Ergothioneine-producing strain with a fingerprint label

Abstract

The application discloses a fingerprint label sequence suitable for escherichia coli, which is SENCLNY or a coding gene sequence thereof. After the DNA label sequence is inserted into three gene sites ackA, marR and yobF in the genome of a ergothioneine production strain, a complex genetic mark which is difficult to remove is formed, and a synergistic enhancement effect on the ergothioneine production capacity of the strain is achieved. The application realizes integration innovation from 'trait modification' to 'property locking', and provides a new solution for industrial strain protection.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and relates to an ergothioneine-producing bacterium with a fingerprint tag. Specifically, it relates to a fingerprint tag sequence for Escherichia coli, an ergothioneine-producing high-yielding strain containing the fingerprint tag sequence, and a method for constructing the bacterium. Background Technology

[0002] Ergothioneine (EGT) is a rare, naturally occurring chiral amino acid derivative with exceptional antioxidant and cell-protective activities, showing great promise for applications in pharmaceuticals, health supplements, and cosmetics. Microbial fermentation for EGT production is currently a hot research topic; however, the selection and modification of high-yield strains require significant investment, and intellectual property protection is a core concern for its industrialization.

[0003] The protection of industrial strains currently relies mainly on trade secrets and biological material preservation. Traditional genetically engineered strains (such as those that knock out or overexpress specific genes) are relatively easy to reverse engineer and imitate due to their relatively clear genetic background. Once a strain is lost, it is often difficult to prove its unique ownership, making it difficult to protect one's rights. Summary of the Invention

[0004] To overcome the aforementioned shortcomings of existing genetically engineered strains in terms of legal protection and rights enforcement, we devised a method to embed an exclusive, stable, and easily identifiable "encrypted fingerprint" into the strain's genome. This fingerprint sequence is used to "encrypt the identity" of the industrial strains we construct and use. The precise identification of this unique genetic marker tag can be achieved through simple PCR identification, facilitating strain protection and rights enforcement in case of loss.

[0005] Therefore, based on public databases (such as NCBI NR / NT), we designed the nucleotide sequence of this encrypted fingerprint tag. Through gene chimerism experiments with various bacteria, we confirmed that one tag sequence did not adversely affect the biological morphology of the bacteria and could maintain stability and identification reliability in the host bacterial genome (such as Escherichia coli). More unexpectedly, when this tag sequence was inserted into the genome of ergothioneine-producing bacteria, such as the ETTE strain previously reported in CN120310764A, it could also improve the ergothioneine fermentation level, indicating a yield-increasing effect. Based on these experimental findings, the present invention provides the following technical solution.

[0006] The first aspect of the present invention provides a fingerprint tag sequence (fingerprint tag or encrypted tag) applicable to Escherichia coli, such as Escherichia coli MG1655 and its derivatives, which is a peptide chain Ser-Glu-Asn-Cys-Leu-Asn-Tyr, i.e., SENCLNY (SEQ ID NO: 1) or its encoding gene sequence, i.e., a fingerprint DNA tag sequence.

[0007] The fingerprint DNA tag sequence is a specially encrypted DNA sequence. By inserting a tag specific to this genus into the three genes acka, marR, and yobF of the strain, a permanent complex genetic marker that is difficult to remove is formed. It is anchored at multiple sites in the E. coli genome, and the encrypted tag can be accurately identified using a matching PCR identification system.

[0008] Preferably, the nucleotide GC content of the above-mentioned coding gene sequence, i.e., the fingerprint DNA tag sequence, is 30% to 70%, and more preferably, the nucleotide sequence of the coding gene sequence, i.e., the fingerprint DNA tag sequence, is as shown in SEQ ID NO: 2:

[0009] TCGGAATAGAATTGCCTGTACTAG (SEQ ID NO: 2).

[0010] A second aspect of the present invention provides a modified Escherichia coli strain for producing ergothioneine, which, compared with unmodified Escherichia coli, integrates the coding gene described above into its genome.

