Use of a nuak2 inhibitor in the preparation of a medicament for the prevention or / and treatment of pulmonary fibrosis

By using NUAK2 inhibitors such as WZ4003 to reduce NUAK2 protein levels and alleviate pulmonary fibrosis symptoms, the problem of existing drugs being unable to reverse pulmonary fibrosis has been solved, providing a more effective treatment option.

CN122075701APending Publication Date: 2026-05-26BINZHOU MEDICAL COLLEGE
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
BINZHOU MEDICAL COLLEGE
Filing Date
2026-02-12
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

Existing antifibrotic drugs such as nintedanib and pirfenidone can only slow down the decline in lung function, but cannot reverse or cure pulmonary fibrosis, and have significant side effects. The medical community needs to develop more effective treatments with fewer side effects based on new mechanisms.

Method used

NuAK2 inhibitors, such as WZ4003, are provided for the preparation of drugs to prevent or treat pulmonary fibrosis, which alleviate pulmonary fibrosis symptoms by reducing NUAK2 protein levels or activity.

Benefits of technology

NUAK2 inhibitors significantly reverse or alleviate symptoms of pulmonary fibrosis, such as weight loss, decreased lung compliance, alveolar structural damage, and abnormal collagen fiber proliferation, providing a novel treatment option and filling a technological gap in drug targets for pulmonary fibrosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This application discloses the use of NUAK2 inhibitors in the preparation of drugs for the prevention and / or treatment of pulmonary fibrosis, belonging to the field of medical preparation technology. The technical problem this application aims to solve is: to find and validate a novel drug target that plays a key role in pulmonary fibrosis, and to provide an intervention strategy based on this novel target with a clear therapeutic effect; specifically, to provide an effective therapeutic drug for pulmonary fibrosis. To solve this technical problem, this application provides the application of NUAK2 inhibitors in the preparation of drugs for the prevention and / or treatment of pulmonary fibrosis. This application is the first in the world to reveal that NUAK2 is a key pathogenic factor and drug intervention target for pulmonary fibrosis, and the first to propose and validate a novel use of NUAK2 inhibitors (represented by WZ4003) for the treatment of pulmonary fibrosis, filling a technological gap in this field.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of medical preparation technology, specifically relating to the use of NUAK2 inhibitors in the preparation of drugs for the prevention and / or treatment of pulmonary fibrosis. Background Technology

[0002] Pulmonary fibrosis, especially idiopathic pulmonary fibrosis (IPF), is a chronic, progressive, and fatal interstitial lung disease of unknown etiology. Its core pathology involves the abnormal activation, proliferation, and migration of pulmonary fibroblasts / myofibroblasts, leading to excessive extracellular matrix deposition, destruction of normal alveolar structure, and the formation of diffuse interstitial lung scarring. This process ultimately results in severe impairment of pulmonary ventilation and gas exchange, leading to death from respiratory failure. The median survival after diagnosis is only 3-5 years, posing a significant threat to public health.

[0003] Currently, only two classes of antifibrotic drugs are approved globally for IPF: nintedanib (a multi-target tyrosine kinase inhibitor) and pirfenidone (whose mechanism of action is not fully understood). Clinical practice shows that these two classes of drugs can only slow down the rate of decline in lung function (such as forced vital capacity) to a certain extent; they cannot reverse or cure the disease, and they have significant side effects such as diarrhea, elevated liver enzymes, photosensitivity, and gastrointestinal reactions. Therefore, the medical community urgently needs to develop new therapeutic drugs based on novel disease mechanisms that offer better efficacy and fewer side effects.

[0004] NUAK2 (also known as SNARK) belongs to the AMPK-associated serine / threonine protein kinase family. Previous studies have suggested that NUAK2 participates in regulating cellular responses to metabolic stress, energy balance, cytoskeleton remodeling, and cell growth. It has been reported to be overexpressed in certain tumor types (such as pancreatic cancer and cervical cancer) and promotes tumor cell proliferation, migration, and epithelial-mesenchymal transition. However, in the field of pulmonary fibrosis research, NUAK2 remains a completely unknown entity. To date, no publicly available scientific literature or patents have clearly revealed the expression changes and significance of NUAK2 in pulmonary fibrosis patients or disease models, the specific function of NUAK2 in pulmonary fibroblast activation and the fibrotic process, or whether intervention targeting NUAK2 can affect the occurrence and development of pulmonary fibrosis. Summary of the Invention

[0005] The technical problem this application aims to solve is: to identify and validate a novel drug target that plays a key role in pulmonary fibrosis, and to provide an intervention strategy based on this novel target with a clear therapeutic effect; specifically, to provide an effective therapeutic drug for pulmonary fibrosis. To solve this technical problem, this application provides the following technical solution:

[0006] This application provides the use of NUAK2 inhibitors in the preparation of drugs for the prevention and / or treatment of pulmonary fibrosis.

[0007] The term "NUAK2 inhibitor (also known as antagonist)" has the meaning known in the art and can refer to any substance that reduces (downregulates) the level and / or activity of the target protein NUAK2 or its gene (target gene). The inhibitor can also refer to any substance that inhibits post-translational modifications of the target gene (including phosphorylation inhibitors).

[0008] In this application, the NUAK2 inhibitor is selected from at least one of WZ4003, HTH-02-006, KHKI-01128, KHKI-01215, ON123300 and Trilaciclib, or a pharmaceutically acceptable modification or derivative thereof, a pharmaceutically acceptable salt, solvate, hydrate, polymorph, cocrystal, tautomer or isotopically labeled compound.

[0009] In this application, the CAS No. of WZ4003 is 1214265-58-3. The structural formula of WZ4003 is shown in formula (Ⅰ).

[0010]

[0011] In this application, the structural formula of HTH-02-006 is shown in formula (Ⅱ).

[0012]

[0013] In this application, the structural formula of KHKI-01128 is shown in formula (Ⅲ).

[0014]

[0015] In this application, the structural formula of KHKI-01215 is shown in formula (Ⅳ).

[0016]

[0017] In this application, the structural formula of the ON123300 is shown in formula (V).

[0018]

[0019] In this application, the CAS No. of Trilaciclib is 1374743-00-6, and its structural formula is shown in formula (VI).

[0020]

[0021] In this application, the NUAK2 inhibitor is WZ4003, or a pharmaceutically acceptable modification or derivative thereof, a pharmaceutically acceptable salt, solvate, hydrate, polymorph, eutectic, tautomer, or isotopically labeled compound.

[0022] In this application, the pharmaceutically acceptable modification or derivative of WZ4003 is HTH-02-006, and the isotopically labeled compound of WZ4003 is WZ4003-d5.

[0023] The aforementioned HTH-02-006 is a derivative obtained by replacing chlorine (Cl) in WZ4003 with iodine (I).

[0024] The aforementioned WZ4003-d5 is a deuterated isotope derivative of WZ4003, in which hydrogen (H) is replaced by deuterium (D). The structural formula of WZ4003-d5 is shown in formula (VII).

[0025]

[0026] In this application, the pulmonary fibrosis may be idiopathic pulmonary fibrosis.

[0027] In this application, the pulmonary fibrosis includes at least one of the following characteristics: (1) Weight loss; (2) Decreased lung compliance; (3) Decreased forced vital capacity; (4) Extensive destruction and collapse of alveolar structure; (5) Extensive inflammatory cell infiltration in the lung interstitium; (6) Abnormal proliferation and deposition of blue collagen fibers in lung tissue; (7) Increased NUAK2 protein content in lung tissue; (8) Increased collagen I protein content in lung tissue; (9) The content of α-smooth muscle actin in lung tissue is increased.

[0028] In this application, the aforementioned weight loss, decreased lung compliance, forced vital capacity, extensive alveolar structure destruction, massive inflammatory cell infiltration in the lung interstitium, and / or abnormal proliferation and deposition of blue collagen fibers in the lung tissue can be caused by diseases including pulmonary fibrosis.

