Influenza b virus ha protein mutants and vaccine applications thereof

Abstract

The application belongs to the technical field of biology and specifically relates to a mutant of HA protein of influenza B virus Victoria and vaccine application thereof. The amino acid sequence of the mutant of HA protein of influenza B virus Victoria comprises an amino acid sequence obtained by amino acid mutation at at least one of positions 142, 151, 159, 165, 177-179, 196, 209, 215 and 291 of the sequence shown in SEQ ID NO:2, and has great potential as a broad-spectrum antigen to cope with continuous variation of influenza B virus Victoria.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a mutant of the HA protein of influenza B virus and its vaccine application. Background Technology

[0002] Influenza virus is the primary pathogen causing influenza in humans, infecting hundreds of millions of people globally each year and causing a severe disease burden. Among the population, the main influenza viruses causing seasonal epidemics include influenza A (H1N1), influenza A (H3N2), and influenza B (Victoria) virus. The HA protein on the surface of the influenza virus is responsible for binding to host cell receptors and is the main antigen that stimulates the host to produce neutralizing antibodies; therefore, it is also a major component of influenza vaccines. Due to the high variability of the influenza virus genome, the HA gene is prone to point mutations, known as antigenic drift, or gene exchange between HA segments of different viruses, resulting in reassortant viruses, known as antigenic shift. Both of these forms of mutation lead to continuous changes in the antigenicity of the HA protein. To cope with the continuous mutation of the virus, influenza vaccines need to be updated annually. The World Health Organization (WHO) analyzes the predominant circulating strains reported by various countries each year and recommends the most prevalent influenza virus strain for the season in both the Northern and Southern Hemispheres as the vaccine strain. However, the HA protein mutates rapidly, and the vaccine strain often mismatches with the actual circulating strains in various countries and regions, resulting in the protection efficiency of the influenza vaccine being less than 40% for many years. Even with annual updates to the vaccine antigen, it is difficult to improve the protection efficiency. There is an urgent need to develop a new vaccine technology platform with broad-spectrum cross-protection capabilities.

[0003] Despite the various broad-spectrum vaccine design strategies proposed by the scientific community, no broad-spectrum influenza vaccine products have yet been commercialized. On the one hand, antigens designed based on conserved epitopes have limited protective effects against each circulating strain due to insufficient immunogenicity, exhibiting broad-spectrum but not specific protection. On the other hand, antigens designed based on the principle of circulating strain prediction do not have broad-spectrum effects against historical strains or future strains other than the predicted strains, exhibiting specific but not broad-spectrum protection. The research of the inventors' team, along with increasing evidence, suggests that designing antigens based on the virus's own evolutionary patterns can achieve a "both specific and broad-spectrum" protective effect. This is because, in order to adapt to the host, viruses undergo convergent mutations in key epitopes and functional regions. Amino acid variations with advantageous functions (such as key sites for receptor binding and key sites for antibody evasion) are inherited by progeny viruses and amplified and retained in the population, while immutable functional regions remain unchanged in progeny viruses. Therefore, finding convergent sites in viral evolution and achieving coverage of high-frequency variant sites in the strain database holds promise for obtaining vaccine antigens with broad-spectrum protective effects.

[0004] Influenza B virus is mainly divided into the B / Victoria lineage (BV) and the B / Yamagata lineage (BY). Before 2020, the BV and BY lineages alternated in circulation. However, after 2020, human-to-human transmission of the BY lineage disappeared, while human-to-human transmission of BV continued, indicating a lineage shift in the impact of the influenza B epidemic. This may be because the antigenic evolution rate of the BV lineage increased significantly after 2020 (Zeng Z et al, Infect Dis Poverty, 2024; DOI: 10.1186 / s40249-024-01218-z), enabling BV strains to acquire resistance to the pathogenic spectrum fluctuations caused by SARS-CoV-2. It is precisely because of the accelerated evolution of BV antigens after SARS-CoV-2 that the probability of mismatch between recommended BV vaccine strains and circulating strains has increased, posing a significant challenge to BV vaccine recommendations. Sequence evolution analysis of all BV lineage strains in the GISAID database from 1985 to 2023 revealed that the BV lineage has evolved into four distinct branches: Branch 1 is dominated by strains prevalent from 1985 to 2016; Branch 2 by strains prevalent from 2017 to 2018; Branch 3 by strains prevalent from 2019 to 2020; and Branch 4 by strains prevalent from 2021 to 2023. Figure 1 The evolutionary distance between the above four branches is greater than 6 amino acids, indicating significant antigenic differences between the branches. From 2022 to 2026, the WHO-recommended BV vaccine strain for the Northern Hemisphere has been the B / Austria / 1359417 / 2021 strain, without any rapidly evolving BV-responsive strains. This vaccine strain is located on branch 4 of the phylogenetic tree, far from branches 1, 2, and 3. Figure 1 This indicates that the vaccine strain may have mismatches with other strains. Therefore, it is necessary to develop a vaccine antigen with broad-spectrum characteristics, capable of inducing immune responses against different strains, and with a stable production process, based on the actual epidemiological situation of accelerated evolution of BV antigens. Summary of the Invention

[0005] This invention employs the principle of antigen evolution calculation and integrates multiple calculation methods to calculate the amino acid sequences of the HA protein of all influenza B Victoria strains from 1985 to 2023, a total of 39 years. It successfully obtained a broad-spectrum sequence pan-B / Victoria(pre-19), which can cover strains from different years (including branch 1 and branch 2) before 2019. This sequence has 9 amino acid mutations compared with the vaccine recommended strain B / Austria / 1359417 / 2021. Of the nine amino acid mutations mentioned above, the amino acid mutation sequence containing three of these sites is named pan-B / Victoria (post-19), which can cover strains from different years after 2019 (including branches 3 and 4); the amino acid mutation sequence containing one of these sites is named pan-B / Victoria (post-21), which can enhance the protection of strains from 2020 onwards; the amino acid mutation sequence containing five of these sites is the necessary amino acid combination for pan-B / Victoria (pre-19) to protect strains from different years before 2019 (including branches 1 and 2), and it has been determined that the amino acid mutations at at least two of these sites are particularly critical.

[0006] Using the above five sequences as templates, this invention developed five subunit vaccines against the type B Victoria influenza virus.

[0007] On one hand, the present invention provides a mutant influenza B virus HA protein comprising an antigenic peptide; the amino acid sequence of the antigenic peptide is selected from either (a) or (b) below: (a) An amino acid sequence comprising the amino acid sequence shown in SEQ ID NO: 2, and obtained by mutating an amino acid at at least one of the following positions: position 142, position 151, position 159, position 165, positions 177-179, position 196, position 209, position 215, and position 291, wherein the amino acid mutation includes at least one of the following: substitution, deletion, and / or insertion of amino acids; (b) A sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with the sequence defined in (a) and having the same amino acid residues at positions 142, 151, 159, 165, 177-179, 196, 209, 215, and 291 as the sequence defined in (a).

[0008] In some embodiments, the antigenic peptide comprises at least one of the following mutations: T142A, E151K, L159P, K165N, insert 177-179KND, E196G, D209N / E, R215K, and K291R.

[0009] In some embodiments, the antigenic peptide contains T142A, E151K, L159P, K165N, insert 177-179KND, E196G, D209N, R215K, and K291R mutations.

[0010] In some embodiments, the antigenic peptide contains T142A, L159P, and R215K mutations.

[0011] In some embodiments, the antigenic peptide comprises at least one of the following mutations: T142A, L159P, R215K mutation and optional E151K, K165N, insert 177-179KND, E196G, D209N / E, K291R mutation.

[0012] In some implementations, the antigenic peptide contains the D209E mutation.

[0013] In some implementations, the antigenic peptide contains the D209N mutation.

[0014] In some embodiments, the antigenic peptide comprises at least one of the following mutations: D209E mutation and optional T142A, E151K, L159P, K165N, insert 177-179KND, E196G, R215K, or K291R mutation.

[0015] In some embodiments, the antigenic peptide contains E151K, K165N, insert 177-179KND, E196G, and K291R mutations.

[0016] In some embodiments, the antigenic peptide comprises at least one of the following mutations: E151K, K165N, insert 177-179KND, E196G, K291R, and optionally T142A, L159P, D209N / E, R215K.

[0017] In some embodiments, the antigenic peptide contains E151K, insert 177-179KND mutations.

[0018] In some embodiments, the antigenic peptide comprises at least one of the following mutations: E151K, insert 177-179KND mutation, and optionally T142A, L159P, K165N, E196G, D209N / E, R215K, and K291R mutation.

[0019] In some specific embodiments, the antigenic peptide contains T142A, E151K, L159P, K165N, insert177-179KND, E196G, D209N, R215K, and K291R mutations.

[0020] In some specific implementations, the antigenic peptide contains T142A, L159P, and R215K mutations.

[0021] In some specific embodiments, the antigenic peptide contains the D209E mutation.

[0022] In some specific embodiments, the antigenic peptide contains E151K, K165N, insert 177-179KND, E196G, and K291R mutations.

[0023] In some specific embodiments, the antigenic peptide contains E151K and insert 177-179KND mutations.

[0024] In some embodiments, the antigenic peptide comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the sequence shown in SEQ ID NO: 4, 6, 8, 10, or 12.

[0025] In some preferred embodiments, the amino acid sequence of the antigenic peptide is the sequence shown in SEQ ID NO: 4, 6, 8, 10 or 12.

[0026] In some embodiments, the influenza B virus HA protein mutant further comprises one or more peptides selected from the transmembrane domain and the intracellular domain.

[0027] In some specific embodiments, the influenza B virus HA protein mutant is based on the sequence shown in SEQ ID NO: 2, and the HA protein mutant contains an antigenic peptide containing a combination of mutation sites: T142A, E151K, L159P, K165N, insert 177-179KND, E196G, D209N, R215K, K291R.

[0028] In some specific embodiments, the influenza B virus HA protein mutant is based on the sequence shown in SEQ ID NO: 2, and the HA protein mutant contains an antigenic peptide containing a combination of mutation sites: T142A, L159P, and R215K.

[0029] In some specific embodiments, the influenza B virus HA protein mutant is based on the sequence shown in SEQ ID NO: 2, the HA protein mutant comprising an antigenic peptide containing the mutation site D209E.

[0030] In some specific embodiments, the influenza B virus HA protein mutant is based on the sequence shown in SEQ ID NO: 2, and the HA protein mutant contains an antigenic peptide containing a combination of mutation sites: E151K, K165N, insert 177-179KND, E196G, K291R.

[0031] In some specific embodiments, the influenza B virus HA protein mutant is based on the sequence shown in SEQ ID NO: 2, and the HA protein mutant contains an antigenic peptide containing a combination of mutation sites: E151K, insert 177-179KND.

[0032] In some specific embodiments, the influenza B virus HA protein mutant is based on the sequence shown in SEQ ID NO: 2, and the HA protein mutant contains a combination of mutation sites: T142A, E151K, L159P, K165N, insert177-179KND, E196G, D209N, R215K, K291R, and its amino acid sequence is shown in SEQ ID NO: 4.

[0033] In some specific embodiments, the influenza B virus HA protein mutant is based on the sequence shown in SEQ ID NO: 2, and the HA protein mutant contains a combination of mutation sites: T142A, L159P, R215K, and its amino acid sequence is shown in SEQ ID NO: 6.

[0034] In some specific embodiments, the influenza B virus HA protein mutant is based on the sequence shown in SEQ ID NO: 2, the HA protein mutant comprising an antigenic peptide containing a mutation site D209E, the amino acid sequence of the antigenic peptide being shown in SEQ ID NO: 8.