[0011] In one embodiment, the aforementioned Escherichia coli is a derivative of ergothioneine-producing Escherichia coli MG1655, preferably the ergothioneine-producing ETTE strain disclosed in patent document CN120310764A.

[0012] Preferably, the above-mentioned coding gene is integrated into any two or more of the following gene loci: ackA (2025 NCBI ID: 946775 version), marR (2025 NCBI ID: 945825 version), yobF (2025 NCBI ID: 946338 version), proV (2025 NCBI ID: 947148 version), marC (2025 NCBI ID: 947132 version), rob (2025 NCBI ID: 948916 version), and yghB (2025 NCBI ID: 947490 version); more preferably, the gene loci are ackA, marR, and yobF, forming a composite genetic marker.

[0013] The study unexpectedly found that the insertion of the three gene loci ackA, marR, and yobF into the fingerprint tag sequence had a synergistic enhancing effect on the strain's ability to produce ergothionein.

[0014] Preferably, in the above-mentioned Escherichia coli genome, the gene insertion sites of the coding genes are interposed with a gene spacer region of 300–1200 bp in length, forming a structural unit containing three or more fingerprint tag sequences, resulting in the PCR bands exhibiting fingerprint characteristics on the electrophoresis image.

[0015] A third aspect of the present invention provides a method for constructing the above-mentioned engineered Escherichia coli, comprising the following steps:

[0016] (1) Provide donor plasmid pDonor containing the above structural units; and helper plasmid pQcasTns containing sgRNA targeting ackA, marR, and yobF gene sites and Cas elements respectively;

[0017] (2) The two plasmids pDonor and pQcasTns from step (1) were co-transformed into the host strain that produces ergothionein;

[0018] (3) The structural units are sequentially integrated into the ackA, marR and yobF sites of the host strain genome using gene editing technologies such as MUCICAT (Multi-copy chromosomal integration by CRISPR-associated transposase, a bacterial chromosome multicopy integration technology based on CRISPR-associated transposases CASTs);

[0019] (4) Screen and verify the engineered strains that successfully inserted the structural unit at all three sites.

[0020] A fourth aspect of the present invention provides a method for identifying engineered *E. coli* strains as described above, comprising the following steps: performing PCR amplification on the *E. coli* genome using a single or double primer targeting the fingerprint tag sequence encoding gene sequence, i.e., the fingerprint DNA tag sequence, wherein...

[0021] The nucleotide sequence of the single primer is TCGGAATAGAATTGCCTGTACTAG (SEQ ID NO: 2);

[0022] The double primers include a forward primer Tag F and a reverse primer Tag R, with the following nucleotide sequences:

[0023] Tag F: TCGGAATAGAATTGCCTGTACTAG (SEQ ID NO: 2);

[0024] Tag R: CTAGTACAGGCAATTCTATTCCGA (SEQ ID NO: 3),

[0025] If the single or double primer initiates an amplification reaction from within or flanking the tag sequence, producing a characteristic DNA amplification fragment containing the tag sequence, such as SEQ ID NO: 2, then the engineered E. coli bacterium contains the fingerprint tag sequence.

[0026] A fifth aspect of the invention provides a system for identifying engineered *E. coli* bacteria containing fingerprint tag sequences as described above, preferably a kit comprising a single or double primer targeting the fingerprint tag sequence encoding a gene sequence, i.e., a fingerprint DNA tag sequence, wherein...

[0027] The nucleotide sequence of the single primer is TCGGAATAGAATTGCCTGTACTAG (SEQ ID NO: 2);

[0028] The double primers include a forward primer Tag F and a reverse primer Tag R, with the following nucleotide sequences:

[0029] Tag F: TCGGAATAGAATTGCCTGTACTAG (SEQ ID NO: 2);

[0030] Tag R: CTAGTACAGGCAATTCTATTCCGA (SEQ ID NO: 3).