[0029] In this application, the aforementioned weight loss, decreased lung compliance, forced vital capacity, extensive alveolar structure destruction, massive inflammatory cell infiltration in the lung interstitium, and / or abnormal proliferation and deposition of blue collagen fibers in the lung tissue can be caused by pulmonary fibrosis.

[0030] In this application, the elevated levels of NUAK2 protein, collagen I protein, and / or collagen I protein in the lung tissue may be caused by diseases including pulmonary fibrosis.

[0031] In this application, the increased levels of NUAK2 protein, collagen I protein, and / or collagen I protein in the lung tissue may be caused by pulmonary fibrosis.

[0032] In this application, the alveolar structure, interstitial inflammatory cell infiltration and / or abnormal proliferation and deposition of blue collagen fibers in the lung tissue can be detected by immunohistochemistry.

[0033] In this application, the prevention and / or treatment are described as relief.

[0034] In this application, the mitigation is manifested in at least one of the following: (1) Reversing weight loss; (2) Reverse decreased lung compliance; (3) Reversing exertion reduces vital capacity; (4) Alleviates widespread damage and collapse of alveolar structure; (5) Relieves massive inflammatory cell infiltration in the lung interstitium; (6) Alleviates abnormal proliferation and deposition of blue collagen fibers in lung tissue; (7) Reduces the elevated NUAK2 protein content in lung tissue; (8) Reduces the increased content of collagen I protein in lung tissue; (9) Reduces the increase in α-smooth muscle actin content in lung tissue.

[0035] This application also provides a pharmaceutical composition for the prevention and / or treatment of pulmonary fibrosis, wherein the active ingredient of the pharmaceutical composition includes the above-mentioned NUAK2 inhibitor.

[0036] In this application, the drug combination also contains a pharmaceutically acceptable carrier.

[0037] In practical applications, the NUAK2 inhibitor of this application can be administered directly to patients as a drug or mixed with a suitable carrier or excipient before administration to patients to achieve the purpose of preventing and / or treating pulmonary fibrosis caused by hypertension.

[0038] The carrier materials here include, but are not limited to, water-soluble carrier materials (such as polyethylene glycol, polyvinylpyrrolidone, organic acids, etc.), poorly soluble carrier materials (such as ethyl cellulose, cholesterol stearate, etc.), and enteric carrier materials (such as cellulose acetate phthalate and carboxymethyl ethyl cellulose, etc.).

[0039] These materials can be used to formulate a variety of dosage forms, including but not limited to tablets, capsules, pellets, aerosols, pills, powders, solutions, suspensions, emulsions, granules, liposomes, transdermal preparations, lozenges, suppositories, and lyophilized powder injections.

[0040] To formulate unit-dose dosage forms into tablets, a wide variety of carriers known in the art can be used. Examples of carriers include, for instance, diluents and absorbents such as starch, dextrin, calcium sulfate, lactose, mannitol, sucrose, sodium chloride, glucose, urea, calcium carbonate, kaolin, microcrystalline cellulose, aluminum silicate, etc.; humectants and binders such as water, glycerin, polyethylene glycol, ethanol, propanol, starch paste, dextrin, syrup, honey, glucose solution, gum arabic paste, gelatin paste, sodium carboxymethyl cellulose, shellac, methyl cellulose, potassium phosphate, polyvinylpyrrolidone, etc.; and disintegrants. Examples of carriers include dried starch, alginate, agar powder, brown algae starch, sodium bicarbonate and citric acid, calcium carbonate, polyoxyethylene, sorbitol fatty acid esters, sodium dodecyl sulfate, methylcellulose, and ethylcellulose; disintegration inhibitors include sucrose, tristearate, cocoa butter, and hydrogenated oil; absorption enhancers include quaternary ammonium salts and sodium dodecyl sulfate; and lubricants include talc, silica, corn starch, stearates, boric acid, liquid paraffin, and polyethylene glycol. Tablets can also be further formulated into coated tablets, such as sugar-coated tablets, film-coated tablets, enteric-coated tablets, or bilayer and multilayer tablets. Various carriers known in the art can be widely used to formulate unit-dose dosage forms into pills. Examples of carriers include diluents and absorbents such as glucose, lactose, starch, cocoa butter, hydrogenated vegetable oil, polyvinylpyrrolidone, kaolin, and talc; binders such as gum arabic, tragacanth, gelatin, ethanol, honey, liquid sugar, rice paste, or flour paste; and disintegrants such as agar powder, dried starch, alginate, sodium dodecyl sulfonate, methylcellulose, and ethylcellulose. For preparing unit-dose dosage forms into suppositories, a wide variety of carriers known in the art can be used. Examples of carriers include polyethylene glycol, lecithin, cocoa butter, higher alcohols, esters of higher alcohols, gelatin, and semi-synthetic glycerides. For preparing unit-dose dosage forms into injectable formulations such as solutions, emulsions, lyophilized powders for injection, and suspensions, all diluents commonly used in the art can be used, such as water, ethanol, polyethylene glycol, 1,3-propanediol, ethoxylated isostearyl alcohol, polyoxyethylene isostearyl alcohol, and polyoxyethylene sorbitan fatty acid esters. In addition, to prepare isotonic injection solutions, appropriate amounts of sodium chloride, glucose, or glycerol can be added to the injectable formulation. Furthermore, conventional solubilizers, buffers, pH adjusters, etc., can also be added. Additionally, if necessary, colorants, preservatives, flavorings, tasters, sweeteners, or other materials can be added to the pharmaceutical formulation.

[0041] The above dosage forms can be used for administration via injection, including subcutaneous injection, intravenous injection, intramuscular injection, and intraperitoneal injection or infusion; cavity administration, such as rectal and sublingual administration; respiratory administration, such as nasal administration; and mucosal administration.

[0042] The dosage of NUAK2 inhibitors depends on many factors, such as the nature and severity of the disease to be prevented or treated, the sex, age, weight, and individual response of the patient or animal, the route of administration, and the frequency of administration. The dosage can be administered as a single dose or in several doses, such as two, three, or four doses.

[0043] For any given patient, the specific effective therapeutic dose level must be determined based on a number of factors, including the severity of pulmonary fibrosis; the activity of the specific active ingredient used; the patient's age, weight, general health condition, sex, and diet; the timing, route of administration, and excretion rate of the specific active ingredient; the duration of treatment; medications used in combination with or concurrently with the specific active ingredient; and similar factors known in the medical field. For example, it is practiced in the art to start with a dose of the active ingredient below the level required to achieve the desired therapeutic effect and gradually increase the dose until the desired effect is achieved.

[0044] NUAK2 inhibitors can be used alone for the prevention and / or treatment of pulmonary fibrosis, or in combination with one or more anti-pulmonary fibrosis drugs. They can be used simultaneously or intermittently to improve the overall treatment effect.

[0045] This application also provides the use of NUAK2 inhibitors in the prevention and / or treatment of pulmonary fibrosis.

[0046] This application also provides a method for preventing and / or treating pulmonary fibrosis, the method comprising the step of administering an effective dose of a NUAK2 inhibitor to a subject for the prevention and / or treatment of pulmonary fibrosis.

[0047] In this application, the application, use, or method may be for the purpose of diagnosing and treating diseases.

[0048] In this application, the application, use or method may not be for the purpose of diagnosing and treating diseases, but its direct purpose is only to obtain intermediate results.

[0049] The beneficial effects achieved by this application are as follows: 1. Outstanding originality and novelty: This application reveals for the first time globally that NUAK2 is a key pathogenic factor and drug intervention target of pulmonary fibrosis, and proposes and verifies for the first time a novel use of NUAK2 inhibitors (represented by WZ4003) for the treatment of pulmonary fibrosis, filling a technological gap in this field.

