22-6 85.2

[0077] Table 2. SRCR domain of MSR1 docking compound using CDOCKER

[0078] Serial Number compound CAS number CDOCKER Energy 1 Doxylamine 562-10-7 -179.88 2 Abacavir 188062-50-2 -78.42 3 Trofinetide 853400-76-7 -52.88 4 Dexrazoxane 24584-09-6 -45.94 5 Entecavir 142217-69-4 -39.33 6 Guanethidine 645-43-2 -12.82 7 Clavulanate 61177-44-4 -12.67

[0079] Example 4

[0080] 1. Obtaining and inducing mouse bone marrow-derived macrophages (BMDMs)

[0081] Complete medium (C1640): 1640 medium containing 10% FBS (Keygen Biotech, Cat# KGL1501-500).

[0082] Tumor cell conditioned medium: Py8119 cells were passaged in complete medium to 50% confluence. After 24 hours, the cell culture supernatant was collected and FBS was added to prepare a tumor cell conditioned medium containing 10% FBS.

[0083] Experimental Methods: C57BL / 6J mice were euthanized according to standard animal ethics procedures. Bilateral femurs and tibias were harvested, soft tissue was removed, and bone marrow cells were isolated. Bone marrow cells were filtered through a 100 μm filter, and erythrocytes were lysed using erythrocyte lysis buffer. Primary cells were washed with PBS. Cells were cultured for approximately 7 days in a culture system containing recombinant mouse M-CSF (R&D, Cat# 416-ML-050 / CF) (10 ng / mL M-CSF, C1640) to differentiate them into BMDMs. Primary BMDMs were stimulated with tumor cell conditioned medium for 48 hours to acquire phenotypic characteristics similar to tumor-associated macrophages.

[0084] 2. Experiment on the inhibition of macrophage-mediated tumor cell immune escape by MSR1 inhibitors

[0085] Experimental methods:

[0086] The construction of the Py8119-GFP-Luc cell line is described in Example 1. Complete culture medium containing the drugs (doxycycline, trifineptide, dexrazoxane, and clavulanic acid) was prepared (drug concentration 10 μM). In this experiment, a Msr1 knockout group was set up as a positive control. Specifically, Msr1 gene knockout mice (Msr1...) were used... cko Bone marrow-derived macrophages (BMDMs) were cultured; wild-type mice (Msr1) were used in the control group and each drug treatment group. wt BMDMs were used. After macrophages completed tumor microenvironment induction, the medium was replaced with drug-containing medium or complete medium (control treatment, Ctrl), and cultured for another 48 hours to observe the effect of MSR1 inhibition on macrophage function. Subsequently, the induced BMDMs were co-incubated with tumor cells labeled with Luc (Py8119-GFP-Luc) for 48 hours to construct a phagocytic model through short-term co-culture. After co-culture, the cells were stained to label macrophage surface molecules (such as F4 / 80), and the proportion of GFP⁺F4 / 80⁺ double-positive cells was detected by flow cytometry to quantify the phagocytic rate of macrophages on tumor cells. This system was used to evaluate the ability of macrophages to clear tumor cells by MSR1 inhibitors through MSR1 inhibition.

[0087] Experimental results: Figure 8 It can be seen that the tumor cell phagocytosis rate of macrophages in the control group was low, and Msr1 was absent (Msr1...). ckoThe dexrazoxane group showed a significantly increased phagocytic level, suggesting that MSR1 promotes macrophage-mediated immune escape. Statistical analysis showed that the percentage of macrophage phagocytosis in the dexrazoxane group was significantly higher than that in the control group (p < 0.0001), and compared with doxylamine, trifineptide, and clavulanic acid, dexrazoxane showed a stronger ability to promote phagocytosis, inhibit macrophage-mediated tumor cell immune escape, and effectively block MSR1-mediated immune escape.

[0088] 3. A combined administration experiment of dexrazoxane and anti-PD-1 drugs to evaluate the effect of dexrazoxane on the sensitivity to immunotherapy.

[0089] An in situ breast cancer model was established according to Example 1, using Py8119-Luc breast cancer cells (1.5 × 10⁻⁶). 6 The cells were injected into the fourth mammary fat pad of 6-8 week old female C57BL / 6J mice. A breast cancer metastasis model was established according to Example 1: Py8119-Luc cells (2.5 × 10⁻⁶) were injected via tail vein. 5 Female C57BL / 6J mice aged 6–8 weeks were used.