[0035] In some specific embodiments, the influenza B virus HA protein mutant is based on the sequence shown in SEQ ID NO: 2, and the HA protein mutant contains a combination of mutation sites: E151K, K165N, insert 177-179KND, E196G, K291R, and its amino acid sequence is shown in SEQ ID NO: 10.

[0036] In some specific embodiments, the influenza B virus HA protein mutant is based on the sequence shown in SEQ ID NO: 2, and the HA protein mutant contains the combination of mutation sites: E151K, insert 177-179KND, and its amino acid sequence is shown in SEQ ID NO: 12.

[0037] On the other hand, the present invention relates to a recombinant protein comprising the aforementioned mutant of the HA protein of the influenza B virus, wherein the mutant of the HA protein of the influenza B virus is linked to the original signal peptide of the HA protein or other optional signal peptide.

[0038] In some implementations, the influenza B virus HA protein mutant removes the original HA protein signal peptide and then links it to other optional signal peptides.

[0039] In some implementations, the other optional signal peptide is directly linked to the influenza B virus HA protein mutant, or indirectly linked via a linker.

[0040] In some embodiments, the other optional signal peptide is inserted into the amino terminus (N-terminus) of the influenza B virus HA protein mutant.

[0041] In some preferred embodiments, the other optional signal peptide is directly linked to the amino terminus (N-terminus) of the influenza B virus HA protein mutant.

[0042] In some preferred embodiments, the other optional components include an immunoglobulin κ chain signal peptide, a tissue plasminogen activator (tPA) signal peptide, and a signal peptide of human differentiation cluster 5 (CD5) protein.

[0043] In some preferred embodiments, the other optional signal peptide is the CD5 signal peptide, whose amino acid sequence is shown in SEQ ID NO: 14.

[0044] In some preferred embodiments, the recombinant protein comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the sequence shown in SEQ ID NO: 18, 20, 22, 24, or 26.

[0045] In some preferred embodiments, the recombinant protein comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the sequence shown in SEQ ID NO: 18, 20, 22, 24, or 26, and having at least one of the following positions: positions 142, 151, 159, 165, 177-179, 196-198, 209-211, 215-217, or 291-293, having the same amino acid residues as the sequence shown in SEQ ID NO: 18, 20, 22, 24, or 26.

[0046] In some specific embodiments, the amino acid sequence of the recombinant protein is shown as SEQ ID NO: 18, 20, 22, 24 or 26.

[0047] In some specific embodiments, the antigenic peptide of the mutant HA protein of the recombinant protein of the influenza B virus contains a combination of mutation sites: T142A, E151K, L159P, K165N, insert 177-179KND, E196G, D209N, R215K, and K291R.

[0048] In some specific embodiments, the antigenic peptide of the mutant HA protein of the recombinant protein of the influenza B virus contains a combination of mutation sites: T142A, L159P, and R215K.

[0049] In some specific embodiments, the antigenic peptide of the mutant HA protein of the recombinant protein of the Victorian influenza B virus contains the mutation site D209E.

[0050] In some specific embodiments, the antigenic peptide of the mutant HA protein of the recombinant protein of the Victorian influenza B virus contains mutation sites E151K, K165N, insert 177-179KND, E196G, and K291R.

[0051] In some specific embodiments, the antigenic peptide of the mutant HA protein of the recombinant protein of the influenza B virus includes the mutation sites E151K and insert 177-179KND.

[0052] In some specific embodiments, the recombinant protein comprises a combination of mutation sites: T142A, E151K, L159P, K165N, insert 177-179KND, E196G, D209N, R215K, K291R, the amino acid sequence of which is shown in SEQ ID NO: 18.

[0053] In some specific embodiments, the recombinant protein comprises a combination of mutation sites: T142A, L159P, and R215K, the amino acid sequence of which is shown in SEQ ID NO: 20.

[0054] In some specific embodiments, the recombinant protein contains the mutation site D209E, and the amino acid sequence of the antigenic peptide is shown in SEQ ID NO: 22.

[0055] In some specific embodiments, the recombinant protein contains mutation sites E151K, K165N, insert 177-179KND, E196G, and K291R, and its amino acid sequence is shown in SEQ ID NO: 24.

[0056] In some specific embodiments, the recombinant protein contains mutation sites E151K and insert 177-179KND, and its amino acid sequence is shown in SEQ ID NO: 26.

[0057] In some embodiments, the recombinant protein further comprises a polymerizing element.

[0058] In some implementations, the polymerizing element is directly linked to the influenza B virus HA protein mutant, or indirectly linked via a linker.

[0059] In some preferred embodiments, the polymerizing element is inserted into the carboxyl terminus (C-terminus) of the influenza B virus HA protein mutant.

[0060] In some preferred embodiments, the polymerizing element is indirectly connected to the carboxyl terminus (C-terminus) of the influenza B virus HA protein mutant via a linker.

[0061] In some preferred embodiments, the polymerizing element is a trimerizing domain of T4 phage fibrin, the amino acid sequence of which is shown in SEQ ID NO: 28.

[0062] The linker can be a flexible linker, such as a short peptide rich in G and S (e.g., G, GG, GS, GGS, GSG, GGG, GGGS, (GGS)n, (GGGGS)n, etc.); it can also be a linker with a certain degree of rigidity, such as a helical linker rich in EAAAK repeats; or it can be a hybrid linker to balance flexibility and spatial distance.

[0063] In some preferred embodiments, the linker amino acid sequence is as shown in SEQ ID NO: 30.

[0064] In some further preferred embodiments, the amino acid sequence of the recombinant protein is any one of SEQ ID NO: 34, 36, 38, 40 or 42.

[0065] On the other hand, the present invention relates to a nucleic acid molecule that encodes the aforementioned mutant or recombinant protein of the type B Victoria influenza virus HA protein.

[0066] In some preferred embodiments, the nucleotide sequence of the nucleic acid molecule is a codon-optimized sequence.

[0067] In some more preferred embodiments, the nucleotide sequence of the nucleic acid molecule is any one of the sequences shown in SEQ ID NO: 3, 5, 7, 9, 11, 17, 19, 21, 23, 25, 33, 35, 37, 39 or 41.

[0068] On the other hand, the present invention relates to an expression vector comprising the aforementioned nucleic acid molecules.

[0069] In some preferred embodiments, the expression vector is based on a eukaryotic expression plasmid.

[0070] In some preferred embodiments, the eukaryotic expression plasmid is KS001, pcDNA3.1, or pCAGGS.

[0071] On the other hand, the present invention relates to a cell comprising the aforementioned nucleic acid molecules or expression vectors.

[0072] In some preferred embodiments, the cells are eukaryotic cells.

[0073] In some preferred embodiments, the cell is a mammalian cell.

[0074] In some further preferred embodiments, the cells are HEK293 cells, CHO cells, or derived cells thereof.

[0075] In some particularly preferred embodiments, the cells are HEK293F cells or CHO-K1 cells.

[0076] On the other hand, the present invention relates to a vaccine comprising the aforementioned recombinant protein, nucleic acid molecule or expression vector.

[0077] In some preferred embodiments, the vaccine further comprises a pharmaceutically acceptable adjuvant, carrier, diluent, or excipient.

[0078] On the other hand, the present invention relates to the use of the aforementioned influenza B virus HA protein mutant, recombinant protein, nucleic acid molecule, expression vector or cell in the preparation of vaccines for the prevention and / or treatment of influenza virus infection, or in the preparation of drugs for the prevention and / or treatment of related diseases caused by influenza virus, or in the preparation of reagents or kits for the diagnosis and / or screening of influenza virus infection.

[0079] In some preferred embodiments, the influenza virus is influenza B (Victoria) virus.

[0080] On the other hand, the present invention relates to a method for in vitro detection of influenza virus for non-diagnostic purposes, comprising the step of contacting the sample to be tested with the aforementioned HA protein mutant, recombinant protein, nucleic acid molecule, expression vector or cell.

[0081] In some preferred embodiments, the influenza virus is influenza B (Victoria) virus.

[0082] Compared with the prior art, the present invention has at least the following beneficial effects: (1) For the first time, a broad-spectrum sequence of HA protein that can cover the evolutionary characteristics of influenza viruses of different evolutionary branches in the Victoria lineage was calculated; (2) Through systematic structural design, the computationally obtained broad-spectrum sequence can be correctly folded and stably expressed in vitro as a protein with a natural trimer structure; (3) The use of recombinant protein vaccine technology avoids the unpredictable side effects that may occur during the transcription and translation of nucleic acid vaccines in vivo, and significantly improves safety; at the same time, it overcomes the limitations of nucleic acid vaccines that rely on electric shock inoculation or liposome delivery, and is more conducive to large-scale production and clinical promotion. (4) By introducing amino acid substitutions or insertions at specific positions of HA proteins (such as multiple combinations of 9 / 3 / 1 / 5 / 2 sites), broad-spectrum neutralizing epitopes can be systematically exposed and stabilized.

[0083] (5) By using a codon optimization strategy, the expression level of the broad-spectrum HA sequence in mammalian cells can be increased by more than 4 times compared with the unoptimized version, which can directly reduce the unit cost of industrial production and significantly improve production efficiency. (6) By inserting T4 trimerizing elements into the HA stalk region, the trimerization ratio of recombinant protein is increased, effectively maintaining the native conformation of the antigen and enhancing immunogenicity; (7) The above improvements have a synergistic effect in three aspects: antigen epitope design, immunogenicity enhancement and structural stability, which significantly enhances the broad-spectrum protective ability of the vaccine: the introduction of broad-spectrum sites at the sequence level exposes or stabilizes broad-spectrum neutralizing epitopes and improves the immune system's ability to recognize antigens in a broad spectrum, thereby ensuring a broad-spectrum effect at the source of antigen design; through codon optimization and the application of trimer elements, the expression level of recombinant proteins is further improved and their natural three-dimensional conformation is restored, providing a reliable guarantee for the effectiveness of the vaccine; (8) The developed vaccine can effectively cover multiple viral evolutionary branches, solve the vaccine mismatch problem caused by viral mutation, and provide a reliable technical path for the development of a broad-spectrum vaccine for influenza B (Victoria) influenza. (9) Mutant HA protein and its vaccine have the characteristics of high expression level, high purity and excellent stability, making them suitable for large-scale production and clinical application. Attached Figure Description

[0084] The accompanying drawings, which are incorporated in and form part of this specification, illustrate embodiments consistent with this specification and, together with the description, serve to explain the principles of this specification.

[0085] Figure 1 The positions of the three computed sequences in the phylogenetic tree of the HA protein of influenza B virus Victoria are shown.

[0086] Figure 2 The broad-spectrum neutralizing activity of mouse serum immunized with the pan-B / Victoria (pre-19)-T4 recombinant subunit vaccine was demonstrated.

[0087] Figure 3 The broad-spectrum neutralizing activity of mouse serum immunized with the pan-B / Victoria (post-19)-T4 recombinant subunit vaccine was demonstrated.

[0088] Figure 4 The broad-spectrum neutralizing activity of mouse serum immunized with the pan-B / Victoria (post-21)-T4 recombinant subunit vaccine was demonstrated.

[0089] Figure 5 Three computed sequences were shown to be differentially expressed at the HA protein of influenza B virus compared to the B / Austria / 1359417 / 2021 vaccine strain.

[0090] Figure 6 Pan-B / Victoria (pre-19) is shown. 2mutBroad-spectrum neutralizing activity of mouse serum immunized with the -T4 recombinant subunit vaccine. Detailed Implementation

[0091] I. Definition In this invention, unless otherwise stated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, the terms and laboratory procedures related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, and immunology used herein are all widely used terms and routine procedures in their respective fields. To better understand this invention, definitions and explanations of relevant terms are provided below. It should be understood that this invention is not limited to specific methods, reagents, compounds, compositions, or biological systems, and variations thereof are certainly possible. It should also be understood that the terminology used in this application is for describing specific embodiments only and is not intended to be limiting.