[0050] 2. Solid and reliable scientific basis: This study followed a complete drug development logic chain from "target discovery and validation" to "pharmacological efficacy confirmation". In vitro experiments clarified the necessity and adequacy of NUAK2; in vivo animal experiments provided irreplaceable pharmacodynamic evidence, with multi-level and multi-indicator data, and solid conclusions.

[0051] 3. Promising Clinical Application: This application directly targets drug development. WZ4003, as a lead compound, or its structurally optimized derivatives, holds promise for development into a new generation of anti-pulmonary fibrosis drugs, providing new treatment options for clinical patients and possessing significant social value and economic potential. Attached Figure Description

[0052] Figure 1 The expression level of NUAK2 protein in a bleomycin (BLM)-induced mouse pulmonary fibrosis model.

[0053] Figure 2 Protein expression of NUAK2 in human embryonic lung fibroblasts stimulated by transforming growth factor-β1.

[0054] Figure 3 The relative expression level of the NUAK2 gene, NUAK2 protein content, cell proliferation activity, and cell migration were measured in MRC-5 cells with NUAK2 knockdown or overexpression.

[0055] Figure 4 NuAK2 inhibitors have demonstrated clear therapeutic benefits in animal models. Detailed Implementation

[0056] I. Terminology in this application: For ease of understanding this application, several terms and abbreviations used herein are defined as follows: When used in a list of two or more items, the term "and / or" means that any of the listed items can be used alone or in combination with any one or more of the listed items. For example, the expression "A and / or B" is intended to mean either or both of A and B, i.e., A alone, B alone, or a combination of A and B. The expression "A, B and / or C" means A alone, B alone, C alone, a combination of A and B, a combination of A and C, a combination of B and C, or a combination of A, B and C.

[0057] The term "comprising" is not intended to be restrictive, but rather inclusive and implies the presence of other elements besides those listed, and can be interpreted as "including but not limited to". The term "comprising" also encompasses the terms "consisting of" and "substantially consisting of". In this document, the terms "including" and "comprise" are used interchangeably.

[0058] The term "prevention" generally refers to methods implemented to prevent or delay the occurrence of a disease, condition, or symptom in a subject.

[0059] The term “treatment” generally refers to a method implemented to achieve a beneficial or desired clinical outcome. Its purpose is to slow or alleviate undesirable physiological changes or disease, or to provide a beneficial or desired clinical outcome during treatment. Beneficial or desired clinical outcomes include symptom reduction, disease severity reduction, disease state stabilization (i.e., cessation of worsening), delay or slowing of disease progression, improvement or mitigation of disease state, and / or remission (whether partial or complete, and whether detectable or undetectable). “Treatment” can also mean prolonged survival compared to the expected survival of a subject without treatment. Subjects requiring treatment include those who already have undesirable physiological changes or disease, and those who are predisposed to developing such changes or disease. Treatment may involve therapeutic agents, also referred to herein as “medicaments” or “medication,” which may be designed to help achieve the beneficial or desired clinical outcome of interest through their action. Therapeutic agents or medications can be administered to subjects via many routes, including at least intravenous and oral routes. The term “intravenous” in relation to the administration of a therapeutic agent or medication means administration of said therapeutic agent or medication into one or more veins. The term “oral” in relation to the administration of a therapeutic agent or drug means that the therapeutic agent or drug is administered via the oral cavity, such as through the mouth.

[0060] The term "effective" when applied to dosage or amount refers to an amount of compound or pharmaceutical composition sufficient to produce the desired activity when administered to a subject in need. Note that when a combination of active ingredients is administered, the effective amount of the combination may or may not include the amount of each ingredient that would be effective if administered alone. The exact amount required will vary depending on the subject, including their species, age and general condition, the severity of the condition being treated, one or more specific medications being used, the mode of administration, etc.

[0061] In this application, "subject" includes a person who is being treated or prevented as a patient. The methods described herein can be used to treat animal subjects belonging to any classification. Examples of such animals include mammals. Mammals include, but are not limited to, rodents such as mice and hamsters, and lagomorphs such as rabbits. Mammals can be carnivores, including felines (cats) and canines (dogs). Mammals can be artiodactyla, including bovines (cows) and suidae (pigs), or perissodactyla, including equines (horses). Mammals can be primates, ceboids, or simoids (monkeys) or hominids.

[0062] The phrase “pharmaceutically acceptable” used in conjunction with the compositions described herein refers to the molecular entities and other components of such compositions that are physiologically tolerable and typically do not produce adverse effects when administered to mammals (e.g., humans). Preferably, the term “pharmaceutically acceptable” means listed in recognized pharmacopoeias for use in mammals, and more particularly for use in humans.

[0063] II. Implementation Examples This application aims to overcome the shortcomings of existing technologies and address the following core issues: identifying and validating a novel drug target that plays a key role in pulmonary fibrosis; and providing an intervention strategy with clear therapeutic efficacy based on this novel target. Specifically, it explores whether NUAK2 can serve as an effective therapeutic target for pulmonary fibrosis and verifies the in vitro and in vivo efficacy of its inhibitors. Through systematic in vitro cell experiments and in vivo animal model studies, we have elucidated for the first time the pathogenic role of NUAK2 in pulmonary fibrosis and provided indisputable evidence for its potential as a therapeutic target.

[0064] The present application will now be described in further detail with reference to specific embodiments. The embodiments given are merely illustrative of the present application and are not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the present application in any way.

[0065] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0066] In the following examples, human embryonic lung fibroblasts MRC-5 (ATCC, #CCL-171) are products of the American Center for Type Culture Collection, batch number (70043598).

[0067] In the following examples, the male C57BL / 6J mice (8 weeks old, weighing 20–26 g) were products of Shandong Pengyue Experimental Animal Technology Co., Ltd., and had passed the qualification review of the Animal Ethics Committee of Binzhou Medical University. The animal ethics research approval number is: SCXK (Lu) 2022 0006.

[0068] Main Reagents and Consumables List

[0069]

[0070] In the following embodiments, the solution preparation method is as follows: (1) 0.9% NaCl solution: Dissolve 9 g NaCl in 1000 mL of ultrapure water, autoclave at 121℃ for 30 min, and store in a 4℃ refrigerator for later use.

[0071] (2) 4% paraformaldehyde solution: Weigh 40.0 g of paraformaldehyde and dissolve it in 1 L of physiological saline. Place it on a magnetic stirrer and stir until it is clear and not turbid. After sterilizing in an autoclave, store it in a refrigerator at 4℃ for later use.

[0072] (3) Bleomycin solution (BLM injection): Dissolve 15 mg of bleomycin hydrochloride for injection (product of Nippon Kayaku Co., Ltd., catalog number Y00720) in 2.5 mL of physiological saline, place it on a magnetic stirrer and stir until well mixed, and prepare it as fresh as possible.

[0073] (4) MEM complete medium: Add 500 μL each of the three additives glutamine, non-essential amino acids, pyruvic acid and penicillin / streptomycin / amphoteric B solution (100×) to a 50 mL centrifuge tube, then add MEM medium to make up to 45 mL, and then add 5 mL of serum (FBS).

[0074] (5) MEM incomplete culture medium: Add 500 μL each of the three additives glutamine, non-essential amino acids, pyruvic acid, penicillin / streptomycin / amphoteric B solution (100×) and serum (FBS) to a 50 mL centrifuge tube, and then add MEM culture medium to make up to 50 mL.

[0075] (6) TGF-β1 solution: Take one bottle of TGF-β1 lyophilized powder from the ultra-low temperature freezer, centrifuge at low speed for 1 min, dissolve in enzyme-free sterile water, and dispense 15 μL. When using, add 985 μL of MEM incomplete culture medium to the dispensing tube, seal with sealing film, Store at 20°C.

