Antibodies against IgG Fc fragment YTE mutant and their applications

Abstract

The application belongs to the technical field of monoclonal antibodies, and particularly relates to an antibody against an IgG Fc segment YTE mutant and application thereof.The antibody is selected from one of Ab1 to Ab3;the amino acid sequences of the light chain CDR1-3 of the antibodies Ab1-Ab3 are respectively shown as SEQ ID NO.3-5, 13-15 and 23-25; and the amino acid sequences of the heavy chain CDR1-3 of the antibodies Ab1-Ab3 are respectively shown as SEQ ID NO.8-10, 18-20 and 28-30.The three strains of antibodies provided in the application have high affinity, good specificity and high recognition sensitivity for IgG antibodies with YTE mutations, have important application value in the aspects of IgG pharmacodynamics / pharmacokinetics research and detection technology, and have the advantages of good detection specificity, strong anti-interference capability, high sensitivity, accurate and reliable results and the like.

Description

Technical Field

[0001] This invention relates to the field of monoclonal antibody technology, and in particular to antibodies against the YTE mutant of IgG Fc fragment and their applications. Background Technology

[0002] Antibodies are Y-type immunoglobulins produced by B lymphocytes in response to stimulation by foreign molecules or antigens. They consist of two identical antigen-binding fragments (Fab) and a crystallizable fragment (Fc). While the Fc fragment does not bind to the antigen, it mediates various biological effects and is closely related to the antibody's half-life. There are five main types of immunoglobulins (Ig) expressed in the human body: IgM, IgA, IgD, IgG, and IgE. Among them, IgG is the main type of antibody in blood and extracellular fluid, and due to its longer serum half-life, it has become the mainstay of current therapeutic antibodies. The half-life of IgG antibodies in the human body is approximately 2-4 weeks. Its metabolic regulation in vivo is controlled by binding to the neonatal Fc receptor (FcRn). FcRn binds to the CH2, CH3 junction of IgG and exhibits pH dependence. After being taken up by endothelial cells or monocytes, IgG antibodies in the blood bind to FcRn in the acidic endosome (pH 6-6.5) to form IgG-FcRn complexes, thus avoiding degradation by lysosomes. IgG that is not bound to FcRn will enter the lysosome for degradation. The IgG-FcRn complex is then transported to the cell surface. In the extracellular physiological environment (pH around 7.4), the affinity of IgG for FcRn decreases and dissociates, leading to the release of IgG into the recycling process. This receptor-mediated recycling mechanism results in a relatively long half-life and a low clearance rate of IgG in vivo.

[0003] Based on the protective and cycling mechanisms of FcRn against IgG, modifying the Fc sequence of antibodies to prolong the half-life of therapeutic antibodies, optimize pharmacokinetic characteristics, and reduce dosing frequency has become one of the hot topics in next-generation therapeutic antibodies. In recent years, scientists have conducted extensive research on the amino acid sequence of the Fc segment of IgG antibodies, attempting to identify key amino acids affecting the affinity between IgG antibodies and FcRn. Related studies have shown that various mutations in the Fc segment of IgG antibodies, such as T250Q / M428L, V308P, M428L, M252Y / S254T / T256E (YTE), M428L / N434S (LS), N434A, and N434H, can improve the affinity of modified IgG for FcRn at pH 6, while ensuring that the separation of the two remains unaffected under physiological pH conditions. In vivo experiments with these mutants showed that the modified therapeutic antibodies had a 2-4 fold longer terminal half-life. This prolonged half-life allows for sustained high blood drug concentrations, resulting in greater bioavailability and potential therapeutic efficacy. Among all Fc mutation types, YTE is one of the most studied and widely used mutations; antibodies modified with YTE in the Fc region provide durable and effective protection.