[0092] As used herein, the terms “a” and “an” as well as “the” and similar pronouns indicate singular and plural, unless otherwise specified herein or the context clearly contradicts them.

[0093] As used herein, unless otherwise stated, the terms "about" or "approximately" mean within 10% of a given value or range. Where an integer is required, the term means within 10% of a given value or range, rounded up or down to the nearest integer. All disclosures of ranges in this invention should be considered as disclosures of all subranges and all point values ​​within the range. For example, a disclosure of 1-1000 should be considered as also disclosing ranges such as 1-200, 200-300, and point values ​​such as 200, 300, 400, 500, 600, 700, 800, 900, and 1000.

[0094] As used herein, the conjunction term “and / or” between multiple described elements is understood to include both individual and combined options. For example, the phrase “A, B and / or C” is intended to cover each of the following: A, B and C; A, B or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0095] As used herein, the term "identity" refers to the degree to which two or more amino acid sequences, after alignment, have identical amino acid residues at the same positions. Amino acid identity can be expressed as a percentage and can also be used to assess the similarity and homology between sequences. In this invention, amino acid sequences can undergo certain changes in identity without substantially affecting their biological activity.

[0096] As used herein, the term "mutation" refers to any alteration that occurs in a nucleic acid sequence or amino acid sequence. Such alterations to the amino acid sequence include, but are not limited to, substitution, deletion, and / or insertion of one or more amino acid residues, whereby the amino acid composition of the amino acid sequence can be altered without substantially affecting its biological activity. For example, an amino acid sequence may contain one or more conserved amino acid substitutions. A conserved amino acid substitution is the substitution of one amino acid residue by another amino acid residue with a similar side chain. Amino acid residues are classified in the literature according to the nature of their side chains. Basic side chain amino acid residues include lysine, arginine, and histidine; acidic side chain and amide side chain amino acid residues include aspartic acid, glutamic acid, asparagine, and glutamine; small aliphatic, nonpolar, or weakly polar side chain amino acid residues include glycine, alanine, threonine, serine, and proline; large aliphatic, nonpolar side chain amino acid residues include leucine, isoleucine, and valine; aromatic amino acid residues include phenylalanine, tryptophan, and tyrosine; and sulfur-containing side chain amino acid residues include cysteine ​​and methionine. Such substituted amino acid residues may or may not be encoded by the genetic code. Conservative substitutions in which an amino acid is replaced by another amino acid belonging to the same group fall within the scope of this invention, provided that the substitution does not lead to the inactivation of the bioactivity of the polypeptide compound.

[0097] As used in this article, amino acid substitutions are represented by the following naming convention: original amino acid—position number—substituted amino acid. For example, threonine (Thr) at position 142 is substituted with alanine (Ala), which can be represented as "T142A".

[0098] As used in this article, amino acid insertion or deletion, as a form of amino acid sequence alteration, also falls under the category of "mutation" mentioned above. Amino acid insertions or deletions can be represented using the following naming convention: insert or del—position number—inserted or deleted amino acid, where the position number indicates the position of the inserted or deleted amino acid. For example, inserting a lysine (Lys) after the original 176th amino acid, resulting in the insertion position being 177, can be represented as "insert 177K". When multiple amino acid residues are inserted at the same position, the inserted amino acids are listed sequentially according to their insertion order, using the naming convention: insert—position number—inserted amino acid 1—inserted amino acid 2. For example, inserting three new amino acids—lysine (Lys), asparagine (Asn), and aspartic acid (Asp)—after the original 176th amino acid, resulting in the insertion positions being 177-179, can be represented as "insert 177-179KND".

[0099] In this paper, when the same amino acid sequence contains multiple mutations (including substitution, deletion, and insertion), each mutation site is defined independently with reference to the original amino acid sequence. The numbering of each mutation site is not affected by the sequence length or site shift caused by other mutations (such as amino acid insertion or deletion). For example, for the amino acid sequence shown in SEQ ID NO: 2, if three new amino acids, lysine (Lys), asparagine (Asn), and aspartic acid (Asp), are inserted after the 176th amino acid, and glutamic acid (Glu) at the 196th position is replaced by glycine (Gly), then the substitution of the 196th amino acid is defined based on the original sequence site of SEQ ID NO: 2, and is not affected by the shift in sequence position caused by the aforementioned amino acid insertion mutation. Therefore, this mutated sequence can be represented as a peptide containing the insert 177-179KND and E196G mutations.

[0100] Those skilled in the art will understand that one or more amino acid residues in a polypeptide compound can be altered (replaced, deleted, truncated, or inserted) at the free amino terminus and / or free carboxyl terminus while retaining its functional activity. Therefore, polypeptide compounds that alter one or more amino acid residues at both ends while retaining their desired functional activity are also within the scope of this invention. In some embodiments of this invention, sequences of the HA protein of the influenza B virus (Victoria bacillus) designed based on viral evolutionary principles are provided. These sequences can achieve the expected immunogenicity enhancement and broad-spectrum protective effect of this invention. It is understood that when the HA protein is mutated at any one or more of the nine mutation sites—T142A, E151K, L159P, K165N, insert 177-179KND, E196G, D209N / E, R215K, and K291R—its broad-spectrum immune effect can be enhanced. Those skilled in the art can select or adjust mutation combinations according to actual needs. All changes not explicitly listed but conforming to the above core design logic fall within the protection scope of this invention.

[0101] As used herein, the terms “nucleic acid,” “nucleotide,” and “polynucleotide” are used interchangeably to refer to deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and polymers thereof in single-stranded, double-stranded, or multi-stranded form. This term includes, but is not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and / or pyrimidine bases or other natural, chemically modified, biochemically modified, non-natural, synthetic, or derived nucleotide bases. In some embodiments, nucleic acids may include mixtures of DNA, RNA, and the like. The term also covers nucleic acids containing known analogs of natural nucleotides that have similar binding properties to a reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. “Nucleic acid” is used interchangeably with “gene,” “DNA,” and “mRNA” encoded by a gene.

[0102] As used herein, the term "vector" or "expression vector" refers to a segment of DNA extracted from a virus, plasmid, or cell of a higher organism, into which a foreign DNA fragment may be inserted or has been inserted for cloning and / or expression purposes. In some embodiments, the vector can be stably maintained in the organism. A vector may contain, for example, an origin of replication, a selection marker or reporter gene, such as antibiotic resistance or GFP, and / or a multiple cloning site (MCS). The term includes linear DNA fragments (e.g., PCR products, linear plasmid fragments), plasmid vectors, viral vectors, granules, bacterial artificial chromosomes (BACs), yeast artificial chromosomes (YACs), and the like.

[0103] As used herein, the term "codon optimization" is a method in genetic engineering that improves gene expression by altering synonymous codons based on an organism's codon preferences. As used herein, "improvement" means that a codon-optimized nucleotide sequence used in non-natural cells produces more protein than a non-codon-optimized natural nucleotide sequence. As used herein, "nucleotide sequence" describes the expression of the complete protein or any sequence within the same framework as an amino acid epitope or as the complete protein in a vector.

[0104] As used herein, the terms "cell" and "host cell" are used interchangeably in this invention and refer to a cell that expresses or is capable of expressing the sequence to be expressed. The host cells of this invention express polynucleotides encoding polypeptides or RNA that have a variety of uses, including biotechnology, molecular biology, and clinical applications. Host cells include prokaryotic or eukaryotic cells, and examples of suitable host cells in this invention include, but are not limited to, bacterial and fungal cells.

[0105] As used herein, the term "antigen" refers to any substance that elicits an immune response. For example, the immune response may involve the activation of specific immune cells or an immune reaction such as antibody production. In this invention, the antigen may comprise a protein, a peptide, or a nucleic acid molecule encoding said protein or peptide.

[0106] As used herein, a "peptide" refers to a short-chain molecule composed of two or more amino acids linked sequentially by peptide bonds. It typically consists of approximately 2 to 50 amino acid residues, has a small molecular weight, and generally lacks the complex tertiary structure of a complete protein, but may retain specific biological activities, such as antigenicity, receptor binding, or signal regulation. In certain contexts, the term often specifically refers to a continuous segment derived from a particular protein that has functional or structural significance, such as antigenic peptides used in vaccine design or immunogenic peptides used in antibody preparation in some embodiments of this invention.

[0107] As used herein, the term "antigen peptide" refers to a molecular segment derived from a protein component that is capable of inducing an immune response, including full-length antigens and / or any portion capable of triggering the desired immune response (e.g., functional fragments of the antigen). Those skilled in the art will understand that antigen fragments obtained by removing regions such as signal peptides, transmembrane domains, or intracellular domains, or recombinant proteins further incorporating functional modules such as polymerizing elements, can still retain the immunogenic properties of natural or artificial antigens and elicit an immune response against them. In some embodiments of the invention, "antigen peptide" specifically refers to a mutant fragment of the influenza B virus HA protein that does not contain a signal peptide, transmembrane domain, or intracellular domain.

[0108] As used herein, the term "vaccine" refers to a biological agent that provides acquired immunity against a specific infectious disease. Vaccines typically contain factors similar to pathogenic microorganisms and are usually made from a weakened or killed form of the microorganism, its toxins, or one of its surface proteins. Vaccines produced using recombinant DNA technology are called recombinant vaccines. Recombinant vaccines can be produced using many different methods. These types of vaccines are made with the assistance of expression systems such as bacteria, insects, yeast, plants, mammals, and cell-free organisms. While various types of vaccines can be prepared using gene recombination technology, recombinant vaccines can be divided into two main categories. Nucleic acid vaccines typically consist of a fragment of genetic nucleic acid containing a protein encoding a disease factor. Typically, plasmid DNA used as the vaccine antigen is propagated in bacteria (such as E. coli) and then isolated and purified for injection (usually intramuscular or intradermal). The principle behind nucleic acid vaccines is that the fragment of genetic nucleic acid encoding a disease factor protein directs host cells to express the antigen, mimicking viral infection and evoking an immune response in the host. Recombinant (protein subunit) vaccines are subunit vaccines containing only a portion of the pathogen. Typically, these are synthetic peptides representing protein components that induce an immune response. However, they can also consist of protein subunits (antigens) expressed in heterologous expression systems (E. coli, yeast, insects, etc.) using recombinant protein expression technology. Prokaryotic expression systems used for vaccine antigen production include bacteria such as E. coli, while eukaryotic systems include mammalian, yeast, or insect cells. Several factors must be considered before selecting the appropriate system for vaccine antigen expression. Among these, expression levels, selection markers, and the presence or absence of post-translational modifications are important factors that interfere with the efficacy of recombinant antigens used as vaccines.

[0109] As used herein, "adjuvant" refers to a substance that can be any immunomodulatory substance capable of being combined with a peptide or nucleic acid vaccine to enhance, improve, or otherwise modulate the immune response of a subject without causing harmful effects on the subject. Non-limiting examples of adjuvants that can be used in the vaccines of this invention include the RIBI adjuvant system, alum, mineral gels such as aluminum hydroxide gel, oil-in-water emulsions, water-in-oil emulsions such as Freund's complete and incomplete adjuvants, block copolymers, QS-21, SAF-M, AMPHIGENTM adjuvants, saponins, Quil A or other saponin fractions, monophospholipid A, and avridin lipid-amine adjuvants. Adjuvants may also include other immunomodulators in the vaccine, such as one or more interleukins, interferons, or other known cytokines.