[0076] (7) 10 × TBST: Dissolve 24.5 g Tris base and 80 g NaCl in 990 mL of triple-distilled water, mix well with a stirrer, adjust the pH value with about 10 mL of concentrated HCl to pH=7.4, and store in a refrigerator at 4℃ for later use.

[0077] (8) Antibody working solution (WB): Prepare according to the recommended WB ratio for the antibody. Add a certain volume of antibody to a 15 mL centrifuge tube using 1 × TBST, mix well, and store at 4°C for later use. If not frequently used, it can be stored in a refrigerator. Store in a refrigerator at 20°C.

[0078] (9) 75% alcohol: Store 1500 mL of 95% alcohol and 400 mL of triple-distilled water at room temperature for later use.

[0079] (10) 5% milk sealing solution: skim milk powder: TBST (1×) = 1:20. Taking 120 mL as an example, weigh 6 g of skim milk powder and dissolve it in 120 mL of TBST (1×) solution. Mix well and prepare fresh before use.

[0080] (11) Electrophoresis buffer: Pour 28.96 g glycine powder, 6.1 g Tris powder and 2 g SDS powder into a graduated cylinder containing 1.8 L double distilled water, and keep the volume at 2 L. Store in a 4°C refrigerator for later use.

[0081] Unless otherwise specified, the quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0082] All data in this experiment are expressed as mean ± SD (M ± SD). Statistical analysis was performed using GraphPad Prism and one-way ANOVA was employed. A p-value < 0.05 was considered statistically significant.

[0083] Example 1, Target Discovery: NUAK2 is specifically highly expressed in pulmonary fibrosis. We first examined the expression level of NUAK2 in a multi-level pulmonary fibrosis model.

[0084] 1.1 Detection of NUAK2 expression level in animal models of pulmonary fibrosis (I) Establishment of a pulmonary fibrosis model (1) Preparation materials: BLM injection solution, nebulizer for quantitative intratracheal administration of liquid, 1 mL disposable syringe, hemostat, rodent anesthetic (2.5% Avertin solution), heating blanket, filter paper, laboratory gloves, disposable mask, etc.

[0085] (2) Six male C57BL / 6J mice aged 8 weeks and weighing 20–26 g were selected. The mice were fasted for 3 hours before the operation was performed to avoid the mice choking and dying during the modeling process.

[0086] (3) Anesthetize the mice by intraperitoneal injection of 2.5% Avertin solution (0.1 mL / 10g), place them on a heating blanket to prevent hypothermia, and when the mice are lying still, gently clamp the mice’s toes with hemostatic forceps. If there is no violent reflex movement, proceed to the next step.

[0087] (4) BLM was administered intratracheally to mice using a nebulizer for quantitative intratracheal administration. The dosage was 5 mg / kg. A fixed volume of BLM injection solution was taken according to the mouse's body weight, and physiological saline was added to a total volume of 20 μL. Day 0 of administration was recorded on the day of administration.

[0088] (5) Observe the condition of the mice, put them back in the cage in the mouse room, mark them, and provide enough food and water.

[0089] The inflammatory response period is within 7 days of BLM administration, the period of fibrosis progression is within 14 days, the period of fibrosis formation is within 21 days, and the period of fibrosis stabilization is within 28 days. Therefore, our lung function tests were scheduled for 28 days. After BLM administration, lung inflammation was observed by regularly tracking changes in body weight and using micro-CT scans in small animals.

[0090] The procedure for the sham control group (sham) was the same as that for the pulmonary fibrosis model, except that BLM in step (4) was replaced with an equal volume of physiological saline, and a total of 6 sham control mice were prepared.

[0091] (II) Detection of NUAK2 protein expression level in lung tissue by Western blot analysis (I) Lung tissue extraction On day 28 after BLM administration, mice were fixed on an operating table, and the skin of the chest and abdomen was routinely disinfected using 75% ethanol cotton balls. The skin was incised transversely from the lower abdomen and bluntly dissected to fully expose the abdominal cavity. The liver was gently dissected, and the ribs were cut to expose the heart and lungs. The right lung tissue was completely excised from the mouse, gently rinsed in physiological saline to remove surface blood, and then transferred to cryovials. After rapid freezing in liquid nitrogen, it was stored at -80 °C for subsequent tissue protein extraction.

[0092] (II) Extraction of tissue protein (1) Turn on the centrifuge and pre-cool to 4°C. Take out the ice plate from the -20°C refrigerator. Prepare a clean beaker filled with triple-distilled water / ultrapure water. Prepare autoclaved scissors, curved forceps, filter paper and 75% alcohol, several 1.5 mL EP tubes that have been autoclaved, ice plate and foam box.

[0093] (2) Prepare tissue protein lysis buffer (RIPA lysis buffer: PMSF = 98:2), protect from light, and prepare fresh before use.

[0094] (3) Transfer the cryovial containing the tissue from the cryopreservation unit to a foam box containing ice. Take it to the workbench, open the cryovial, use curved forceps to pick up the tissue, cut off a piece of tissue the size of a grain of rice with scissors, place it on filter paper to absorb the blood, transfer it to a 1.5 mL EP tube on the ice plate, and label it. When cutting different groups of tissue, it is necessary to spray with alcohol, wash with triple-distilled water, and wipe it clean with filter paper. Immediately put the remaining tissue back into the cryovial and store it in the cryopreservation unit. Add lysis buffer, cut the tissue pieces in the tube, and put them into a tissue homogenizer for 3 min.

[0095] (5) Place the EP tube containing the lysis buffer into a pre-cooled centrifuge, strictly follow the principle of "equal weight balancing" to place the EP tubes, set the centrifugation parameters to 12000 rpm, 4℃, 20 min, and start the centrifugation program; at the same time, prepare a new 1.5 mL autoclaved EP tube for later use.

[0096] (6) After centrifugation, slowly and steadily remove the EP tube and place it on an ice plate to avoid violent shaking that could cause the precipitate to suspend. Use a pipette to slowly aspirate the supernatant (protein component) from the tube and transfer it to a new 1.5 mL EP tube, labeling the sample information. The supernatant can be used directly for protein concentration determination or stored in a -20℃ freezer for later use. Note: When aspirating the supernatant, avoid the cell precipitate at the bottom of the tube. If precipitate is accidentally aspirated, return the liquid to the original EP tube, centrifuge again, and then collect the supernatant as the protein sample for protein concentration determination.

[0097] (III) Determine the protein concentration of the sample. (1) Preparation of experimental materials: Prepare 96-well plates, BCA protein concentration detection kit, 1×PBS buffer, ice plates, autoclaved 1.5 mL EP tubes, and centrifuge in advance. Ensure that all equipment is sterile and free from protein contamination.

[0098] (2) Preparation of BCA working solution: Based on the total number of wells of the sample and standard to be tested, prepare an appropriate amount of working solution according to the ratio of BCA reagent A solution: B solution = 50:1. After thorough mixing, store in the dark to avoid component failure.

[0099] (3) Sample and standard loading: Place the frozen experimental protein sample and standard protein sample on ice and thaw slowly (to prevent protein degradation); take a new 96-well plate and mark the standard loading volume (0, 2, 4, 6, 8, 12, 16, 20 μL) in the corresponding wells on the plate cap from left to right. Add the corresponding volume of standard protein to each standard well, and then add 1×PBS buffer to make up to 20 μL per well; add 4 μL of sample to each experimental protein sample well, and add 16 μL of 1×PBS buffer to make the final volume of each well 20 μL. Avoid cross-contamination during the loading process.

[0100] (4) Incubation reaction: Slowly add 200 μL of BCA working solution to each well of the 96-well plate, gently shake the plate to mix the liquid thoroughly, and be careful to avoid generating bubbles (which will affect the absorbance detection); place the 96-well plate in a 37°C environment and incubate in the dark for 30 min.