[0004] Pharmacokinetic (PK) assays of IgG YTE mutants are widely used in clinical practice to help study their metabolism and clearance rates in vivo, thereby optimizing dosing regimens. On the other hand, they help study the pharmacodynamic (PD) characteristics of YTE mutant antibodies, understanding the relationship between their efficacy and antibody dosage, and helping to determine the therapeutic window and efficacy targets. Currently, the anti-human IgG antibody YTE mutants used for detection in China are all polyclonal antisera, which have low specificity and sensitivity, and there is a lack of detection antibodies specifically targeting therapeutic IgG Fc fragment YTE mutants.

[0005] In summary, the development of high-performance antibodies against the YTE mutant of the IgG Fc segment is of great value for achieving high specificity and / or high sensitivity in monitoring the blood concentration of therapeutic IgG drugs and conducting pharmacokinetic studies. Summary of the Invention

[0006] To address the lack of detection antibodies against IgG Fc YTE mutants in existing technologies, this application provides three antibodies with high recognition specificity, affinity, and binding sensitivity against IgG Fc YTE mutants. These antibodies can effectively capture and stably bind to the target antigen, and have significant application value in pharmacodynamic / pharmacokinetic studies and detection technologies for therapeutic IgG YTE mutants. Therefore, this invention further provides the application of the aforementioned antibodies in the preparation of detection kits for IgG antibodies with YTE mutations or their Fc domains, and provides detection kits containing the aforementioned antibodies. This invention is achieved through the following technical solutions:

[0007] The first aspect of this invention provides an antibody against an IgG Fc fragment YTE mutant, the antibody being selected from one of Ab1 to Ab3; the antibody includes a light chain variable region and a heavy chain variable region, wherein: the amino acid sequences of CDR1, CDR2, and CDR3 on the light chain variable region of antibody Ab1 are as shown in SEQ ID NO. 3, SEQ ID NO. 4, and SEQ ID NO. 5, respectively, and the amino acid sequences of CDR1, CDR2, and CDR3 on the heavy chain variable region are as shown in SEQ ID NO. 8, SEQ ID NO. 9, and SEQ ID NO. 10, respectively; the amino acid sequences of CDR1, CDR2, and CDR3 on the light chain variable region of antibody Ab2 are as shown in SEQ ID NO. 13, SEQ ID NO. 14, and SEQ ID NO. 15, respectively, and the amino acid sequences of CDR1, CDR2, and CDR3 on the heavy chain variable region are as shown in SEQ ID NO. 18, SEQ ID NO. 19, and SEQ ID NO. 20, respectively; the amino acid sequences of CDR1, CDR2, and CDR3 on the light chain variable region of antibody Ab3 are as shown in SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, and ... As shown in NO.23, SEQ ID NO.24 and SEQ ID NO.25, the amino acid sequences of CDR1, CDR2 and CDR3 on the variable region of the heavy chain are shown in SEQ ID NO.28, SEQ ID NO.29 and SEQ ID NO.30, respectively.

[0008] A second aspect of the present invention provides a nucleic acid molecule that encodes an antibody against the IgG Fc segment YTE mutant as described above.

[0009] A third aspect of the present invention provides the use of the antibody against the YTE mutant of the Fc region of IgG as described above in the preparation of a detection kit for an IgG antibody with the YTE mutation or its Fc domain.

[0010] A fourth aspect of the present invention provides a detection kit for an IgG antibody with a YTE mutation or its Fc domain, the detection kit comprising an antibody against an IgG Fc YTE mutant as described above.

[0011] Compared with the prior art, the advantages and positive effects of the present invention are as follows:

[0012] The three monoclonal antibodies provided by this invention have high affinity, high specificity, and high recognition sensitivity for IgG antibodies with YTE mutations in the Fc region. They can be used to detect the blood concentration of IgG antibodies with YTE mutations in the Fc region, monitor the pharmacokinetic characteristics of drugs, etc. They have important application value in the pharmacodynamic / pharmacokinetic research and detection technology of therapeutic IgG, and have advantages such as good detection specificity, strong anti-interference ability, high sensitivity, and accurate and reliable results. Attached Figure Description

[0013] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0014] Figure 1 Example 2 of this invention uses enzyme-linked immunosorbent assay (ELISA) to detect the binding curves of different concentrations of monoclonal antibodies with YTE mutations to IgG antibodies.