[0110] As used herein, the term "signal peptide" refers to a class of amino acid sequences located at the amino terminus (N-terminus) of a protein that mediate the secretory or membrane transport pathways of nascent polypeptide chains into the host cell, thereby guiding the protein's proper localization, processing, or secretory expression within the cell. The signal peptide typically contains a hydrophobic amino acid sequence that can be cleaved by the host cell's signal peptidase during protein transport or secretion, or retained as part of the protein. Examples of signal peptides include, but are not limited to, human or animal-derived signal peptides, viral-derived signal peptides, and artificially designed signal peptides, such as the immunoglobulin κ chain signal peptide, tissue plasminogen activator (tPA) signal peptide, and the signal peptide of human differentiation cluster 5 (CD5) protein. In some embodiments, the signal peptide can be replaced without affecting the functional activity of the protein. In some embodiments, the influenza B virus HA protein mutant removes the original HA protein signal peptide and links it to another optional signal peptide.

[0111] As used herein, the term "multimerizing element" refers to a class of amino acid sequences or domains that, through their structural properties, mediate specific interactions between protein molecules to form stable homologous or heterologous multimers. Examples of multimerizing elements include, but are not limited to, the trimerizing domain (Foldon domain, T4 trimerizing element) of T4 phage fibrin, the trimerizing domain of collagen, the B subunit of cholera toxin, leucine zippers, and artificially designed multimerizing elements. Multimerizing elements can be directly fused to mutants or linked via linkers. These linkers may contain one or more amino acid residues (or amino acid polymers) and are, for example, 1-20 amino acids in length. In some embodiments of the invention, the linker consists of 1-10 amino acids linked by peptide bonds, typically flexible linker peptides such as GGSGGS composed of amino acids such as glycine (G) and serine (S).

[0112] Those skilled in the art will understand that when constructing protein-based vaccine technologies, the introduction of polymerizing elements typically only affects the polymerization state and stability of the protein, without altering its functional essence as a core antigen. Therefore, regardless of whether the technology contains polymerizing elements, as long as the core active ingredient is the influenza B virus HA protein as defined in this invention, the expected core functions such as immunogenicity can be achieved. Some embodiments of this invention provide both recombinant HA proteins containing polymerizing elements and technologies that do not introduce polymerizing elements but retain only the structure of the HA protein itself. Both can meet the application requirements of enhanced immunogenicity or broad-spectrum protection. Technicians can flexibly choose whether to use polymerizing elements based on actual production processes (such as host expression system compatibility), product stability requirements, or application scenarios (such as vaccine formulations). All technologies not explicitly listed but using the HA protein as the core active ingredient as defined in this invention, regardless of whether they contain polymerizing elements, fall within the protection scope of this invention.

[0113] II. Detailed Implementation Plan For the purpose of clarity and concise description, features are described herein as part of some identical or separate embodiments; however, it will be understood that the scope of the invention may include some embodiments having a combination of all or some of the features described.

[0114] Example Example 1: Design and Performance Evaluation of pan-B / Victoria (pre-19) 1.1 Sequence design for pan-B / Victoria (pre-19) The full-length amino acid sequences of the human influenza B (B / Victoria) HA protein from January 1, 1985 to August 20, 2023 were downloaded from the NCBI database, totaling 5156 sequences after deduplication. A phylogenetic tree was constructed using MEGA 7.0 software via neighbor-joining, revealing that the HA protein from 1985 to 2023 can be divided into four branches (…). Figure 1The sequence characteristics of each branch are as described above: Branch 1 is dominated by strains prevalent from 1985-2016, Branch 2 by strains prevalent from 2017-2018, Branch 3 by strains prevalent from 2019-2020, and Branch 4 by strains prevalent from 2021-2023. The evolutionary distance between branches is greater than 6 amino acids. To obtain a broad-spectrum sequence covering different branches, the Clustal Omega algorithm was used to calculate a consensus sequence covering all four branches. This sequence needed to cover convergent sites in the evolution of the viruses in the four branches and cover high-frequency mutation sites in the strain database. To ensure that the selected high-frequency mutation sites have convergent frequencies in the population, the carrying frequency threshold of the variant amino acids in the algorithm was set to >50%. Amino acids with a frequency threshold >50% were integrated to obtain the broad-spectrum sequence pan-B / Victoria(pre-19). In the phylogenetic tree, pan-B / Victoria(pre-19) is located on branch 2, close to branch 3, suggesting that it is closer to the evolutionary midpoint of the entire sequence on the phylogenetic tree, and therefore may have better broad-spectrum potential. As described in the background art, the WHO-recommended Northern Hemisphere vaccine strain B / Austria / 1359417 / 2021 for 2022-2026 is located on branch 4 of the phylogenetic tree, close to branch 3, but far from branches 1 and 2 (…). Figure 1 ).

[0115] 1.2 Modification of expression elements of pan-B / Victoria (pre-19) To ensure the secretory expression of the HA protein encoded by the pan-B / Victoria(pre-19) gene into the supernatant, the transmembrane and intracellular domains of the HA protein were deleted in this invention. To improve the secretory expression efficiency of the HA protein, the natural signal peptide of the HA protein was replaced with the CD5 signal peptide (SEQ ID NO: 13). To improve the expression efficiency of the recombinant HA protein in mammalian cells, the pan-B / Victoria(pre-19) gene sequence was optimized using mammalian cell-preferred codons using ExpOptimizer software. To improve the trimerization efficiency of the HA protein, the nucleotide sequence encoding the T4 trimerizing element (SEQ ID NO: 27) was linked to the 3' end of the gene using GGSGGS-Linker (SEQ ID NO: 29). After the above modifications and optimizations, this invention finally obtained a gene capable of efficiently secreting and expressing trimer HA protein: the pan-B / Victoria(pre-19)-T4 gene (SEQ ID NO: 33). The corresponding gene was cloned into the mammalian cell expression vector KS001 (Zhongshan Kangtianshenghe Biotechnology Co., Ltd.) to obtain the eukaryotic expression plasmid of HA protein, named pan-B / Victoria(pre-19)-T4.

[0116] The specific steps of molecular cloning experimental methods are as follows: (1) Polymerase chain reaction: Polymerase chain reaction (PCR) was carried out using KOD plus neo DNA polymerase (Toyobo (Shanghai) Biotechnology Co., Ltd.). The reaction system and reaction conditions are shown in Table 1 and Table 2.

[0117] Table 1. KOD plus neo PCR reaction system Table 2. KOD plus neo PCR reaction conditions (2) Purification of the target fragment: After the PCR reaction, add 6×DNA Loading Buffer to the PCR product in an equal proportion, mix well, and add to the agarose gel electrophoresis wells. Select a suitable DNA Marker according to the size of the target fragment, and perform agarose gel electrophoresis at 120 V for 30 min. After electrophoresis, place the gel under a gel imaging system for development, and determine whether the size of the target band is correct by comparison with the DNA Marker. If the band is correct, cut the gel with a knife and put it into a 1.5 mL EP tube for recovery. Use the Gel Extraction Kit (Omega) for gel recovery.

[0118] (3) Enzyme digestion of PCR products and vectors: The PCR products and expression vector plasmids were double-digested using restriction endonuclease I and restriction endonuclease II (Thermo Fisher Fast Digest, Thermo Fisher). The reaction system is shown in Table 3.

[0119] Table 3. Enzyme digestion system After the above reaction system is prepared, it is placed in a 37 ℃ water bath for 15-60 min to react.

[0120] The digested vector should be subjected to agarose gel electrophoresis together with the undigested plasmid. If the digested product bands are delayed, they should be recovered and purified. The PCR product does not need to be subjected to agarose gel electrophoresis. DNA purification can be performed directly using the Gel Extraction Kit (Omega).

[0121] (4) Ligation of the expression vector and the target fragment: After enzyme digestion and recovery, the expression vector and the target fragment were ligated using T4 DNA ligase (Thermo Fisher). The reaction system is shown in Table 4.

[0122] Table 4. T4 ligase reaction system To ensure ligation efficiency, the expression vector and the target fragment were ligated at a molecular ratio of 1:3, and the reaction system was placed in a 22 °C metal bath for 30 min for ligation.

[0123] (5) Transformation: DH5α competent cells were used to transform the ligation product into the cells by heat shock. After resuscitation and culture, the cells were plated on resistance plates for screening.

[0124] (6) Identification of positive colonies: Pick 3-5 single colonies from the plate and place them in 500 μL of LB medium with the same resistance as the vector. Incubate at 220 rpm and 37 ℃ for 4 h. Use 2×Es Taq MasterMix (Kangwei Century Biotechnology Co., Ltd.) to identify positive clones by bacterial culture PCR. The bacterial culture PCR reaction system is shown in Tables 5 and 6 below.

[0125] Table 5. Bacterial PCR Reaction System Note: Please use a final concentration of 0.1-1.0 μM as a reference range for primer concentration settings. If the amplification efficiency is low, the primer concentration can be increased; if non-specific reactions occur, the primer concentration can be decreased, thereby optimizing the reaction system.

[0126] Table 6. PCR reaction conditions for bacterial culture Note: PCR reaction conditions can be optimized according to actual conditions: for example, the annealing temperature can be adjusted according to amplification efficiency and specificity; the extension time needs to be matched with the length of the target fragment; and the number of cycles should be reduced as much as possible while ensuring product yield to reduce the error rate.

[0127] After the reaction, 20 μL of the bacterial culture PCR product was taken for agarose gel electrophoresis. If a clear amplified band was visible and the molecular weight was correct, the bacterial culture was a positive clone. The bacterial culture was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing to confirm the correct gene sequence, thus obtaining the pan-B / Victoria(pre-19)-T4 gene expression plasmid.

[0128] 1.3 Expression and purification of pan-B / Victoria (pre-19) recombinant protein Transfecting the eukaryotic expression plasmid of pan-B / Victoria(pre-19)-T4 (SEQ ID NO: 33) into mammalian cells HEK293F (China Center for Type Culture Collection, Wuhan University) can express the recombinant HA protein with the amino acid sequence SEQ ID NO: 34, which is the recombinant pan-B / Victoria(pre-19)-T4 protein.

[0129] The specific methods used for cell culture, transfection, and protein purification are as follows: The density of HEK293F cells in suspension culture was 1×10⁻⁶. 6 When the cell count is 95% and the cell viability is greater than 95%, 300 mL of cells are used for transfection. The transfection mixture is prepared as follows: Place two 15 mL centrifuge tubes on a centrifuge rack. Add 5 mL of HEK293F serum-free medium (SMM 293-TII, Sinocare) to each tube, and name them tubes A and B. Add 450 μg of KS001-pan-B / Victoria(pre-19)-T4 gene expression plasmid to tube A, and add 675 μL of transfection reagent (PEI, Yisheng Biotechnology Co., Ltd.) to tube B. Mix well and let stand at room temperature for 5 minutes. Transfer the liquid from tube A to tube B, vortex, and let stand at room temperature for 15 minutes. In the center of a shake flask, add the above mixture dropwise into 300 mL of cells while shaking. Mix well and then place in a CO2 cell culture incubator for culture. Seven days after HEK293F cell transfection, cells were collected and centrifuged at 3,000 rpm at 4°C for 10 min. The cell supernatant was collected and then purified to obtain recombinant protein.

[0130] 1.4 Preparation and immunization of pan-B / Victoria(pre-19)-T4 recombinant subunit vaccine (1) Preparation of subunit vaccine: Pan-B / Victoria(pre-19)-T4 protein (SEQ ID NO: 34) was mixed with aluminum hydroxide adjuvant to prepare a subunit vaccine. Each dose contained 25 μg of HA protein and 750 μg of aluminum hydroxide adjuvant.