[0101] (5) Absorbance detection: Place the incubated 96-well plate into the microplate reader detection platform, open the instrument software and adjust the detection parameters, set the detection wavelength to 562 nm; designate the 0 μL standard well as the blank control (Black), and after confirming that the parameters are correct, click "Read" to start the detection and record the absorbance (OD value) of each well.

[0102] (6) Concentration calculation: Based on the amount of standard sample added (corresponding concentration) and the measured OD value, a standard curve is plotted. The concentration of each experimental protein sample is calculated through the standard curve equation, and the sample volume containing 20 μg of protein is further calculated. All detection data are recorded and saved completely.

[0103] (7) Protein sample processing: Add 1 / 4 volume of 5× Loading Buffer to each experimental protein sample, mix thoroughly, and incubate at 95℃ for 10 min (to denature the protein); the processed protein samples can be directly used for subsequent SDS-PAGE loading, or aliquoted and stored at -20℃ for later use.

[0104] (IV) Gel electrophoresis (1) Prepare SDS-PAGE gel. Take the prepared glass gel plate out of the refrigerator and let it stand at room temperature for 30 min to allow it to warm up. At this time, prepare the electrophoresis buffer. 1 L of electrophoresis buffer = 1 L of ultrapure water + 1 bottle of electrophoresis powder. Stir and mix well, and refrigerate at 4℃.

[0105] (2) Fix the glass gel plate in the electrophoresis clamp, pour in the electrophoresis solution, and slowly pull out the comb vertically. Add 5 μL of Protein Marker to both ends of the protein sample to label the protein molecular weight, and add the corresponding protein samples in the order required for the experiment.

[0106] (3) After the sample is added, transfer the electrophoresis clamp to the electrophoresis tank smoothly and slowly pour the electrophoresis solution into the tank along the side wall to prevent the sample protein from being washed out of the sample well.

[0107] (4) Cover the positive and negative electrodes with the corresponding lids, connect the electrophoresis apparatus, and set the parameters to 150V for 37 minutes; when you see bubbles rising in the vertical electrophoresis tank, the electrophoresis has started.

[0108] (V) Transfer membrane (1) Prepare the electrospinning solution: 1 L of electrospinning solution = 800 mL of ultrapure water + 1 bottle of electrospinning powder + 200 mL of anhydrous methanol, stir and mix well.

[0109] (2) Preparation: cutting plate, ultrapure water, transfer tank, several filter papers, PVDF membrane, scissors, tweezers, iron basin, ice box, electroporation solution, sandwich clamp, sponge, anhydrous methanol.

[0110] (3) Use electro-conversion fluid to pre-wet the sandwich clamps and remove air bubbles.

[0111] (4) Cut the required protein completely according to the molecular weight of the marker and transfer it smoothly onto the transfer sandwich clamp, remembering the order of the ends. Cut PVDF membranes of the same size according to the gel size, immerse them in methanol for 3 minutes to activate them. The PVDF membrane will change from opaque to translucent. Place it in a tray containing ultrapure water to check if the activation is successful. Rotation upon contact with water indicates successful activation. Place the membrane in transfer buffer and equilibrate for at least 2 minutes. Cover the cut protein gel with the membrane and label it.

[0112] (5) Place the transfer tank into an iron basin filled with ice, transfer the transfer sandwich to the transfer tank, fill the tank with electrospinning solution so that it covers the transfer sandwich, cover the safety cap according to the positive and negative poles, insert the power cable into the electrospinning instrument, adjust the parameters to 200mA, 120 min, and start electrospinning.

[0113] (VI) Milk Sealing (1) After the electro-spinning is completed, take out the strip, put it in the tray on the shaker, add TBST (1×) and wash 3 times, 5 min each time.

[0114] (2) Prepare a 5% milk sealing solution.

[0115] (3) Transfer the strip to the incubation box, pour in the milk sealing solution, and incubate on a shaker at room temperature for 2 hours.

[0116] (4) After incubation, wash with TBST (1×) 3 times, 5 min each time.

[0117] (VII) Antigen-antibody immune response (1) Prepare antibody dilution solution according to the appropriate ratio according to the antibody instructions and store at 4°C.

[0118] (2) Place the band that has ended the milk blocking process into the antibody incubation box, and add the corresponding primary antibody (β-actin antibody and...) NUAK2 antibody) dilution buffer, completely covering the band, incubate overnight at 4°C with gentle shaking (not less than 10 h).

[0119] (3) Wash with TBST (1×) 3 times, 10 min each time.

[0120] (4) Place the strip into the antibody incubation box, add the corresponding species of secondary antibody dilution solution to completely cover the strip, and incubate at room temperature with slow shaking for 1 h.

[0121] (5) Wash with TBST (1×) 3 times, 10 min each time.

[0122] (VIII) Chemiluminescence color development (1) Turn on the exposure machine and pre-cool to -30℃. While washing the membrane for the last time, prepare the ECL working solution. Mix Buffer A and Buffer B in a 1:1 ratio to form the working solution. Keep away from light. The working solution should be used immediately after fresh preparation. Do not leave it for too long, as this will affect the detection sensitivity.

[0123] (2) Use flat-tipped tweezers to hold the edge of the banded imprint membrane and remove it from the TBST (1×) buffer. Place it in the chemiluminescence imaging instrument with the protein side facing up, add ECL working solution until the imprint membrane is completely covered, incubate at room temperature for 1 min, and then perform chemiluminescence imaging.

[0124] (3) Save the image and analyze it.

[0125] Results and Analysis: Western blot analysis of fibrotic lung tissue showed that, compared with the sham control group, the expression level of NUAK2 protein was significantly upregulated in the bleomycin (BLM)-induced mouse pulmonary fibrosis model. Figure 1 ).

[0126] 1.2 Detection of NUAK2 expression level in lung fibrosis cell model (I) Preparation of a pulmonary fibrosis cell model: MRC-5 cells were resuscitated and cultured in MEM complete medium. After passage, when the cell confluence in 6.0 cm cell culture dishes reached approximately 70%, it was confirmed by observation under an inverted microscope, and subsequent intervention experiments were then carried out. The original culture medium in the culture dishes was aspirated, and 1 mL of phosphate-buffered saline (PBS) was added to gently wash the cells once. After washing, the PBS was aspirated. The control group was given 2 mL of MEM incomplete medium, and the experimental group was given 2 mL of MEM incomplete medium containing 5 ng / mL transforming growth factor-β1 (TGF-β1) working solution. The cells in each group were placed in a CO2 incubator for further culture, and the treatment time and expected sample collection time (24, 48, and 72) were accurately recorded. The cells were divided into the following groups according to different treatments, and three biological replicates were set up for each group.

[0127] 24-hour group: TGF-β1 treatment for 24 hours; 48-hour group: TGF-β1 treatment for 48 hours; 72-hour group: TGF-β1 treatment for 72 hours.

[0128] Control group (Normol): treated with MEM incomplete culture medium for 72 hours.

[0129] (II) Detection of NUAK2 protein expression level in pulmonary fibrosis cells: (I) Extraction of cell proteins (1) Observe the cell growth status and density under an inverted microscope. Prepare cell protein lysis buffer at a ratio of RIPA lysis buffer: PMSF = 100:1. After preparation, it should be stored in the dark to avoid inactivation of components.

[0130] (2) Start the centrifuge in advance and set the temperature to pre-cool to 4℃; take out the ice plate from the -20℃ refrigerator and place it on the experimental table, prepare a clean beaker (filled with ultrapure water), sterile cell scraper and filter paper, and make experimental preparations.

[0131] (3) Discard the culture medium in the cell culture flask, add 1×PBS buffer and gently wash the cells twice to remove residual culture medium and dead cells; then use a 200 μL pipette to carefully remove the remaining PBS liquid in the flask to avoid diluting the lysis buffer with residual liquid.