[0031] Preferably, in addition to PCR primers, the above system may further include a nucleic acid extraction system for extracting DNA from the strain, and / or a reverse transcription system for reverse transcription into cDNA.

[0032] Furthermore, the kit also includes an instruction manual, which describes the procedures for extracting DNA, the steps for detecting the fingerprint tag sequence, and the identification criteria.

[0033] For example, the instructions can be written on bottles, test tubes and similar objects, boards, or on a separate piece of paper, or on the outside or inside of a container, such as a paper document with an operation demonstration video app download window or a QR code. The instructions can also be in multimedia form, such as a CD, USB flash drive, or cloud storage.

[0034] The sixth aspect of the present invention provides the use of engineered Escherichia coli in the fermentation production of ergothioneine.

[0035] This invention is the first to develop an encrypted tag sequence with fingerprinting function. After being inserted into specific sites in the E. coli genome, such as acka, marR, and yobF, it can be permanently anchored in the genome, forming a complex genetic marker that is difficult to remove. The marker can be accurately identified by a PCR identification system that is compatible with the encrypted tag sequence, providing a brand-new solution for the protection of industrial strains. At the same time, the tag can also promote the fermentation level of ergothionein-producing bacteria, achieving two benefits in one go and making it valuable for widespread application. Attached Figure Description

[0036] Figure 1 Electrophoresis images (single primer PCR) of the encrypted engineered strain ETTE-Tag1 after plasmid elimination, using the PCR identification system of the present invention.

[0037] Figure 2 Electrophoresis images (double primer PCR) of the encrypted engineered strain ETTE-Tag1 after plasmid elimination, using the PCR identification system of the present invention.

[0038] Figure 3 Electrophoresis images showing the verification of the engineered strain ETTE-Tag1 using the PCR identification system of the present invention.

[0039] Figure 4 A bar chart comparing the fermentation yield of ergothioneine by wild-type strain ETTE with the three-site densification engineered strains ETTE-Tag1 (inserted at acka, marR, yobF sites) and ETTE-Tag2 (inserted at marC, rob, gpr sites) constructed in this invention. Detailed Implementation

[0040] The core innovation of this invention lies in the insertion of a complex genetic encryption marker that is difficult to completely remove into multiple sites of the genome of a high-yield ergothionein strain. Through screening and comparison, an encrypted fingerprint tag that does not affect the original biological characteristics of the host bacterium *Escherichia coli* and can be stably inherited was developed. This fingerprint tag is a GC-rich (GC content 30-70%) coding gene sequence of SENCLNY, with the preferred fingerprint tag DNA sequence being SEQ ID NO: 2. This DNA tag sequence can be used as a genetic resource to encrypt and modify valuable *E. coli* strains, especially industrial strains, to construct genetically engineered bacteria with genetic fingerprint profiles.

[0041] The fingerprint tag sequence showed no significant homology in common public databases (such as NCBI NR / NT), ensuring its specificity.

[0042] The DNA tag in encrypted strains can be rapidly and accurately identified using a PCR detection system that employs specific primers designed for the encrypted tag for PCR amplification. For example, a single primer (as shown in SEQ ID NO:3) can be used, which amplifies a characteristic band in encrypted strains but not in wild-type or non-encrypted strains; alternatively, a double primer (as shown in SEQ ID NO:4 and SEQ ID NO:5) can be used, detecting multiple specific bands to determine the strain's identity. This identification method is simple to operate, provides clear results, and is inexpensive, facilitating rapid identity verification in areas such as strain preservation, contract manufacturing, and evidence collection for legal action.

[0043] The DNA tag sequence of the present invention preferably has two or more insertion sites in the genome, with a gene spacer region of 300–1200 bp between each insertion site, so that the PCR amplification band presents a unique "fingerprint pattern" on the electrophoresis image.

[0044] In one specific instance, the insertion sites of the DNA tag sequence are preferably ackA, marR, and yobF, forming a complex, multi-site genetic marker. This structure enhances the stability of the marker and the signal intensity of PCR detection.