[0131] (2) Immunization procedure: BALB / c female mice (6-8 weeks old, 19-25g) were immunized. They were ordered from Beijing Vital River Laboratory Animal Technology Co., Ltd. All immunization experiments were conducted in the SPF laboratory. A total of 10 mice were immunized, including 5 mice in the pan-B / Victoria(pre-19)-T4 vaccine group and 5 mice in the B / Austria / 1359417 / 2021-T4 control group. Each mouse was immunized twice by intramuscular injection, with an interval of 14 days between each injection. Blood was collected from the orbital rim of all mice 14 days after the second immunization.

[0132] 1.5 Evaluation of the broad-spectrum neutralizing efficacy of pan-B / Victoria(pre-19)-T4 recombinant subunit vaccine To evaluate the broad-spectrum neutralizing activity of pan-B / Victoria (pre-19)-T4 vaccine-immunized serum against prevalent B / Victoria strains from different years, this invention uses the hemagglutination inhibition assay to determine the hemagglutination inhibition titer of post-immunization mouse serum against representative strains. The representative strains selected for this invention from different years are: 2016 representative strain B / Hubei Yingcheng / 1218 / 2016; 2017 representative strain B / Hubei Yingcheng / 319 / 2017; and 2018 representative strain B / Hubei Xiantao / 211 / 2018.

[0133] The specific procedure for the blood coagulation inhibition test is as follows: 1) The serum to be tested was treated with receptor-degrading enzyme RDE (Nippon Seiken Corporation) and incubated at 37°C for 18 h to remove non-specific hemagglutination inhibitors from the serum. After treatment, the serum was inactivated by treating at 56°C for 30 min.

[0134] 2) PBS was used to serially dilute mouse serum to dilutions of 1:20, 1:40, 1:80, 1:160, 1:320, 1:640, 1:1280 and 1:2560.

[0135] 3) Mix the virus diluent (containing 4 hemagglutination units) with the serum diluent in equal proportions and incubate at room temperature for 1 h.

[0136] 4) Add chicken red blood cells (Nanjing Senbega Biotechnology Co., Ltd.) and let stand at room temperature for 15 minutes.

[0137] 5) Observation results: The highest serum dilution that inhibits chicken erythrocyte aggregation is recorded as the hemagglutination inhibition titer. A hemagglutination inhibition titer >40 is recorded as positive.

[0138] Results of blood coagulation inhibition test as follows Figure 2 As shown, serum immunized with the pan-B / Victoria(pre-19)-T4 subunit vaccine exhibited broad-spectrum neutralizing activity against representative strains from 2016 (branch 1), 2017 (branch 2), and 2018 (branch 2) (hemagglutination inhibition titers were 73, 56, and 226, respectively). Serum immunized with the control group B / Austria / 1359417 / 2021-T4 subunit vaccine showed hemagglutination inhibition titers below the limit of detection for representative strains from 2016, 2017, and 2018. These results indicate that the pan-B / Victoria(pre-19)-T4 vaccine designed in this invention can broadly cover pre-2019 circulating strains.

[0139] Example 2: Design and Effect Evaluation of pan-B / Victoria (post-19) 2.1 Sequence Design for pan-B / Victoria (post-19) To broaden the protection scope of the broad-spectrum sequence, this invention added the sequence weight of the prevalent strain in branch 4 during the calculation process, and obtained the broad-spectrum sequence pan-B / Victoria(post-19) using the same calculation method described above. In the phylogenetic tree, pan-B / Victoria(post-19) is located in branch 4, close to branch 3, suggesting its potential to broadly cover strains in branches 3 and 4.

[0140] 2.2 Evaluation of the broad-spectrum neutralizing efficacy of the pan-B / Victoria (post-19)-T4 recombinant subunit vaccine This invention utilizes the same expression element modification and codon optimization strategies described above to obtain the pan-B / Victoria(post-19)-T4 gene (SEQ ID NO: 35). The same protein expression and purification methods described above are used to obtain the recombinant pan-B / Victoria(post-19)-T4 protein (SEQ ID NO: 36), which is then mixed with aluminum adjuvant to prepare a subunit vaccine, which is then used to immunize BALB / c mice. A total of 10 mice were immunized, including 5 mice in the pan-B / Victoria(post-19)-T4 vaccine group and 5 mice in the B / Austria / 1359417 / 2021-T4 control group. Each mouse received two intramuscular injections, 14 days apart. Blood was collected from the orbital sinus of all mice 14 days after the second immunization.

[0141] To evaluate the broad-spectrum neutralizing activity of pan-B / Victoria (post-19)-T4 vaccine-immunized serum against B / Victoria epidemic strains from different years, this invention uses the hemagglutination inhibition assay to determine the hemagglutination inhibition titer of post-immunized mouse serum against representative strains. The representative strains selected for different years in this invention are: 2019 representative strain B / Washington / 02 / 2019; 2021 representative strain B / Austria / 1359417 / 2021; 2023 representative strain B / Hubei Zengdu / 11934 / 2023; 2024 representative strain B / Hubei Zengdu / 1597 / 2024; and 2025 representative strain B / Hubei Songzi / 8473 / 2025.

[0142] Results of blood coagulation inhibition test as follows Figure 3As shown, serum immunized with the pan-B / Victoria (post-19)-T4 subunit vaccine exhibited broad-spectrum neutralizing activity against representative strains from 2019 (branch 3), 2021 (branch 4), 2023 (branch 4), 2024 (branch 4), and 2025 (branch 4) (hemagglutination inhibition titers were 160, 160, 160, 121, and 106, respectively). Serum immunized with the control group B / Austria / 1359417 / 2021-T4 retained neutralizing activity only against representative strains from 2021 onwards (hemagglutination inhibition titers were 139, 243, 160, and 184), but the hemagglutination inhibition titer against the 2019 representative strain was below the limit of detection. These results indicate that the pan-B / Victoria (post-19)-T4 vaccine designed in this invention can broadly cover epidemic strains from 2019 onwards, especially those from 2019 that are mismatched with the vaccine strain.

[0143] Example 3: Design and Effect Evaluation of pan-B / Victoria (post-21) 3.1 Sequence Design for pan-B / Victoria (post-21) To enhance the neutralizing activity of the broad-spectrum sequence against strains circulating after 2021, this invention used the same method as in Example 1 above to calculate the full-length amino acid sequence of the HA protein of strains circulating after 2021 in the database, obtaining the broad-spectrum sequence pan-B / Victoria(post-21). In the phylogenetic tree, pan-B / Victoria(post-21) is located on branch 4, far from branch 3, suggesting its potential to efficiently cover strains in branch 4.

[0144] 3.2 Evaluation of the broad-spectrum neutralizing efficacy of the pan-B / Victoria (post-21)-T4 recombinant subunit vaccine This invention utilizes the same expression element modification and codon optimization strategies described above to obtain the pan-B / Victoria (post-21)-T4 gene (SEQ ID NO: 37). The same protein expression and purification methods described above are used to obtain the recombinant pan-B / Victoria (post-21)-T4 protein (SEQ ID NO: 38), which is then mixed with aluminum adjuvant to prepare a subunit vaccine, which is then used to immunize BALB / c mice. A total of 10 mice were immunized, including 5 mice in the pan-B / Victoria (post-21)-T4 vaccine group and 5 mice in the B / Austria / 1359417 / 2021-T4 control group. Each mouse received two intramuscular injections, 14 days apart. Blood was collected from the orbital sinus of all mice 14 days after the second immunization.

[0145] To evaluate the broad-spectrum neutralizing activity of pan-B / Victoria (post-21)-T4 vaccine-immunized serum against B / Victoria epidemic strains from different years after 2021, this invention uses the hemagglutination inhibition assay to determine the hemagglutination inhibition titer of post-immunized mouse serum against representative strains. The representative strains selected in this invention are: 2021 representative strain B / Austria / 1359417 / 2021; 2023 representative strain B / Hubei Zengdu / 11934 / 2023; 2024 representative strain B / Hubei Zengdu / 1597 / 2024; and 2025 representative strain B / Hubei Songzi / 8473 / 2025.

[0146] Results of blood coagulation inhibition test as follows Figure 4 As shown, serum immunized with the pan-B / Victoria (post-21)-T4 subunit vaccine exhibited broad-spectrum neutralizing activity against representative strains from 2021, 2023, 2024, and 2025 (hemagglutination inhibition titers were 1940, >2560, >2560, and >2560, respectively). Compared with serum immunized with the control vaccine B / Austria / 1359417 / 2021-T4, serum immunized with pan-B / Victoria (post-21)-T4 showed significantly enhanced neutralizing activity against representative strains from 2021, 2023, 2024, and 2025, with hemagglutination inhibition titers increasing by 13.9-fold, 10.5-fold, 16-fold, and 13.9-fold, respectively. The above results indicate that the pan-B / Victoria (post-21)-T4 vaccine designed in this invention can induce high levels of neutralizing antibodies against strains circulating after 2021, with significantly enhanced neutralizing activity compared to WHO-recommended vaccine strains.

[0147] Example 4: Analysis of key mutation sites covering prevalent strains over the years To analyze the key mutation sites of the broad-spectrum sequences covering the prevalent strains over the years, this invention compared the above three broad-spectrum sequences: pan-B / Victoria (pre-19), pan-B / Victoria (post-19), and pan-B / Victoria (post-21) with the WHO-recommended vaccine strain B / Austria / 1359417 / 2021 from 2022 to 2026. The sequence analysis results are as follows: Figure 5 As shown: 1) Compared with the control sequence, pan-B / Victoria(pre-19) has 9 mutation sites (T142A, E151K, L159P, K165N, insert 177-179KND, E196G, D209N, R215K, K291R), suggesting that the above 9 mutations are key sites covering the prevalent strains before 2019; 2) Three mutation sites (T142A, L159P, R215K) were found in pan-B / Victoria (post-19), suggesting that the T142A, L159P, and R215K mutations are key sites covering the circulating strains after 2019. 3) The pan-B / Victoria (post-21) strain has one mutation site (D209E), suggesting that the D209E mutation is a key site for enhancing neutralizing activity against strains circulating after 2021; 4) Furthermore, this invention subtracts the common mutations with pan-B / Victoria (post-19) and pan-B / Victoria (post-21) from the nine mutation sites present in pan-B / Victoria (pre-19), obtaining five specific mutations (E151K, K165N, insert 177-179KND, E196G, K291R), suggesting that the above five specific mutations have a more critical impact on covering the prevalent strains before 2019.

[0148] Example 5: Identification of core mutations covering pre-2019 circulating strains To confirm the coverage ability of five key mutations for pre-2019 circulating strains, this invention introduces two key site reversion mutations (K151E, del177-179KND) on the basis of pan-B / Victoria(pre-19) to design pan-B / Victoria(pre-19). 2mut Sequence. This invention uses the same expression element modification strategy and codon optimization strategy described above to obtain pan-B / Victoria(pre-19) expressing the HA trimer protein. 2mut -T4 gene (SEQ ID NO: 43). pan-B / Victoria(pre-19) was obtained using the same protein expression and purification method described above. 2mut -T4 (SEQ ID NO: 44), mixed with aluminum adjuvant, was prepared into a subunit vaccine and immunized BALB / c mice. A total of 10 mice were immunized, including pan-B / Victoria (pre-19). 2mut The T4 group (n=5) and the pan-B / Victoria (pre-19)-T4 group (n=5) were immunized twice by intramuscular injection, with an interval of 14 days between each injection. Blood was collected from the orbital cavity of all mice 14 days after the second immunization.