[0132] (4) Add an appropriate amount of the prepared protein lysis buffer to each flask, and place the culture flask in a 4°C environment for static lysis for 5 to 10 minutes. Then, use a sterile cell scraper to gently scrape the cells along the wall of the culture container in a uniform direction of "from top to bottom and from left to right" to ensure that the cells are completely removed from the container wall and fully contact the lysis buffer. Transfer the cell lysis buffer suspension to a 1.5 mL autoclaved EP tube and immediately place it on an ice plate for an ice bath. When scraping cells from different groups, the sterile cell scraper should be cleaned first and wiped clean with filter paper.

[0133] (5) Place the EP tube containing the lysis buffer into a pre-cooled centrifuge, strictly follow the principle of "equal weight balancing" to place the EP tubes, set the centrifugation parameters to 12000 rpm, 4℃, 20 min, and start the centrifugation program; at the same time, prepare a new 1.5 mL autoclaved EP tube for later use.

[0134] (6) After centrifugation, slowly and steadily remove the EP tube and place it on an ice plate to avoid violent shaking that could cause the precipitate to become suspended. Use a pipette to slowly aspirate the supernatant (protein component) from the tube and transfer it to a new 1.5 mL EP tube, labeling the sample information. The supernatant can be used directly for protein concentration determination or stored in a -20℃ freezer for later use. Note: When aspirating the supernatant, avoid the cell precipitate at the bottom of the tube. If precipitate is accidentally aspirated, return the liquid to the original EP tube, centrifuge again, and then collect the supernatant.

[0135] (II) The protein expression level in pulmonary fibrosis cells was detected by Western blotting, following the method described in Section 1.1, "(II) Detection of NUAK2 protein expression level in lung tissue by Western blotting". The primary antibodies used in the antigen-antibody immune reaction were: Collagen I antibody, NUAK2 antibody, Vimentin antibody, α-SMA antibody, and β-actin antibody.

[0136] Results and Analysis: In human embryonic lung fibroblasts (MRC-5 cells) stimulated with transforming growth factor-β1 (TGF-β1, a key pro-fibrotic factor), NUAK2 protein expression also showed a significant time-dependent increase, and its expression trend was synchronous with the increase of classic fibrosis markers (such as α-smooth muscle actin and collagen I). Figure 2 ).

[0137] Conclusion: NUAK2 is specifically activated / upregulated in a fibrotic environment, suggesting that it may be involved in the disease process.

[0138] Example 2, Target Function Validation: NUAK2 is a key factor driving lung fibroblast activation. To clarify the function of NUAK2, we conducted knockdown and overexpression experiments.

[0139] 2.1. Knock down NUAK2 to verify its functionality. (a) Knockdown of NUAK2 in MRC-5 cells In MRC-5 cells, NUAK2 expression was knocked down using specific small interfering RNA (siRNA) followed by TGF-β1 stimulation. The specific procedure is as follows.

[0140] Preparation of 50 nM small interfering RNA (siRNA) transfection reagent for 6-well plates: Prepare the siRNA solution by mixing siRNA with 1× siRNA buffer. The siRNA solution contains three siRNAs: NUAK2-human-186, NUAK2-human-27, and NUAK2-human-712, each at a concentration of 20 μM. Take 5 μL of the siRNA solution, add 35 μL of CALNPRNAi in vitro transfection reagent A, mix well, add 10 μL of CALNPRNAi in vitro transfection reagent B, mix well, incubate for 5 minutes, add 150 μL of MEM incomplete culture medium, mix well, for a total of 200 μL of liquid, labeled ①. Add ① to a 6-well plate containing 1.8 mL of MEM incomplete culture medium for MRC-5 cells. The final concentration of each siRNA is 50 nM. Perform a total of 3 replicates.

[0141] The nucleotide sequences (5' to 3') of the positive strand and translation-linked strand of NUAK2-human-186 are as follows: Justice chain: CCAUCAAGUCAAUCCGGAATT (SEQ ID NO:1, where positions 1 to 19 are ribonucleotides and positions 20 to 21 are deoxyribonucleotides); Antisense strand: UUCCGGAUUGACUUGAUGGTT (SEQ ID NO:2, where positions 1 to 19 are ribonucleotides and positions 20 to 21 are deoxyribonucleotides).

[0142] The nucleotide sequences (5' to 3') of the positive strand and translation-linked strand of NUAK2-human-27 are as follows: The positive chain is: GGCUGAUCAAGUCGCCCAATT (SEQ ID NO:3, where positions 1 to 19 are ribonucleotides and positions 20 to 21 are deoxyribonucleotides); Antisense strand: UUGGGCGACUUGAUCAGCCTT (SEQ ID NO:4, where positions 1 to 19 are ribonucleotides and positions 20 to 21 are deoxyribonucleotides).

[0143] The nucleotide sequences (5' to 3') of the positive strand and translation-linked strand of NUAK2-human-712 are as follows: The positive chain is: CCAUAAGAUCCUAGUGAAATT (SEQ ID NO:5, where positions 1 to 19 are ribonucleotides and positions 20 to 21 are deoxyribonucleotides); Antisense strand: UUUCACUAGGAUCUUAUGGTT (SEQ ID NO:6, where positions 1 to 19 are ribonucleotides and positions 20 to 21 are deoxyribonucleotides).

[0144] In the control setting, the nucleotide sequence (5' to 3') of si-NC is as follows: Justice chain: UUCUCCGAACGUGUCACGUTT (SEQ ID NO:7, where positions 1 to 19 are ribonucleotides and positions 20 to 21 are deoxyribonucleotides); Antisense strand: ACGUGACACGUUCGGAGAATT (SEQ ID NO:8, where positions 1 to 19 are ribonucleotides and positions 20 to 21 are deoxyribonucleotides).

[0145] (ii) Do not change the medium within 24 hours after adding siRNA. Perform q-PCR 24 hours later.

[0146] The detection primers used for q-PCR are shown below, with the GAPDH gene as a reference.

[0147] NUAK2-F: TGTCTTGGACAACCTCACG (SEQ ID NO: 9); NUAK2-R: GCTTTGAGCAGACCCTCAGT (SEQ ID NO: 10).

[0148] (iii) After adding siRNA, the medium was replaced with fresh MEM incomplete culture medium, and cultured for another 24 hours. Then, the protein expression level in the cells was detected according to the protein immunoblotting detection method described in Example 1. The primary antibodies used in the antigen-antibody immunoreaction were Collagen I antibody, NUAK2 antibody, Vimentin antibody, α-SMA antibody, and β-actin antibody.

[0149] (iv) Cell proliferation experiment Cell proliferation assay was performed 48 hours after siRNA addition, following the specific steps: (1) MRC-5 cells were seeded into 12-well plates, with 1 mL of seeding per well.

[0150] (2) Place the cells in a cell culture incubator for routine culture. When the cell confluence reaches about 70%, treat each group of cells according to the experimental design.

[0151] (3) After processing, the cell culture plate was placed back into the 37°C cell culture incubator and allowed to stand for equilibration for 30 min; then it was transferred to the detection platform of the IncuCyte S3 live cell real-time analysis system, the instrument working parameters were adjusted, and a dynamic monitoring program that automatically scanned once every 3 h was set.

[0152] (4) Start the IncuCyte S3 system to continuously and automatically record real-time dynamic data of cell proliferation. After the experiment, integrate, analyze and archive the obtained data.

[0153] (v) Cell scratch migration assay Cell scratch assay was performed 48 hours after adding siRNA, and the specific steps are as follows: (1) Prepare MRC-5 single-cell suspension and adjust the cell concentration to 5×10⁻⁶. 5 The cells / mL were evenly seeded into 96-well cell culture plates at an inoculum of 100 μL per well.

[0154] (2) Place the cells in a cell culture incubator for routine culture. When the cell confluence reaches about 70%, treat each group of cells according to the experimental design.