[0045] Another finding of this invention is that after the encryption tag is inserted simultaneously into the three specific sites ackA, marR and yobF, it not only does not have a negative impact on the normal growth and metabolism of the strain, but also produces an unexpected synergistic yield-increasing effect, which enhances the strain's ability to ferment and produce ergothionein, thereby achieving the dual benefits of effectively "encrypting" and "increasing" the property rights of the strain.

[0046] The reason for the increased production effect of this encrypted tag may be that the short peptide SENCLNY (SEQ ID NO: 1) interacts with proteins related to the ergothioneine biosynthesis pathway in Escherichia coli, promoting the synthesis and secretion of ergothioneine.

[0047] It should be understood that the insertion sites of the DNA tag sequence in the genome of the present invention include, but are not limited to, ackA, marR, and yobF, and may also be other sites. Preferably, insertion at other sites can also improve the ergothioneine fermentation level of genetically engineered bacteria.

[0048] As used herein, the terms “(ergothioneine fermentation yield) increase,” “enhancement,” or “enhancement” can mean an increase of at least 10% compared to a reference level (such as a base strain / originating strain), for example, an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 100%, or at least about 1 time, or at least about 2 times, or at least about 3 times compared to a reference level.

[0049] In this article, the terms “(Escherichia coli) genetically engineered bacteria,” “engineered bacteria (strain),” “reconstructed bacteria,” and “recombinant bacteria (strain)” have the same meaning and can be used interchangeably.

[0050] Correspondingly, for ease of description, the Escherichia coli strain disclosed in patent document CN120310764A, such as the ETTE strain, can be referred to as the "wild type" or "original strain".

[0051] The insertion of the above-mentioned DNA tag sequence into multiple sites in the genome can be performed simultaneously or in one step, for example, using the MUCICAT system for gene editing; or it can be inserted in stages.

[0052] Compared with existing technologies, the engineered ergothionein strain constructed in this invention has the following significant advantages:

[0053] Trait enhancement and intellectual property locking are integrated: For the first time, the modification of high-yield trait of ergothionein is combined with the implantation of genetic encryption markers, breaking the traditional fragmented model of "modification first, protection later".

[0054] Synergistic yield-increasing effect: Insertion of specific tag structures at the ackA, marR, and yobF gene loci produced a synergistic effect, unexpectedly increasing the fermentation yield of ergothionein, proving to be a positive effect of encryption, which is superior to simple tag insertion that may have a negative effect.

[0055] High specificity and irreversibility: The designed encrypted amino acid sequence and specific nucleotide composition are highly specific. The complex insertion pattern at multiple sites (more than 3) makes it extremely difficult to completely remove all the identifiers through natural mutation or artificial manipulation, forming a difficult-to-decipher "genetic fingerprint".

[0056] Accurate and convenient identification: The matching PCR identification system is simple to operate, provides clear results, and is inexpensive, making it convenient for rapid identity verification in processes such as strain storage, contract manufacturing, and infringement evidence collection.

[0057] Potential for versatility: The MUCICAT encryption system and multi-site gene insertion strategy described herein, after adaptation, are expected to be extended to the protection of other industrial microbial strains, providing a new approach to solving common problems in the industry.

[0058] The present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0059] Example

[0060] The embodiments in this article involve the addition amount, content and concentration of various substances. Unless otherwise specified, the percentage content mentioned refers to the mass percentage content.

[0061] In the embodiments described herein, unless otherwise specified, the temperature generally refers to room temperature (15-35°C).

[0062] For experimental methods where specific conditions are not specified in the examples, follow the standard conditions or the manufacturer's recommended conditions.

[0063] Materials and methods

[0064] In the following examples, the primers and plasmids involved were synthesized by General Biotech (Anhui) Co., Ltd.