[0015] Figure 2 Example 3 of the present invention uses enzyme-linked immunosorbent assay (ELISA) to detect the capture curves of monoclonal antibodies capturing different concentrations of IgG antibodies with YTE mutations. Detailed Implementation

[0016] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The embodiments described herein are for illustrative purposes only and are not intended to limit the invention.

[0017] Based on the information contained herein, various changes to the precise description of the invention can be readily made by those skilled in the art without departing from the spirit and scope of the appended claims. It should be understood that the scope of the invention is not limited to the defined processes, properties, or components, as these embodiments and other descriptions are merely illustrative of specific aspects of the invention. In fact, various modifications to embodiments of the invention that will be apparent to those skilled in the art or related fields are covered within the scope of the appended claims.

[0018] To better understand the invention and not to limit its scope, all figures and other numerical values ​​used in this invention to indicate amounts, percentages, or other quantities should, in all cases, be understood to be modified by the word "approximately." Therefore, unless specifically stated otherwise, the numerical parameters listed in the specification and appended claims are approximate values ​​and may vary depending on the desired properties being sought. Each numerical parameter should at least be considered as obtained based on reported significant figures and through conventional rounding methods.

[0019] Additionally, it should be noted that, unless otherwise defined, the scientific and technical terms used in the context of this invention should have the meanings commonly understood by those skilled in the art.

[0020] The terms “including,” “comprising,” “containing,” “having,” and similar words are non-restrictive and can include other steps and components that do not affect the result. The term “and / or” should be considered as a specific disclosure of each of the two specified features or components, with or without the other. For example, “A and / or B” is considered to include (i) A, (ii) B, and (iii) A and B. The terms “Ab1,” “Ab2,” “Ab3,” etc., are used to distinguish similar objects and are not necessarily used to describe a specific order or sequence; it should be understood that such use is interchangeable where appropriate.

[0021] The terms "rabbit monoclonal antibody," "monoclonal antibody," "rabbit-derived antibody," and "rabbit monoclonal antibody" have the same meaning. Unless otherwise specified, they all refer to antibodies that specifically bind to the YTE mutant of the IgG Fc segment. The modifier "rabbit" indicates that the complementarity-determining region (CDR) of this antibody is derived from a rabbit immunoglobulin sequence.

[0022] An antibody is an immunoglobulin molecule that specifically binds to a target antigen or epitope through at least one antigen recognition site located in the variable region of the immunoglobulin molecule. In this invention, the term "antibody" should be interpreted in the broadest sense and includes various antibody structures, including but not limited to so-called full-length antibodies, antibody fragments, and their genetic or chemical modifications, provided they exhibit the desired antigen-binding activity.

[0023] A typical antibody molecule (full-length antibody) consists of two identical light chains (L) and two identical heavy chains (H). Light chains can be classified into two types: κ chains and λ chains; heavy chains can be classified into five types: μ, δ, γ, α, and ε chains, with antibodies defined as IgM, IgD, IgG, IgA, and IgE, respectively. The amino acid sequences near the N-terminus of both the heavy and light chains vary considerably, while the amino acid sequences of other parts are relatively constant. The regions with significant amino acid sequence variation near the N-terminus in both the light and heavy chains are called variable regions (V), and the regions with relatively stable amino acid sequences near the C-terminus are called constant regions (C). The variable regions of the heavy chain (VH) and light chain (VL) are usually the most variable parts of the antibody and contain antigen recognition sites. The VH and VL regions can be further subdivided into hypervariable regions (HVR) and framework regions (FR). The hypervariable region, also known as the complementarity-determining region (CDR), is a ring structure. Heavy chain CDRs and light chain CDRs are tightly joined together by the FR region and cooperate to form a surface that is complementary to the three-dimensional structure of the target antigen or epitope, determining the antibody's specificity and serving as the site for antibody recognition and antigen binding. The FR regions are the more conserved parts of the VH and VL, generally exhibiting a β-sheet configuration, linked by three CDRs forming a connecting loop. Each VH and VL typically consists of three CDRs and four FRs, arranged in the following order from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0024] CDRs and FRs can be identified according to Kabat definitions, Chothia definitions, the sum of Kabat and Chothia definitions, AbM definitions, contact definitions, IMGT unique numbering definitions and / or conformational definitions, or any CDR determination method known in the art. As used in this invention, they are defined by the Kabat numbering system.