[0149] This invention uses a blood coagulation inhibition assay to evaluate pan-B / Victoria (pre-19). 2mutThe neutralizing activity of serum immunized with the T4 vaccine against representative strains before 2019 was measured, with serum immunized with pan-B / Victoria (pre-19)-T4 as a control. Hemagglutination inhibition assay results are as follows: Figure 6 As shown, pan-B / Victoria(pre-19) 2mut Serum immunized with the T4 subunit vaccine showed hemagglutination inhibition titers below the detection limit (less than 40) against representative strains from 2016, 2017, and 2018. However, serum immunized with the pan-B / Victoria (pre-19)-T4 subunit vaccine exhibited broad-spectrum neutralizing activity against representative strains from 2016, 2017, and 2018 (hemagglutination inhibition titers of 73, 56, and 226, respectively). These results indicate that the E151K and insert 177-179KND mutations are core mutations that broadly cover pre-2019 circulating strains.

[0150] The above data fully demonstrate that the gene fragments and related vaccines of this invention have broad-spectrum protective capabilities and good immunogenicity, and have the potential for clinical application.

[0151] The above is a further detailed description of the present invention and should not be considered as a limitation on the specific implementation of the present invention. For those skilled in the art, simple deductions or substitutions without departing from the concept of the present invention are all within the protection scope of the present invention.