[0155] (3) Continue culturing until the cell confluence reaches 95%, then use an IncuCyte S3 Scratcher to make standard straight lines on the surface of the cell monolayer in each well of the 96-well plate.

[0156] (4) Discard the original culture medium in the well, add 1×PBS buffer and gently wash the cells twice to thoroughly remove the dead cells caused by the scratches; then replace with MEM incomplete culture medium, place the cell culture plate in a 37℃ cell culture incubator and let it stand for 30 min to equilibrate for subsequent detection.

[0157] 2.2 Overexpression experiments to verify the function of NUAK2 (a) Overexpression of NUAK2 in cells Preparation of overexpression transfection reagent (prepare fresh before use): Taking a 2mL system as an example, prepare two autoclaved 1.5mL EP tubes, labeled ① and ②. Dilute the overexpression plasmid and transfection reagent using antibiotic-free MEM incomplete medium. Tube ① contains 100μL of overexpression plasmid DNA (2 μg); tube ② contains 100μL of PEI transfection reagent (4μL). After standing for 5 min, mix the two tubes and incubate at room temperature for 15 min to allow the plasmid-PEI complex to form.

[0158] The overexpression plasmid was synthesized by Qingke Biotechnology and named pcDNA3.4-NUAK2-Flag. The structure of the overexpression plasmid involves replacing the sequences AAGCTTGGTACCGAGCTCGGATCCgccacc and TGAGGGCCCGATATCTCGAC in the pcDNA3.4 vector (provided by Qingke Biotechnology) with the DNA molecule shown in SEQ ID NO:11, while keeping the other nucleotide sequences of the backbone plasmid unchanged. Positions 1 to 1884 of SEQ ID NO:11 encode the NUAK2 protein, positions 1890 to 1956 encode the Flag gene, and positions 1957 to 1959 are stop codons.

[0159] The control group was equipped with the control plasmid OE-NC. The preparation of the control plasmid OE-NC was the same as that of the overexpression plasmids described above, except that the exogenous DNA molecule shown in SEQ ID NO:11 was replaced with the DNA molecule at positions 1890 to 1959 of SEQ ID NO:11 (only the gene encoding Flag).

[0160] During the static incubation period, discard the original cell culture medium, add 1 ml of PBS to wash the cells, discard and aspirate the PBS, add 1800 μL of antibiotic-free MEM incomplete culture medium, then gently add the plasmid-PEI complex, and return the cells to the incubator to continue culturing for 6-8 h.

[0161] Discard the culture medium, wash with 1 ml of PBS and aspirate, add 2 ml of MEM incomplete culture medium and continue culturing for 48 h until the sample is collected.

[0162] (II) Testing Protein expression levels in cells were detected using the Western blot assay method described in Example 1. The primary antibodies used in the antigen-antibody immunoreaction were: Collagen I antibody, NUAK2 antibody, Vimentin antibody, α-SMA antibody, and β-actin antibody.

[0163] Cell proliferation and cell scratch migration experiments were performed according to the methods described in section 2.1.

[0164] Results and Analysis: Transcriptional level: Real-time quantitative PCR results showed that, compared with the control group, NUAK2 transcription was significantly upregulated after TGF-β1 stimulation, and NUAK2 mRNA levels decreased after siRNA interference. Figure 3 (A)

[0165] Molecular level: Western blot results showed that, compared with the control group, NUAK2 knockdown significantly inhibited the protein expression of TGF-β1-induced fibrosis markers (α-smooth muscle actin, vimentin, and collagen I). Figure 3 (B)

[0166] Cellular function level: Real-time cell analysis showed that NUAK2 knockdown effectively inhibited the abnormal proliferation of lung fibroblasts stimulated by TGF-β1. Figure 3 (C)

[0167] Overexpression of NUAK2 in MRC-5 cells, even without strong stimulation by TGF-β1, was sufficient to induce increased protein expression of fibrosis markers (α-smooth muscle actin, vimentin, collagen I). Figure 3 (D).

[0168] Cellular function experiments further confirmed that overexpression of NUAK2 significantly enhanced the basal proliferative capacity of lung fibroblasts. Figure 3 (E).

[0169] Meanwhile, scratch healing experiments demonstrated that NUAK2 knockdown significantly slowed cell migration, while overexpression accelerated migration. Figure 3 (Middle F).

[0170] Conclusion: NUAK2 is not only a companion phenomenon in pulmonary fibrosis, but also a necessary and sufficient condition for directly driving the activation, proliferation and migration of pulmonary fibroblasts, and a key "engine" in the pathogenesis process.

[0171] Example 3, Core Efficacy Verification: NUAK2 inhibitors demonstrated clear therapeutic benefits in animal models. We used the previously reported selective NUAK2 small molecule inhibitor WZ4003 (MedChemExpress, HY-15802) to conduct a rigorous efficacy evaluation in a standard BLM-induced mouse pulmonary fibrosis model.

[0172] 3.1 Experimental Design Experimental Design: Twenty-five mice were used to create a pulmonary fibrosis model, as described in Example 1, and six mice were used as a sham control group. On day 14 of BLM administration, NUAK2 inhibitors were administered, resulting in four groups: a 10 mg / kg WZ4003 treatment group, a 20 mg / kg WZ4003 treatment group, a BLM model group (BLM+DMSO solvent control), and a sham control group (Sham). Six mice were included in each group, as detailed below: 10 mg / kg WZ4003 treatment group: On day 14 after BLM administration, WZ4003 was administered once at a dose of 10 mg / kg, with a volume of 0.2 ml, via gavage. A total of one administration was given. The day of WZ4003 administration was recorded as day 0 of administration.

[0173] 20 mg / kg WZ4003 treatment group: On day 14 after BLM administration, 20 mg / kg WZ4003 was administered once, with a volume of 0.2 ml, via gavage, for a total of 1 administration. The day of WZ4003 administration was recorded as day 0 of administration.

[0174] BLM model group (BLM+DMSO solvent control): DMSO was administered once on day 14 after BLM administration, with a volume of 0.2 ml, via gavage, for a total of 1 administration. The day of DMSO administration was recorded as day 0 of administration.

[0175] Sham group: DMSO was administered once on day 14 after saline nebulization, with a volume of 0.2 ml, via gavage, for a total of 1 administration.

[0176] In the treatment group, WZ4003 was dissolved in DMSO solvent containing corn oil (90% corn oil by volume, 10% DMSO by volume) to prepare a 2.5 mg / mL WZ4003 stock solution. During the administration phase, corn oil was used to dilute to the corresponding dosage volume.

[0177] 3.2 Detection Indicators and Detection Methods (a) Weight measurement: The weight of mice in each group was measured and recorded on days 0, 7, 14, 21 and 28 after administration of WZ4003.

[0178] (II) Lung Function Testing: Lung function indicators were tested on day 28 after WZ4003 administration. The specific procedures are as follows: (1) Preparation: The mice were fasted for 6 hours and the instruments used for material collection were sterilized by high pressure in advance.

[0179] (2) Prepare supplies: 1ml disposable syringe, mouse anesthetic (2.5% Avertin solution), laboratory gloves, disposable mask, scissors, hemostats, tweezers, surgical sutures, endotracheal tube, alcohol swabs, dry swabs, physiological saline, 4% paraformaldehyde and garbage bags, etc.

[0180] (3) Mouse anesthesia: Prepare 2.5% Avertin working solution and inject it into the peritoneum at a concentration of 0.1 mL / 10g. The appropriate depth of anesthesia is when the eyelash reflex and toe pinching reflex disappear. The next step can be carried out only after the mouse is completely anesthetized.