[0090] Experimental methods: 6-8 week old female C57BL / 6J mice were used to establish an in situ breast tumor model or metastatic model (refer to Example 1). According to different intervention methods, the mice were divided into control group, Msr1 deficiency group, dexrazoxane single treatment group, anti-PD-1 single drug group, and dexrazoxane and anti-PD-1 combined treatment group. Treatment was initiated via intraperitoneal injection approximately one week after tumor modeling. All drugs were prepared in PBS and administered every two days to maintain a stable immune checkpoint blockade. The dexrazoxane monotherapy group received dexrazoxane (25 mg / kg), the anti-PD-1 monotherapy group received anti-PD-1 antibody (10 mg / kg, MedChemExpress, Cat# HY-P99144S), and the dexrazoxane and anti-PD-1 combination therapy group received both dexrazoxane (25 mg / kg) and anti-PD-1 antibody (10 mg / kg, MedChemExpress, Cat# HY-P99144S) to systematically evaluate the effects of different intervention strategies on tumor growth, metastasis, and survival. The control group used wild-type C57BL / 6J mice and received an equal volume of PBS intraperitoneally. The Msr1 knockout group used Msr1 gene knockout C57BL / 6J mice and received an equal volume of PBS intraperitoneally.

[0091] Monitoring primary tumor volume: From the time the tumor becomes palpable, measure the tumor's long axis (L) and short axis (W) every 2 days using calipers, and calculate the tumor volume V = (L × W) 2 The tumor growth curve was plotted based on the Msr1 deficiency. The monitoring period was set at approximately three weeks until the preset endpoint was reached. The weight of the primary tumor was recorded: at the experimental endpoint, the mice were euthanized, the primary tumor was removed, and the tumor weight was measured. The obtained data were used to evaluate the effect of Msr1 deficiency on breast tumor growth.

[0092] In vivo bioluminescence imaging (BLI) of lung metastasis burden in breast tumors: To assess changes in lung metastasis burden in breast tumors, a small animal in vivo imaging system (IVIS Spectrum) was used. Visible light in vivo imaging technology was employed to perform bioluminescence imaging on mice injected with tumor cells via the tail vein, monitoring fluorescence signals at the tumor sites. Quantitative recording of photon flux (photons / sec) in the lung region was used for comparison with Msr1. wt With Msr1 cko The extent of tumor metastasis in mice.

[0093] Survival statistical analysis: In the breast cancer lung metastasis model, mouse survival was monitored from the modeling date, and the time of death was recorded. Kaplan-Meier survival curves were plotted, and Msr1 was compared using the log-rank test. wt With Msr1 cko Survival differences in mice.

[0094] The experimental results are as follows:

[0095] (1) As shown in Figure 9, compared with the control group, anti-PD-1 alone had limited tumor growth inhibition, while dexrazoxane alone could inhibit tumor growth. However, under the combined treatment of dexrazoxane and anti-PD-1, the growth of primary tumors was significantly inhibited, tumor volume could be reduced, and the tumor weight at the experimental endpoint was significantly lower than that of each single-drug group (p < 0.0001). These experimental results indicate that dexrazoxane can significantly enhance the anti-PD-1 anti-tumor activity after inhibiting MSR1, thereby more effectively inhibiting the growth of primary breast tumors.

[0096] (2) Bioluminescence imaging (BLI) analysis showed that ( Figure 10 A): Anti-PD-1 monotherapy has limited effect in reducing photon flux in lung metastases, while dexrazoxane monotherapy can reduce photon flux in lung metastases. However, in the dexrazoxane and anti-PD-1 combined treatment group, lung tumor signal almost completely disappeared, accompanied by a significant decrease in lung weight / body weight ratio (p < 0.0001). Figure 10B). The results of this experiment indicate that the combination of dexrazoxane and anti-PD-1 can effectively inhibit distant metastasis of breast tumors and significantly improve the immune system's ability to control metastatic lesions.