[0065] The molecular biology experiments in the examples included plasmid construction, enzyme digestion, ligation, preparation of competent cells, transformation, and culture medium preparation, etc., mainly referring to "Molecular Cloning: A Laboratory Manual" (4th Edition), edited by M.R. Green and J. Sambrook (USA), translated by He Fuchu, Science Press, Beijing, 2017. Specific experimental conditions can be determined through simple experiments if necessary.

[0066] PCR amplification experiments should be performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. Adjustments can be made through simple experiments if necessary.

[0067] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, pH 7.2 (solid medium with an additional 20 g / L agar powder).

[0068] Some of the PCR primers used in the examples are listed in Table 1.

[0069] Table 1. Some PCR primers used in the examples

[0070] Primer name sequence effect Acka-F gtaagttagtactggttctgaactgcgg Identify the acka area Acka-R tccggcatagtctggtggaacg Identify the acka area marR-F ccattgggtcgcttaatccatatgg Identify the marR region marR -R gcgtctggacatcgtcatacctc Identify the marR region yobF-F ccactggcctggaacaactgaac Identify yobF region yobF -R ctgccatcagccggagtaatgaag Identify yobF region

[0071] Note: The suffix "-F" in primer names indicates forward direction; "-R" indicates reverse direction.

[0072] Example 1: Integration of Tag at acka, marR, and yobF sites in the ETTE strain genome

[0073] 1.1 Synthesis of related plasmids

[0074] The pQcasTns-AMY and pDonor-tag plasmids were synthesized by General Biotechnology (Anhui) Co., Ltd.

[0075] in:

[0076] Sg-acka:aaaccagaactgtctgcgcagctgactgctat

[0077] Sg-marR:ccgtatgctggatcgcctggtctgtaaaggct

[0078] Sg-yobF:atgtgtggcattttcagtaaagaagtcctgag

[0079] Tag:

[0080]

[0081] The above tag sequence includes the Ser-Glu-Asn-Cys-Leu-Asn-Tyr gene encoding sequence + intergenic region (phaZ gene, a functional fragment whose role is to increase the tolerance of the integrating strain to certain compounds) + reverse sequence of the Ser-Glu-Asn-Cys-Leu-Asn-Tyr gene encoding sequence + intergenic region (terminator) + Ser-Glu-Asn-Cys-Leu-Asn-Tyr gene encoding sequence.

[0082] 1.2 The pQcasTns-AMY and pDonor-tag plasmids were introduced into the ETTE strain.

[0083] (1) Streak the ETTE strain stored at -80℃ onto LB agar plates to form single colonies;

[0084] (2) The next day, select single clones and transfer them into test tubes containing 5 ml of LB liquid culture medium. Incubate overnight at 37°C and 200 rpm.

[0085] (3) Then transfer to a 250 mL shake flask containing 50 mL LB liquid medium (transfer at 1% v / v), incubate at 200 rpm for 4 hours, and then measure OD every 10 min. 600 , to OD 600 =Approximately 0.8;

[0086] (4) Immediately place the culture in an ice water bath to cool it down as quickly as possible;

[0087] (5) The culture was then transferred to a 50 ml pre-cooled centrifuge tube and centrifuged at 4°C, 5000 rpm, for 10 min.

[0088] (6) After discarding the supernatant, suspend the bacterial cells in 40 mL of pre-cooled 10% glycerol. After suspending the bacterial cells, centrifuge at 5000 rpm for 10 min and discard the supernatant.

[0089] (7) Resuspend once more in 10% glycerol using the same method, and centrifuge at 5000 rpm for 10 min;

[0090] (8) After the last drench of glycerol (remove as much as possible), add 10% glycerol to resuspend the bacterial cells, and dispense 100 μl into 1.5 mL Ep tubes (EP tubes should be pre-cooled to -70℃).

[0091] (9) Add 100 ng pQcas4arrayts and 100 ng pDonor-tag1 to a 1.5 mL Ep tube containing 100 μl of bacterial cells.