[0152] The gene sequence involved in this invention is: SEQ ID NO: 1 SEQ ID NO: 2 MKAIIVLLMVVTSNADRICTGITSSNSPHVVKTATQGEVNVTGVIPLTTTPTKSHFANLKGTETRGKLCPKCLNCTDLDVALGRPKCTGKIPSARVSILHEVRPVTSGCFPIMHDRTKIRQLPNLLRGYEHVRLSTHNVINTEDAPGGPYEIGTSGSCLNITNGKGFFATMAWAVPKNKTATNPLTIEVPYICTEEEDQITVWGFHSDDETQMARLYGDSKPQKFTSSANGVTTHYVSQIGGFPNQTEDGGLPQSGRIVVDYMVQKSGKTGTITYQRGILLPQKVWCASGKSKVIKGSLPLIGEADCLHEKYGGLNKSKPYYTGEHAKAIGNCPIWVKTPLKLANGTKYRPPAKLLKERGFFGAIAGFLEGGWEGMIAGWHGYTSHGAHGVAVAADLKSTQEAINKITKNLNSLSELEVKNLQRLSGAMDELHNEILELDEKVDDLRADTISSQIELAVLLSNEGIINSEDEHLLALERKLKKMLGPSAVEIGNGCFETKHKCNQTCLDRIAAGTFDAGEFSLPTFDSLNITAASLNDDGLDNHTI SEQ ID NO: 3 SEQ ID NO: 4 MKAIIVLLMVVTSNADRICTGITSSNSPHVVKTATQGEVNVTGVIPLTTTPTKSHFANLKGTETRGKLCPKCLNCTDLDVALGRPKCTGKIPSARVSILHEVRPVTSGCFPIMHDRTKIRQLPNLLRGYEHVRLSTHNVINAEDAPGGPYKIGTSGSCPNITNGNGFFATMAWAVPKNDKNKTATNPLTIEVPYICTEGEDQITVWGFHSDNETQMAKLYGDSKPQKFTSSANGVTTHYVSQIGGFPNQTEDGGLPQSGRIVVDYMVQKSGKTGTITYQRGILLPQKVWCASGRSKVIKGSLPLIGEADCLHEKYGGLNKSKPYYTGEHAKAIGNCPIWVKTPLKLANGTKYRPPAKLLKERGFFGAIAGFLEGGWEGMIAGWHGYTSHGAHGVAVAADLKSTQEAINKITKNLNSLSELEVKNLQRLSGAMDELHNEILELDEKVDDLRADTISSQIELAVLLSNEGIINSEDEHLLALERKLKKMLGPSAVEIGNGCFETKHKCNQTCLDRIAAGTFDAGEFSLPTFDSLNITAASLNDDGLDNHTI SEQ ID NO: 5 SEQ ID NO: 6 MKAIIVLLMVVTSNADRICTGITSSNSPHVVKTATQGEVNVTGVIPLTTTPTKSHFANLKGTETRGKLCPKCLNCTDLDVALGRPKCTGKIPSARVSILHEVRPVTSGCFPIMHDRTKIRQLPNLLRGYEHVRLSTHNVINAEDAPGGPYEIGTSGSCPNITNGKGFFATMAWAVPKNKTATNPLTIEVPYICTEEEDQITVWGFHSDDETQMAKLYGDSKPQKFTSSANGVTTHYVSQIGGFPNQTEDGGLPQSGRIVVDYMVQKSGKTGTITYQRGILLPQKVWCASGKSKVIKGSLPLIGEADCLHEKYGGLNKSKPYYTGEHAKAIGNCPIWVKTPLKLANGTKYRPPAKLLKERGFFGAIAGFLEGGWEGMIAGWHGYTSHGAHGVAVAADLKSTQEAINKITKNLNSLSELEVKNLQRLSGAMDELHNEILELDEKVDDLRADTISSQIELAVLLSNEGIINSEDEHLLALERKLKKMLGPSAVEIGNGCFETKHKCNQTCLDRIAAGTFDAGEFSLPTFDSLNITAASLNDDGLDNHTI SEQ ID NO: 7 SEQ ID NO: 8 MKAIIVLLMVVTSNADRICTGITSSNSPHVVKTATQGEVNVTGVIPLTTTPTKSHFANLKGTETRGKLCPKCLNCTDLDVALGRPKCTGKIPSARVSILHEVRPVTSGCFPIMHDRTKIRQLPNLLRGYEHVRLSTHNVINTEDAPGGPYEIGTSGSCLNITNGKGFFATMAWAVPKNKTATNPLTIEVPYICTEEEDQITVWGFHSDEETQMARLYGDSKPQKFTSSANGVTTHYVSQIGGFPNQTEDGGLPQSGRIVVDYMVQKSGKTGTITYQRGILLPQKVWCASGKSKVIKGSLPLIGEADCLHEKYGGLNKSKPYYTGEHAKAIGNCPIWVKTPLKLANGTKYRPPAKLLKERGFFGAIAGFLEGGWEGMIAGWHGYTSHGAHGVAVAADLKSTQEAINKITKNLNSLSELEVKNLQRLSGAMDELHNEILELDEKVDDLRADTISSQIELAVLLSNEGIINSEDEHLLALERKLKKMLGPSAVEIGNGCFETKHKCNQTCLDRIAAGTFDAGEFSLPTFDSLNITAASLNDDGLDNHTI SEQ ID NO: 9 SEQ ID NO: 10 MKAIIVLLMVVTSNADRICTGITSSNSPHVVKTATQGEVNVTGVIPLTTTPTKSHFANLKGTETRGKLCPKCLNCTDLDVALGRPKCTGKIPSARVSILHEVRPVTSGCFPIMHDRTKIRQLPNLLRGYEHVRLSTHNVINTEDAPGGPYKIGTSGSCLNITNGNGFFATMAWAVPKNDKNKTATNPLTIEVPYICTEGEDQITVWGFHSDDETQMARLYGDSKPQKFTSSANGVTTHYVSQIGGFPNQTEDGGLPQSGRIVVDYMVQKSGKTGTITYQRGILLPQKVWCASGRSKVIKGSLPLIGEADCLHEKYGGLNKSKPYYTGEHAKAIGNCPIWVKTPLKLANGTKYRPPAKLLKERGFFGAIAGFLEGGWEGMIAGWHGYTSHGAHGVAVAADLKSTQEAINKITKNLNSLSELEVKNLQRLSGAMDELHNEILELDEKVDDLRADTISSQIELAVLLSNEGIINSEDEHLLALERKLKKMLGPSAVEIGNGCFETKHKCNQTCLDRIAAGTFDAGEFSLPTFDSLNITAASLNDDGLDNHTI SEQ ID NO: 11 SEQ ID NO: 12 MKAIIVLLMVVTSNADRICTGITSSNSPHVVKTATQGEVNVTGVIPLTTTPTKSHFANLKGTETRGKLCPKCLNCTDLDVALGRPKCTGKIPSARVSILHEVRPVTSGCFPIMHDRTKIRQLPNLLRGYEHVRLSTHNVINTEDAPGGPYKIGTSGSCLNITNGKGFFATMAWAVPKNDKNKTATNPLTIEVPYICTEEEDQITVWGFHSDDETQMARLYGDSKPQKFTSSANGVTTHYVSQIGGFPNQTEDGGLPQSGRIVVDYMVQKSGKTGTITYQRGILLPQKVWCASGKSKVIKGSLPLIGEADCLHEKYGGLNKSKPYYTGEHAKAIGNCPIWVKTPLKLANGTKYRPPAKLLKERGFFGAIAGFLEGGWEGMIAGWHGYTSHGAHGVAVAADLKSTQEAINKITKNLNSLSELEVKNLQRLSGAMDELHNEILELDEKVDDLRADTISSQIELAVLLSNEGIINSEDEHLLALERKLKKMLGPSAVEIGNGCFETKHKCNQTCLDRIAAGTFDAGEFSLPTFDSLNITAASLNDDGLDNHTI SEQ ID NO: 13 ATGCCCATGGGGTCTCTGCAACCGCTGGCCACCTTGTACCTGCTGGGGATGCTGGTCGCTTCCGTGCTGGCC SEQ ID NO: 14 MPMGSLQPLATLYLLGMLVASVLA SEQ ID NO: 15 SEQ ID NO: 16 MPMGSLQPLATLYLLGMLVASVLADRICTGITSSNSPHVVKTATQGEVNVTGVIPLTTTPTKSHFANLKGTETRGKLCPKCLNCTDLDVALGRPKCTGKIPSARVSILHEVRPVTSGCFPIMHDRTKIRQLPNLLRGYEHVRLSTHNVINTEDAPGGPYEIGTSGSCLNITNGKGFFATMAWAVPKNKTATNPLTIEVPYICTEEEDQITVWGFHSDDETQMARLYGDSKPQKFTSSANGVTTHYVSQIGGFPNQTEDGGLPQSGRIVVDYMVQKSGKTGTITYQRGILLPQKVWCASGKSKVIKGSLPLIGEADCLHEKYGGLNKSKPYYTGEHAKAIGNCPIWVKTPLKLANGTKYRPPAKLLKERGFFGAIAGFLEGGWEGMIAGWHGYTSHGAHGVAVAADLKSTQEAINKITKNLNSLSELEVKNLQRLSGAMDELHNEILELDEKVDDLRADTISSQIELAVLLSNEGIINSEDEHLLALERKLKKMLGPSAVEIGNGCFETKHKCNQTCLDRIAAGTFDAGEFSLPTFDSLNITAASLNDDGLDNHTI SEQ ID NO: 17 SEQ ID NO: 18 MPMGSLQPLATLYLLGMLVASVLADRICTGITSSNSPHVVKTATQGEVNVTGVIPLTTTPTKSHFANLKGTETRGKLCPKCLNCTDLDVALGRPKCTGKIPSARVSILHEVRPVTSGCFPIMHDRTKIRQLPNLLRGYEHVRLSTHNVINAEDAPGGPYKIGTSGSCPNITNGNGFFATMAWAVPKNDKNKTATNPLTIEVPYICTEGEDQITVWGFHSDNETQMAKLYGDSKPQKFTSSANGVTTHYVSQIGGFPNQTEDGGLPQSGRIVVDYMVQKSGKTGTITYQRGILLPQKVWCASGRSKVIKGSLPLIGEADCLHEKYGGLNKSKPYYTGEHAKAIGNCPIWVKTPLKLANGTKYRPPAKLLKERGFFGAIAGFLEGGWEGMIAGWHGYTSHGAHGVAVAADLKSTQEAINKITKNLNSLSELEVKNLQRLSGAMDELHNEILELDEKVDDLRADTISSQIELAVLLSNEGIINSEDEHLLALERKLKKMLGPSAVEIGNGCFETKHKCNQTCLDRIAAGTFDAGEFSLPTFDSLNITAASLNDDGLDNHTI SEQ ID NO: 19 SEQ ID NO: 20 MPMGSLQPLATLYLLGMLVASVLADRICTGITSSNSPHVVKTATQGEVNVTGVIPLTTTPTKSHFANLKGTETRGKLCPKCLNCTDLDVALGRPKCTGKIPSARVSILHEVRPVTSGCFPIMHDRTKIRQLPNLLRGYEHVRLSTHNVINAEDAPGGPYEIGTSGSCPNITNGKGFFATMAWAVPKNKTATNPLTIEVPYICTEEEDQITVWGFHSDDETQMAKLYGDSKPQKFTSSANGVTTHYVSQIGGFPNQTEDGGLPQSGRIVVDYMVQKSGKTGTITYQRGILLPQKVWCASGKSKVIKGSLPLIGEADCLHEKYGGLNKSKPYYTGEHAKAIGNCPIWVKTPLKLANGTKYRPPAKLLKERGFFGAIAGFLEGGWEGMIAGWHGYTSHGAHGVAVAADLKSTQEAINKITKNLNSLSELEVKNLQRLSGAMDELHNEILELDEKVDDLRADTISSQIELAVLLSNEGIINSEDEHLLALERKLKKMLGPSAVEIGNGCFETKHKCNQTCLDRIAAGTFDAGEFSLPTFDSLNITAASLNDDGLDNHTI SEQ ID NO: 21 SEQ ID NO: 22 MPMGSLQPLATLYLLGMLVASVLADRICTGITSSNSPHVVKTATQGEVNVTGVIPLTTTPTKSHFANLKGTETRGKLCPKCLNCTDLDVALGRPKCTGKIPSARVSILHEVRPVTSGCFPIMHDRTKIRQLPNLLRGYEHVRLSTHNVINTEDAPGGPYEIGTSGSCLNITNGKGFFATMAWAVPKNKTATNPLTIEVPYICTEEEDQITVWGFHSDEETQMARLYGDSKPQKFTSSANGVTTHYVSQIGGFPNQTEDGGLPQSGRIVVDYMVQKSGKTGTITYQRGILLPQKVWCASGKSKVIKGSLPLIGEADCLHEKYGGLNKSKPYYTGEHAKAIGNCPIWVKTPLKLANGTKYRPPAKLLKERGFFGAIAGFLEGGWEGMIAGWHGYTSHGAHGVAVAADLKSTQEAINKITKNLNSLSELEVKNLQRLSGAMDELHNEILELDEKVDDLRADTISSQIELAVLLSNEGIINSEDEHLLALERKLKKMLGPSAVEIGNGCFETKHKCNQTCLDRIAAGTFDAGEFSLPTFDSLNITAASLNDDGLDNHTI SEQ ID NO: 23 SEQ ID NO: 24 MPMGSLQPLATLYLLGMLVASVLADRICTGITSSNSPHVVKTATQGEVNVTGVIPLTTTPTKSHFANLKGTETRGKLCPKCLNCTDLDVALGRPKCTGKIPSARVSILHEVRPVTSGCFPIMHDRTKIRQLPNLLRGYEHVRLSTHNVINTEDAPGGPYKIGTSGSCLNITNGNGFFATMAWAVPKNDKNKTATNPLTIEVPYICTEGEDQITVWGFHSDDETQMARLYGDSKPQKFTSSANGVTTHYVSQIGGFPNQTEDGGLPQSGRIVVDYMVQKSGKTGTITYQRGILLPQKVWCASGRSKVIKGSLPLIGEADCLHEKYGGLNKSKPYYTGEHAKAIGNCPIWVKTPLKLANGTKYRPPAKLLKERGFFGAIAGFLEGGWEGMIAGWHGYTSHGAHGVAVAADLKSTQEAINKITKNLNSLSELEVKNLQRLSGAMDELHNEILELDEKVDDLRADTISSQIELAVLLSNEGIINSEDEHLLALERKLKKMLGPSAVEIGNGCFETKHKCNQTCLDRIAAGTFDAGEFSLPTFDSLNITAASLNDDGLDNHTI SEQ ID NO: 25 SEQ ID NO: 26 MPMGSLQPLATLYLLGMLVASVLADRICTGITSSNSPHVVKTATQGEVNVTGVIPLTTTPTKSHFANLKGTETRGKLCPKCLNCTDLDVALGRPKCTGKIPSARVSILHEVRPVTSGCFPIMHDRTKIRQLPNLLRGYEHVRLSTHNVINTEDAPGGPYKIGTSGSCLNITNGKGFFATMAWAVPKNDKNKTATNPLTIEVPYICTEEEDQITVWGFHSDDETQMARLYGDSKPQKFTSSANGVTTHYVSQIGGFPNQTEDGGLPQSGRIVVDYMVQKSGKTGTITYQRGILLPQKVWCASGKSKVIKGSLPLIGEADCLHEKYGGLNKSKPYYTGEHAKAIGNCPIWVKTPLKLANGTKYRPPAKLLKERGFFGAIAGFLEGGWEGMIAGWHGYTSHGAHGVAVAADLKSTQEAINKITKNLNSLSELEVKNLQRLSGAMDELHNEILELDEKVDDLRADTISSQIELAVLLSNEGIINSEDEHLLALERKLKKMLGPSAVEIGNGCFETKHKCNQTCLDRIAAGTFDAGEFSLPTFDSLNITAASLNDDGLDNHTI SEQ ID NO: 27 GGCTACATCCCCGAGGCCCCCCGCGACGGCCAGGCCTACGTGCGCAAGGACGGCGAGTGGGTGCTGCTGAGCACCTTCCTG SEQ ID NO: 28 GYIPEAPRDGQAYVRKDGEWVLLSTFL SEQ ID NO: 29 GGTGGCTCCGGTGGCTCC SEQ ID NO: 30 GGSGGS SEQ ID NO: 31 SEQ ID NO: 32 MPMGSLQPLATLYLLGMLVASVLADRICTGITSSNSPHVVKTATQGEVNVTGVIPLTTTPTKSHFANLKGTETRGKLCPKCLNCTDLDVALGRPKCTGKIPSARVSILHEVRPVTSGCFPIMHDRTKIRQLPNLLRGYEHVRLSTHNVINTEDAPGGPYEIGTSGSCLNITNGKGFFATMAWAVPKNKTATNPLTIEVPYICTEEEDQITVWGFHSDDETQMARLYGDSKPQKFTSSANGVTTHYVSQIGGFPNQTEDGGLPQSGRIVVDYMVQKSGKTGTITYQRGILLPQKVWCASGKSKVIKGSLPLIGEADCLHEKYGGLNKSKPYYTGEHAKAIGNCPIWVKTPLKLANGTKYRPPAKLLKERGFFGAIAGFLEGGWEGMIAGWHGYTSHGAHGVAVAADLKSTQEAINKITKNLNSLSELEVKNLQRLSGAMDELHNEILELDEKVDDLRADTISSQIELAVLLSNEGIINSEDEHLLALERKLKKMLGPSAVEIGNGCFETKHKCNQTCLDRIAAGTFDAGEFSLPTFDSLNITAASLNDDGLDNHTIGGSGGSGYIPEAPRDGQAYVRKDGEWVLLSTFL SEQ ID NO: 33 SEQ ID NO: 34 MPMGSLQPLATLYLLGMLVASVLADRICTGITSSNSPHVVKTATQGEVNVTGVIPLTTTPTKSHFANLKGTETRGKLCPKCLNCTDLDVALGRPKCTGKIPSARVSILHEVRPVTSGCFPIMHDRTKIRQLPNLLRGYEHVRLSTHNVINAEDAPGGPYKIGTSGSCPNITNGNGFFATMAWAVPKNDKNKTATNPLTIEVPYICTEGEDQITVWGFHSDNETQMAKLYGDSKPQKFTSSANGVTTHYVSQIGGFPNQTEDGGLPQSGRIVVDYMVQKSGKTGTITYQRGILLPQKVWCASGRSKVIKGSLPLIGEADCLHEKYGGLNKSKPYYTGEHAKAIGNCPIWVKTPLKLANGTKYRPPAKLLKERGFFGAIAGFLEGGWEGMIAGWHGYTSHGAHGVAVAADLKSTQEAINKITKNLNSLSELEVKNLQRLSGAMDELHNEILELDEKVDDLRADTISSQIELAVLLSNEGIINSEDEHLLALERKLKKMLGPSAVEIGNGCFETKHKCNQTCLDRIAAGTFDAGEFSLPTFDSLNITAASLNDDGLDNHTIGGSGGSGYIPEAPRDGQAYVRKDGEWVLLSTFL SEQ ID NO: 35 SEQ ID NO: 36 MPMGSLQPLATLYLLGMLVASVLADRICTGITSSNSPHVVKTATQGEVNVTGVIPLTTTPTKSHFANLKGTETRGKLCPKCLNCTDLDVALGRPKCTGKIPSARVSILHEVRPVTSGCFPIMHDRTKIRQLPNLLRGYEHVRLSTHNVINAEDAPGGPYEIGTSGSCPNITNGKGFFATMAWAVPKNKTATNPLTIEVPYICTEEEDQITVWGFHSDDETQMAKLYGDSKPQKFTSSANGVTTHYVSQIGGFPNQTEDGGLPQSGRIVVDYMVQKSGKTGTITYQRGILLPQKVWCASGKSKVIKGSLPLIGEADCLHEKYGGLNKSKPYYTGEHAKAIGNCPIWVKTPLKLANGTKYRPPAKLLKERGFFGAIAGFLEGGWEGMIAGWHGYTSHGAHGVAVAADLKSTQEAINKITKNLNSLSELEVKNLQRLSGAMDELHNEILELDEKVDDLRADTISSQIELAVLLSNEGIINSEDEHLLALERKLKKMLGPSAVEIGNGCFETKHKCNQTCLDRIAAGTFDAGEFSLPTFDSLNITAASLNDDGLDNHTIGGSGGSGYIPEAPRDGQAYVRKDGEWVLLSTFL SEQ ID NO: 37 SEQ ID NO: 38 MPMGSLQPLATLYLLGMLVASVLADRICTGITSSNSPHVVKTATQGEVNVTGVIPLTTTPTKSHFANLKGTETRGKLCPKCLNCTDLDVALGRPKCTGKIPSARVSILHEVRPVTSGCFPIMHDRTKIRQLPNLLRGYEHVRLSTHNVINTEDAPGGPYEIGTSGSCLNITNGKGFFATMAWAVPKNKTATNPLTIEVPYICTEEEDQITVWGFHSDEETQMARLYGDSKPQKFTSSANGVTTHYVSQIGGFPNQTEDGGLPQSGRIVVDYMVQKSGKTGTITYQRGILLPQKVWCASGKSKVIKGSLPLIGEADCLHEKYGGLNKSKPYYTGEHAKAIGNCPIWVKTPLKLANGTKYRPPAKLLKERGFFGAIAGFLEGGWEGMIAGWHGYTSHGAHGVAVAADLKSTQEAINKITKNLNSLSELEVKNLQRLSGAMDELHNEILELDEKVDDLRADTISSQIELAVLLSNEGIINSEDEHLLALERKLKKMLGPSAVEIGNGCFETKHKCNQTCLDRIAAGTFDAGEFSLPTFDSLNITAASLNDDGLDNHTIGGSGGSGYIPEAPRDGQAYVRKDGEWVLLSTFL SEQ ID NO: 39 SEQ ID NO: 40 MPMGSLQPLATLYLLGMLVASVLADRICTGITSSNSPHVVKTATQGEVNVTGVIPLTTTPTKSHFANLKGTETRGKLCPKCLNCTDLDVALGRPKCTGKIPSARVSILHEVRPVTSGCFPIMHDRTKIRQLPNLLRGYEHVRLSTHNVINTEDAPGGPYKIGTSGSCLNITNGNGFFATMAWAVPKNDKNKTATNPLTIEVPYICTEGEDQITVWGFHSDDETQMARLYGDSKPQKFTSSANGVTTHYVSQIGGFPNQTEDGGLPQSGRIVVDYMVQKSGKTGTITYQRGILLPQKVWCASGRSKVIKGSLPLIGEADCLHEKYGGLNKSKPYYTGEHAKAIGNCPIWVKTPLKLANGTKYRPPAKLLKERGFFGAIAGFLEGGWEGMIAGWHGYTSHGAHGVAVAADLKSTQEAINKITKNLNSLSELEVKNLQRLSGAMDELHNEILELDEKVDDLRADTISSQIELAVLLSNEGIINSEDEHLLALERKLKKMLGPSAVEIGNGCFETKHKCNQTCLDRIAAGTFDAGEFSLPTFDSLNITAASLNDDGLDNHTIGGSGGSGYIPEAPRDGQAYVRKDGEWVLLSTFL SEQ ID NO: 41 SEQ ID NO: 42 MPMGSLQPLATLYLLGMLVASVLADRICTGITSSNSPHVVKTATQGEVNVTGVIPLTTTPTKSHFANLKGTETRGKLCPKCLNCTDLDVALGRPKCTGKIPSARVSILHEVRPVTSGCFPIMHDRTKIRQLPNLLRGYEHVRLSTHNVINTEDAPGGPYKIGTSGSCLNITNGKGFFATMAWAVPKNDKNKTATNPLTIEVPYICTEEEDQITVWGFHSDDETQMARLYGDSKPQKFTSSANGVTTHYVSQIGGFPNQTEDGGLPQSGRIVVDYMVQKSGKTGTITYQRGILLPQKVWCASGKSKVIKGSLPLIGEADCLHEKYGGLNKSKPYYTGEHAKAIGNCPIWVKTPLKLANGTKYRPPAKLLKERGFFGAIAGFLEGGWEGMIAGWHGYTSHGAHGVAVAADLKSTQEAINKITKNLNSLSELEVKNLQRLSGAMDELHNEILELDEKVDDLRADTISSQIELAVLLSNEGIINSEDEHLLALERKLKKMLGPSAVEIGNGCFETKHKCNQTCLDRIAAGTFDAGEFSLPTFDSLNITAASLNDDGLDNHTIGGSGGSGYIPEAPRDGQAYVRKDGEWVLLSTFL SEQ ID NO: 43 SEQ ID NO: 44 MPMGSLQPLATLYLLGMLVASVLADRICTGITSSNSPHVVKTATQGEVNVTGVIPLTTTPTKSHFANLKGTETRGKLCPKCLNCTDLDVALGRPKCTGKIPSARVSILHEVRPVTSGCFPIMHDRTKIRQLPNLLRGYEHVRLSTHNVINAEDAPGGPYEIGTSGSCPNITNGNGFFATMAWAVPKNKTATNPLTIEVPYICTEGEDQITVWGFHSDNETQMAKLYGDSKPQKFTSSANGVTTHYVSQIGGFPNQTEDGGLPQSGRIVVDYMVQKSGKTGTITYQRGILLPQKVWCASGRSKVIKGSLPLIGEADCLHEKYGGLNKSKPYYTGEHAKAIGNCPIWVKTPLKLANGTKYRPPAKLLKERGFFGAIAGFLEGGWEGMIAGWHGYTSHGAHGVAVAADLKSTQEAINKITKNLNSLSELEVKNLQRLSGAMDELHNEILELDEKVDDLRADTISSQIELAVLLSNEGIINSEDEHLLALERKLKKMLGPSAVEIGNGCFETKHKCNQTCLDRIAAGTFDAGEFSLPTFDSLNITAASLNDDGLDNHTIGGSGGSGYIPEAPRDGQAYVRKDGEWVLLSTFL