[0097] (3) The combined inhibition of dexrazoxane and anti-PD-1 significantly prolonged the survival of mice (Figure 10C). In the lung metastasis model, the control group mice had the shortest survival; both dexrazoxane and anti-PD-1 alone could prolong survival to some extent. However, the survival curve of the mice treated with the combined dexrazoxane and anti-PD-1 shifted significantly to the right, which was significantly better than each single-drug group (p < 0.0001). These experimental results indicate that dexrazoxane enhances the overall anti-cancer effect of PD-1 blockade therapy by inhibiting MSR1-mediated immune escape, thereby significantly improving the survival prognosis of breast cancer model mice.

[0098] In summary, the MSR1 inhibitor dexrazoxane plays a crucial role in anti-tumor immune regulation. By enhancing the phagocytic capacity of macrophages against tumor cells, dexrazoxane effectively blocks tumor cell immune escape. Furthermore, in primary and metastatic tumor models, the combined application of dexrazoxane and anti-PD-1 significantly inhibited tumor growth and distant metastasis, and markedly prolonged the survival of mice. These findings indicate that dexrazoxane, as a functional MSR1 inhibitor, can enhance the efficacy of immune checkpoint inhibitor immunotherapy, providing a novel therapeutic strategy for breast cancer immunotherapy.

Claims

1. The use of MSR1 inhibitors in the preparation of antitumor immune enhancers, wherein the MSR1 inhibitors are doxylamine, tripfenetide, dexrazoxane, and clavulanic acid.

2. The use according to claim 1, characterized in that: The described use is that of MSR1 inhibitors in the preparation of drugs that induce macrophages to differentiate into M1 macrophages and drive anti-tumor immunity through phagocytosis and cytokine production.

3. The use according to claim 1, characterized in that: The MSR1 inhibitor mentioned is dexrazoxane.

4. The use of MSR1 inhibitors in combination with immune checkpoint inhibitors in the preparation of drugs for treating solid tumors, wherein the MSR1 inhibitors are doxylamine, tripfenetide, dexrazoxane, or clavulanic acid, and the immune checkpoint inhibitors are PD-1 inhibitors, PD-L1 inhibitors, or CTLA-4 inhibitors.

5. The use according to claim 4, characterized in that: The MSR1 inhibitor is dexrazoxane, and the immune checkpoint inhibitor is a PD-1 inhibitor.

6. A pharmaceutical composition for the treatment of tumors, characterized in that: The pharmaceutical composition comprises an MSR1 inhibitor, an immune checkpoint inhibitor, and pharmaceutically acceptable excipients; the MSR1 inhibitor is doxylamine, tripfenetide, dexrazoxane, or clavulanic acid, and the immune checkpoint inhibitor is a PD-1 inhibitor, a PD-L1 inhibitor, or a CTLA-4 inhibitor.

7. The pharmaceutical composition according to claim 6, characterized in that: The mass ratio of the MSR1 inhibitor to the immune checkpoint inhibitor is 10:1 to 2.5:

1.

8. The pharmaceutical composition according to claim 7, characterized in that: The mass ratio of the MSR1 inhibitor to the immune checkpoint inhibitor is 2.5:

1.

9. The pharmaceutical composition according to claim 6, characterized in that: The MSR1 inhibitor is dexrazoxan, and the immune checkpoint inhibitor is a PD-1 inhibitor; preferably, the immune checkpoint inhibitor is nivolumab, pembrolizumab, toripalimab, sintilimab, camrelizumab, tislelizumab, penaprilimab, cepalimumab, slulimab, putelizumab, enronsubazine, durvalumab, atezolizumab, envolizumab, and sulfamarin. Glimemab, adebelimumab, socarzolimumab, bemosubibumab, ipilimumab, cantunilimab, ipaloli / toporelimumab, ivoximumab; more preferably, the immune checkpoint inhibitors are nivolumab, pembrolizumab, toripalimab, sintilimab, camrelizumab, tislelizumab, penaprilimab, cepalimumab, slulimab, putelimab, and enronsubibumab.

10. The pharmaceutical composition according to claim 6, characterized in that: The tumors mentioned are breast cancer, melanoma, liver cancer, kidney cancer, glioma, pancreatic cancer, nasopharyngeal carcinoma, head and neck cancer, esophageal cancer, urothelial carcinoma, gastric or gastroesophageal junction cancer; preferably breast cancer.

Images