[0092] (10) Transfer the bacterial and DNA mixture to a pre-cooled electroshock cup, gently tapping the liquid to ensure the bacterial and DNA suspension is at the bottom of the electroshock cup. Wipe away any condensation and mist outside the electroshock tank and place the electroshock cup into the electroshock apparatus.

[0093] (11) Adjust the parameters of the electric transducer to: 2.5 kV, 5.9 ms, and start the pulse.

[0094] (12) After the pulse ends, remove the sample as quickly as possible, add 0.9 ml of LB culture medium at room temperature and transfer it to a 1.5 mL sterile centrifuge tube.

[0095] (13) Place the centrifuge tubes at 30°C and incubate with gentle shaking for 2 h.

[0096] (14) Take different volumes of bacterial suspension after 2 hours of culture and spread them evenly on LB plates containing kanamycin, chloramphenicol and dehydrated tetracycline. Place the plates upside down in an incubator at 30°C and incubate overnight.

[0097] 1.3 Selection of positive transformants

[0098] The colonies grown on the above plates were identified by PCR using primers Acka-F / R, marR-F / R, and yobF-F / R.

[0099] Identification reaction system in which all three sites are successfully integrated:

[0100] 2xRapid Taq Master Mix 25μL

[0101] Gene-F 1.5μL

[0102] Gene-R 1.5μL

[0103] ddH2O 22μL

[0104] Dispense into 12.5 μL systems and use 1 μL of ddH2O mixture for identification of single colonies.

[0105] The PCR reaction parameters were as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 sec, 60℃ annealing for 1 sec; 72℃ extension for 30 sec, then back to the annealing step, for a total of 30 cycles, and 72℃ complete extension for 5 min.

[0106] The colonies grown on the above plates were identified by PCR using primers Acka-F / R, marR-F / R, and yobF-F / R, respectively.

[0107] Colony identification reaction system: If strain ETTE-Tag1 can amplify bands approximately 440 bp higher than that of strain ETTE, it indicates that integration at all three sites was successful. Figure 3 As shown.

[0108] 1.4 Elimination of positive transformant plasmids

[0109] The positive single colonies were inoculated into LB liquid medium containing glucose and sucrose and incubated overnight at 37°C. Then, they were streaked onto LB plates containing 5 g / L glucose and 10 g / L sucrose and incubated at 37°C. Next, they were spotted onto LB plates, LB plates containing chloramphenicol and LB plates containing kanamycin and incubated at 37°C. The single colonies that eliminated both plasmids were selected and the strain was named ETTE-tag1.

[0110] 1.5 Validation again after plasmid elimination

[0111] PCR amplification of strain ETTE-tag1 was performed using a single primer, tag F. Agarose gel electrophoresis results showed that strain ETTE-tag1 amplified a bright 440bp specific strip, demonstrating the effectiveness and specificity of the identification system. The electrophoresis image is shown below. Figure 1 As shown.

[0112] Single primer tag F identification reaction system for the strain:

[0113] 2xRapid Taq Master Mix 25μL

[0114] tag F 3μL

[0115] ddH2O 22μL

[0116] Dispense into 12.5 μL systems and use 1 μL of ddH2O mixture for identification of single colonies.

[0117] The PCR reaction parameters were as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 sec, 60℃ annealing for 1 sec, 72℃ extension for 15 sec, then return to the annealing step, for a total of 30 cycles, and 72℃ complete extension for 5 min.

[0118] PCR amplification of strain ETTE-tag1 was performed using double primers tag F / R. Agarose gel electrophoresis results showed that strain ETTE-tag1 amplified a bright 440bp specific strip, proving that the identification system is effective and specific. The electrophoresis images are shown below. Figure 2 As shown.

[0119] Double primer tag F / R identification reaction system for the strain:

[0120] 2xRapid Taq Master Mix 25μL

[0121] tag F 1.5μL

[0122] tag R 1.5μL

[0123] ddH2O 22μL

[0124] Dispense into 12.5 μL systems and use 1 μL of ddH2O mixture for identification of single colonies.