Claims

1. A mutant of the HA protein of influenza B virus (Victoria HBV), comprising an antigenic peptide; the amino acid sequence of said antigenic peptide is selected from either (a) or (b): (a) An amino acid sequence comprising the amino acid sequence shown in SEQ ID NO: 2, and obtained by mutating an amino acid at at least one of the following positions: position 142, position 151, position 159, position 165, positions 177-179, position 196, position 209, position 215, and position 291, wherein the amino acid mutation includes at least one of the following: substitution, deletion, and / or insertion of amino acids; (b) A sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with the sequence defined in (a) and having the same amino acid residues at positions 142, 151, 159, 165, 177-179, 196, 209, 215, and 291 as the sequence defined in (a).

2. The influenza B Victoria virus HA protein mutant according to claim 1, wherein, The antigenic peptide contains at least one of the following mutations: T142A, E151K, L159P, K165N, insert 177-179KND, E196G, D209N / E, R215K, and K291R. Preferably, the antigenic peptide contains a mutation or combination of mutations selected from any one of the following groups (1)-(5): (1) T142A, E151K, L159P, K165N, insert 177-179KND, E196G, D209N, R215K, K291R; (2) T142A, L159P, R215K; (3) D209E; (4) E151K, K165N, insert 177-179KND, E196G, K291R; (5) E151K, insert 177-179KND; Optionally, when the antigen peptide contains the mutation of group (2), it also contains at least one of the mutations of E151K, K165N, insert 177-179KND, E196G, D209N / E, and K291R; Optionally, when the antigen peptide contains group (3) mutation, it also contains at least one of the following mutations: T142A, E151K, L159P, K165N, insert177-179KND, E196G, R215K, K291R. Optionally, when the antigenic peptide contains the mutation of group (4), it also contains at least one of the mutations of T142A, L159P, D209N / E, and R215K; Optionally, when the antigenic peptide contains group (5) mutation, it also contains at least one of the mutations T142A, L159P, K165N, E196G, D209N / E, R215K, and K291R.

3. The influenza B Victoria virus HA protein mutant according to claim 1 or 2, wherein, The antigenic peptide contains T142A, E151K, L159P, K165N, insert 177-179KND, E196G, D209N, R215K, and K291R mutations. The antigenic peptide contains T142A, L159P, and R215K mutations; The antigenic peptide contains the D209E mutation; The antigenic peptide contains E151K, K165N, insert 177-179KND, E196G, and K291R mutations; or The antigenic peptide contains E151K and insert 177-179KND mutations.

4. The influenza B virus HA protein mutant according to any one of claims 1-3, wherein the antigenic peptide comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the sequence shown in SEQ ID NO: 4, 6, 8, 10, or 12; preferably, the amino acid sequence of the antigenic peptide is the sequence shown in SEQ ID NO: 4, 6, 8, 10, or 12.

5. The influenza B Victoria virus HA protein mutant according to any one of claims 1-4, further comprising one or more peptides selected from the transmembrane domain and the intracellular domain.

6. A recombinant protein comprising the influenza B Victoria virus HA protein mutant according to any one of claims 1-5, wherein, The mutant HA protein of the type B Victoria influenza virus is linked to the original signal peptide of the HA protein or other optional signal peptides. Preferably, the type B Victoria influenza virus HA protein mutant removes the original signal peptide of the HA protein and then links it to other optional signal peptides; Preferably, the other optional signal peptide is inserted into the amino terminus (N-terminus) of the influenza B virus HA protein mutant. Preferably, the other optional signal peptides are directly linked to the influenza B virus HA protein mutant, or indirectly linked through a linker; Preferably, the other optional components include immunoglobulin κ chain signal peptide, tissue plasminogen activator (tPA) signal peptide, and signal peptide of human differentiation cluster 5 (CD5) protein; More preferably, the other optional signal peptide is the CD5 signal peptide, the amino acid sequence of which is shown in SEQ ID NO: 14; More preferably, the recombinant protein comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the sequence shown in SEQ ID NO: 18, 20, 22, 24, or 26. More preferably, the amino acid sequence of the recombinant protein is as shown in SEQ ID NO: 18, 20, 22, 24 or 26.

7. The recombinant protein according to claim 6, wherein the recombinant protein further comprises a polymerizing element; Preferably, the polymerizing element is directly connected to the type B Victoria influenza virus HA protein mutant, or indirectly connected through a linker; Preferably, the polymerizing element is inserted into the carboxyl terminus (C-terminus) of the type B Victoria influenza virus HA protein mutant. More preferably, the polymerizing element is indirectly connected to the carboxyl terminus (C-terminus) of the type B Victoria influenza virus HA protein mutant via a linker. More preferably, the multimerizing element is a trimerizing domain of T4 phage fibrin, and the amino acid sequence of the T4 trimerizing element is shown in SEQ ID NO: 28; More preferably, the amino acid sequence of the linker is as shown in SEQ ID NO: 30; More preferably, the amino acid sequence of the recombinant protein is the sequence shown in SEQ ID NO: 34, 36, 38, 40 or 42.

8. A nucleic acid molecule encoding a mutant of the type B Victoria influenza virus HA protein as described in any one of claims 1-5 or a recombinant protein as described in claim 6 or 7; Preferably, the nucleotide sequence of the nucleic acid molecule is a codon-optimized sequence; More preferably, the nucleotide sequence of the nucleic acid molecule is the sequence shown in SEQ ID NO: 3, 5, 7, 9, 11, 17, 19, 21, 23, 25, 33, 35, 37, 39 or 41.

9. An expression vector comprising the nucleic acid molecule of claim 8; Preferably, the expression vector is based on a eukaryotic expression plasmid; More preferably, the eukaryotic expression plasmid is KS001, pcDNA3.1, or pCAGGS.

10. A cell comprising the nucleic acid molecule of claim 8 or the expression vector of claim 9; Preferably, the cells are eukaryotic cells; More preferably, the cell is a mammalian cell; More preferably, the cells are HEK293 cells, CHO cells, or derived cells thereof; Particularly preferred, the cells are HEK293F cells or CHO-K1 cells.

11. A vaccine comprising a mutant of the HA protein of influenza B virus according to any one of claims 1-5, a recombinant protein according to claim 6 or 7, a nucleic acid molecule according to claim 8, or an expression vector according to claim 9; preferably, the vaccine further comprises a pharmaceutically acceptable adjuvant, a carrier, a diluent, or an excipient.

12. The use of the influenza B Victoria virus HA protein mutant according to any one of claims 1-5, the recombinant protein according to claim 6 or 7, the nucleic acid molecule according to claim 8, the expression vector according to claim 9, or the cell according to claim 10 in (a) or (b) or (c) below: (a) To prepare vaccines for the prevention and / or treatment of influenza virus infection; (b) To prepare medicines for the prevention and / or treatment of diseases caused by influenza viruses; (c) Prepare reagents or kits for the diagnosis and / or screening of influenza virus infection; Preferably, the influenza virus is type B Victoria influenza virus.

13. A method for in vitro detection of influenza virus for non-diagnostic purposes, the method comprising the step of contacting a sample to be tested with any one of claims 1-5, the HA protein mutant of influenza B virus according to any one of claims 6-5, the recombinant protein according to claim 6 or 7, the nucleic acid molecule according to claim 8, the expression vector according to claim 9, or the cell according to claim 10; Preferably, the influenza virus is type B Victoria influenza virus.

Images