[0181] (4) Mouse lung function measurement: Forced vital capacity (FVC) and dynamic lung compliance were measured using the AniRes2005 animal lung function analysis system. After intraperitoneal anesthesia, mice were fixed on an operating table. The skin of the mouse neck was disinfected with an alcohol swab soaked in 75% alcohol and then cut open. The thyroid gland and surrounding tissues were bluntly dissected. A small incision was made in the trachea to insert a tracheal tube, which was then fixed with surgical sutures. The animal was then placed in a volumetric plethysmography chamber. The initial negative pressure of the instrument was set to 25 cm H2O, the respiratory rate was 60 breaths / minute, and the inspiratory-to-expiratory ratio was 20:10. The start mode was selected to automatically detect at the end of respiration. The 'Start' button was clicked to passively inhale until the set pressure value was reached, and then exhalation was initiated. Next, the 'Stop' button was clicked to complete the FVC test. Each animal's FVC was evaluated at least 5 times, and the FVC value was exported after the test. The value of dynamic lung compliance was obtained during the FVC test. The final result for the mouse was the average value after excluding the maximum and minimum data.

[0182] (III) Histological sampling and testing Sampling: After completing pulmonary function tests, mice were fixed on the operating table, and the skin of the chest and abdomen was routinely disinfected using 75% ethanol cotton balls. The skin was transversely incised from the lower abdomen and bluntly dissected to fully expose the abdominal cavity. The liver was gently dissected, and the ribs were cut to expose the heart and lungs. The right lung tissue was completely excised, gently rinsed in physiological saline to remove surface blood, and then transferred to a cryovial. After rapid freezing in liquid nitrogen, it was stored at -80 ℃ for subsequent tissue protein extraction. Next, a syringe was inserted into the right ventricle of the mouse, and physiological saline was slowly perfused until the left lung tissue turned completely white to thoroughly remove blood from the lungs. Then, 4% paraformaldehyde was perfused for tissue fixation. The left lung tissue was removed, washed with 4% paraformaldehyde, and placed in a 4 mL EP tube containing 4% paraformaldehyde fixative, stored at 4 ℃ for subsequent histological and related experimental analysis.

[0183] Tissue staining: The obtained left lung tissue of mice was dehydrated, embedded in paraffin, sectioned in paraffin, and then stained with HE and Masson staining.

[0184] Protein immunoblotting detection: The right lung tissue of mice was subjected to protein immunoblotting according to the method described in Example 1, wherein the primary antibodies used in the antigen-antibody immunoreaction were Collagen I antibody, Vimentin antibody and α-SMA antibody.

[0185] 3.3 Results and Analysis (a) Systemic indicators: Mice in the BLM model group exhibited progressive weight loss, a direct reflection of disease severity. In contrast, the weight loss in mice treated with WZ4003 was significantly alleviated, and the protective effect of the 20 mg / kg dose group was superior to that of the 10 mg / kg group, showing a clear dose-dependent effect. Figure 4 (A)

[0186] (II) Lung function indicators (evidence of core physiological function recovery): Dynamic lung compliance. The BLM model led to a severe decrease in lung compliance (reflecting lung tissue elasticity) in mice. WZ4003 treatment significantly improved this indicator in a dose-dependent manner, indicating a reduction in lung tissue stiffness. Figure 4 (B) Forced vital capacity (FVC). The BLM model led to a decrease in forced vital capacity (FVC) in mice (reflecting lung volume and ventilation capacity). WZ4003 treatment also significantly improved this indicator in a dose-dependent manner, demonstrating the recovery of lung ventilation function. Figure 4 (C)

[0187] (III) Histopathological Indicators (Direct Evidence of Structural Improvement): Hematoxylin-eosin staining and Masson's trichrome staining were performed on lung tissue. The lung tissue of mice in the BLM model group exhibited typical pathological features of severe fibrosis: extensive destruction and collapse of alveolar structures, extensive infiltration of inflammatory cells in the interstitium, and abnormal proliferation and deposition of blue collagen fibers. In the WZ4003 treatment group, especially the high-dose group, the above pathological changes were significantly alleviated: the degree of alveolar structural destruction was reduced, inflammatory infiltration decreased, and the collagen deposition area was significantly reduced. Figure 4 (E).

[0188] (iv) Western blot analysis of lung tissue samples showed a sharp increase in the expression levels of downstream fibrosis marker proteins (collagen I and α-smooth muscle actin) of NUAK2 in the BLM model group. WZ4003 treatment significantly reduced the expression levels of these proteins in a dose-dependent manner, confirming at the molecular level that the drug blocks the fibrosis signaling pathway by inhibiting the target NUAK2. Figure 4 (D).

[0189] Conclusion: The selective NUAK2 inhibitor WZ4003, in an animal model of pulmonary fibrosis, can produce a clear and dose-dependent therapeutic effect at three levels: physiological function (improved lung function), tissue structure (reduced pathological damage), and molecular expression (inhibition of fibrosis signaling) by inhibiting the target, fully verifying that "targeting NUAK2 is an effective strategy for treating pulmonary fibrosis".

[0190] The present application has been described in detail above. Those skilled in the art will recognize that the present application can be implemented in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments are given in this application, it should be understood that further modifications can be made to the present application. In summary, in accordance with the principles of this application, this application is intended to include any changes, uses, or improvements to the present application, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. Application of NUAK2 inhibitors in the preparation of drugs for the prevention and / or treatment of pulmonary fibrosis.

2. The application according to claim 1, characterized in that: The NUAK2 inhibitor is selected from at least one of WZ4003, HTH-02-006, KHKI-01128, KHKI-01215, ON123300 and Trilaciclib, or a pharmaceutically acceptable modification or derivative thereof, a pharmaceutically acceptable salt, solvate, hydrate, polymorph, cocrystal, tautomer or isotopically labeled compound.

3. The application according to claim 2, characterized in that: The NUAK2 inhibitor is WZ4003, or a pharmaceutically acceptable modification or derivative thereof, a pharmaceutically acceptable salt, solvate, hydrate, polymorph, cocrystal, tautomer, or isotopically labeled compound.

4. The application according to claim 3, characterized in that: The pharmaceutically acceptable modification or derivative is HTH-02-006, and the isotope-labeled compound is WZ4003-d5.

5. The application according to any one of claims 1-4, characterized in that: The pulmonary fibrosis mentioned is idiopathic pulmonary fibrosis.

6. The application according to any one of claims 1-5, characterized in that: The pulmonary fibrosis includes at least one of the following characteristics: (1) Weight loss; (2) Decreased lung compliance; (3) Decreased forced vital capacity; (4) Extensive destruction and collapse of alveolar structure; (5) Extensive inflammatory cell infiltration in the lung interstitium; (6) Abnormal proliferation and deposition of blue collagen fibers in lung tissue; (7) Increased NUAK2 protein content in lung tissue; (8) Increased collagen I protein content in lung tissue; (9) The content of α-smooth muscle actin in lung tissue is increased.

7. The application according to any one of claims 1-6, characterized in that: The prevention and / or treatment mentioned are for relief.

8. The application according to claim 7, characterized in that: The relief is manifested in at least one of the following: (1) Reversing weight loss; (2) Reverse decreased lung compliance; (3) Reversing exertion reduces vital capacity; (4) Alleviates widespread damage and collapse of alveolar structure; (5) Relieves massive inflammatory cell infiltration in the lung interstitium; (6) Alleviates abnormal proliferation and deposition of blue collagen fibers in lung tissue; (7) Reduces the elevated NUAK2 protein content in lung tissue; (8) Reduces the increased content of collagen I protein in lung tissue; (9) Reduces the increase in α-smooth muscle actin content in lung tissue.

9. A pharmaceutical composition for the prevention and / or treatment of pulmonary fibrosis, characterized in that: The active ingredient of the pharmaceutical composition includes any one of claims 1 to 4, the NUAK2 inhibitor.

10. The pharmaceutical composition according to claim 9, characterized in that: The drug combination also contains a pharmaceutically acceptable carrier.