[0125] The PCR reaction parameters were as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 sec, 60℃ annealing for 1 sec, 72℃ extension for 15 sec, then return to the annealing step, for a total of 30 cycles, and 72℃ complete extension for 5 min.

[0126] Example 2: Integration of Tag at marC, rob, and gpr sites in the ETTE strain genome

[0127] 2.1 Synthesis of related plasmids

[0128] The pQcasMRG and pDonor-tag plasmids were synthesized by General Biotechnology (Anhui) Co., Ltd.

[0129] in:

[0130] Sg-marC:acagtgccgaacgtaatcgtcagtcgttgatg

[0131] Sg-rob: cgctcgacaatgtagcggcgaaagcaggttat

[0132] Sg-gpr: gtttacgcctgcccgcgttatcgctcggttta

[0133] The other steps are the same as in Example 1, and the strain that was verified to be correct was named ETTE-tag2.

[0134] Example 3: Determination of Ergothioneine Fermentation Performance of Encrypted Strains

[0135] Strains ETTE-Tag1, ETTE-Tag2, and ETTE were fermented in a 5L fermenter (Shanghai Baoxing).

[0136] Take 50 μL of glycerol from each strain, spread it on a 7cm × 7cm plate (chloramphenicol resistant), and incubate overnight at 37°C. Take 1 / 5000 of the bacterial cells from the plate and inoculate 80 mL / 500 ml of seed LB shake flasks, incubate at 37°C for 12 h, and OD... 600=3-5, top fermentation tank. Fermentation volume 1.6L, inoculum 5%. Fermentation at 37℃, OD 600 After reaching 50°C, the temperature was lowered to 30°C, and amino acids (histidine:cysteine:methionine = 40 g / L: 35 g / L: 70 g / L) were added as feed, along with 80% glucose monohydrate. pH was maintained at 7.0, and fermentation was carried out with zero sugar. The results are shown in Table 2 and... Figure 4 .

[0137] Table 2. Comparison of fermentation performance of different strains

[0138] Fermentation time ETTE ETTE-tag1 ETTE-tag2 24h 0.42g / L 0.51g / L 0.41g / L 31h 2.57g / L 3.15g / L 2.54g / L 48h 5.70g / L 6.84g / L 5.65 / L 55h 6.53g / L 7.85g / L 6.47g / L 72h 7.13g / L 8.55g / L 7.06g / L

[0139] Results analysis:

[0140] The ETTE-Tag1 strain (acka, marR, yobF three-point encryption) achieved an ergothioneine yield of 8.55 g / L at the fermentation endpoint (72 h), which was about 20% higher than the original strain ETTE (7.13 g / L), demonstrating a significant yield increase.

[0141] The yield of ETTE-Tag2 (marC, rob, gpr three-point encryption) is comparable to that of ETTE, indicating that the yield-increasing effect is site-specific. However, inserting a specific tag sequence into E. coli will not significantly affect the subsequent fermentation of the strain.

[0142] Table 2 shows that the fingerprint gene encryption strategy of this invention not only achieved the goal of endowing the gene fingerprint map, but also unexpectedly positively improved the ergothioneine production trait of the strain, achieving the dual effect of "fingerprint tag encryption" and "increased yield". Figure 4 ).

[0143] The specific embodiments of the present invention have been described above, but the scope of protection of the present invention is not limited to the specific embodiments described above. Those skilled in the art can make various changes or modifications within the scope of the claims, which do not affect the substantive content of the present invention.

Claims

1. A fingerprint tag sequence applicable to Escherichia coli, such as Escherichia coli MG1655, which is the peptide chain Ser-Glu-Asn-Cys-Leu-Asn-Tyr, i.e., SENCLNY (SEQ ID NO: 1) or its encoding gene sequence.

2. The fingerprint tag sequence as described in claim 1, characterized in that, The nucleotide GC content of the coding gene sequence, i.e., the fingerprint DNA tag sequence, is 30% to 70%, and preferably the nucleotide sequence of the coding gene sequence, i.e., the fingerprint DNA tag sequence, is as shown in SEQ ID NO: 2: TCGGAATAGAATTGCCTGTACTAG (SEQ ID NO: 2).

3. A modified Escherichia coli strain for producing ergothioneine, characterized in that, Compared to unmodified Escherichia coli, its genome integrates the coding genes as described in claim 1 or 2.

4. The engineered Escherichia coli strain as described in claim 3, characterized in that, The *Escherichia coli* is a derivative of ergothioneine-producing *Escherichia coli* MG1655, preferably the ergothioneine-producing ETTE strain disclosed in patent document CN120310764A.

5. The engineered Escherichia coli strain as described in claim 3, characterized in that, The coding gene is integrated into any two or more of the following gene loci: ackA (2025 NCBI ID: 946775), marR (2025 NCBI ID: 945825), yobF (2025 NCBI ID: 946338), proV (2025 NCBI ID: 947148), marC (2025 NCBI ID: 947132), rob (2025 NCBI ID: 948916), and yghB (2025 NCBI ID: 947490); the preferred gene loci are ackA, marR, and yobF.

6. The engineered Escherichia coli strain as described in claim 3, characterized in that, The genome contains a 300–1200 bp spacer region between each insertion site of the coding gene, forming a structural unit containing more than three fingerprint tag sequences.

7. A method for constructing engineered Escherichia coli as described in claim 5 or 6, characterized in that, Includes the following steps: (1) Provide a donor plasmid pDonor containing the structural unit described in claim 6; and an auxiliary plasmid pQcasTns containing sgRNA targeting ackA, marR, and yobF gene sites and Cas elements respectively; (2) The two plasmids pDonor and pQcasTns from step (1) were co-transformed into the host strain that produces ergothionein; (3) The structural units are sequentially integrated into the ackA, marR and yobF sites of the host strain genome using gene editing technology; (4) Screen and verify the engineered strains that successfully inserted the structural unit at all three sites.

8. A method for identifying engineered *Escherichia coli* strains according to any one of claims 3-6, characterized in that, The process includes the following steps: using a single or double primer targeting the fingerprint tag sequence encoding gene sequence, i.e., the fingerprint DNA tag sequence, to perform PCR amplification on the *E. coli* genome, wherein... The nucleotide sequence of the single primer is TCGGAATAGAATTGCCTGTACTAG (SEQ ID NO: 2); The double primers include a forward primer Tag F and a reverse primer Tag R, with the following nucleotide sequences: Tag F: TCGGAATAGAATTGCCTGTACTAG (SEQ ID NO: 2); Tag R: CTAGTACAGGCAATTCTATTCCGA (SEQ ID NO: 3), If the single primer or double primer initiates the amplification reaction from within or flanking the tag sequence, producing a characteristic DNA amplification fragment containing the tag sequence, it indicates that the engineered E. coli contains the fingerprint tag sequence.

9. A system for identifying engineered *Escherichia coli* bacteria containing a fingerprint tag sequence as described in any one of claims 3-6, preferably a kit, characterized in that... This includes single or double primers that target the fingerprint tag sequence encoding the gene sequence, i.e., the fingerprint DNA tag sequence, wherein... The nucleotide sequence of the single primer is TCGGAATAGAATTGCCTGTACTAG (SEQ ID NO: 2); The double primers include a forward primer Tag F and a reverse primer Tag R, with the following nucleotide sequences: Tag F: TCGGAATAGAATTGCCTGTACTAG (SEQ ID NO: 2); Tag R: CTAGTACAGGCAATTCTATTCCGA (SEQ ID NO: 3).

10. Use of the engineered Escherichia coli strain according to any one of claims 3-6 in the fermentation production of ergothioneine.

Images