[0025] The light chain constant region (CL) and heavy chain constant region (CH) do not directly participate in antibody-antigen binding, but they exhibit different effector functions, such as involvement in antibody-dependent cytotoxicity. The CL lengths of different Ig types (κ or λ) are generally consistent, but the CH lengths differ among Ig classes; for example, IgG, IgA, and IgD include CH1, CH2, and CH3, while IgM and IgE include CH1, CH2, CH3, and CH4. The amino acid sequences of the antibody heavy and light chain constant regions are well-known in the art.

[0026] Full-length antibodies are the most complete antibody molecular structures, with a typical Y-type molecular structure. Therefore, in the context of this invention, "full-length antibody," "complete antibody," and "Y-type antibody" have the same meaning and can be used interchangeably.

[0027] An antibody fragment is one or more portions or segments of a full-length antibody that substantially retain the same biological function or activity as the full-length form. Specifically, an antibody fragment includes at least the same CDR region as the full-length antibody, and more preferably the same variable region, thereby retaining complete antigen recognition and binding sites, enabling it to bind to the same antigens, especially the same epitopes, as the full-length antibody. Typical examples of antibody fragments include Fab, F(ab)2, Fab', F(ab')2, Fv, (Fv)2, scFv, and sc(Fv)2, which can be obtained using conventional techniques in the art.

[0028] (i) Fab: An antigen-binding fragment (Fab) is a monovalent fragment consisting of a complete light chain (variable and constant regions) and a portion of a heavy chain (variable and first constant region). Fragments such as Fab, F(ab')2, and Fab' can be obtained by protease cleavage of a full-length antibody. For example, under the action of papain, IgG can be degraded into two Fab fragments and one Fc fragment; under the action of pepsin, IgG can be degraded into one F(ab')2 fragment and one pFc' fragment. The F(ab')2 fragment is further reduced to form two Fab' fragments. Because Fab possesses an antigen-binding region and a portion of a constant region, it not only has antibody-antigen affinity and excellent tissue penetration like scFv, but also has a more stable structure.

[0029] (ii)F(ab)2: Contains a bivalent segment consisting of two Fabs connected by a disulfide bridge in the hinge region.

[0030] (iii) Fv: The variable fragment (Fv) is located at the N-terminus of the antibody Fab fragment. It contains only the variable region and consists of a variable region of one light chain and one heavy chain. It is a non-covalently bound dimer of VH and VL (VH-VL dimer). The three CDRs of each variable region interact to form an antigen-binding site on the surface of the VH-VL dimer, which has the ability to recognize and bind antigens, although the affinity is lower than that of the intact antibody.

[0031] (iv)(Fv)2: Consists of two Fv segments covalently linked together.

[0032] (v)scFv: A single-chain variable fragment (scFv) is an Fv fragment composed of a single polypeptide chain, consisting of a heavy chain variable region (VH) and a light chain variable region (VL) linked by a flexible linker (typically composed of 10-25 amino acids). It retains the original antibody's specificity for binding to the antigen. The linker in this invention is not particularly limited as long as it does not interfere with the expression of the antibody variable regions linked to its two ends. Compared to full-length antibodies, scFv has a smaller molecular weight, thus exhibiting higher penetration and lower immune side effects.

[0033] The (vi)sc(Fv)2 segment is formed by connecting two heavy chain variable regions and two light chain variable regions through a joint, etc.

[0034] The terms "monoclonal antibody" or similar terms are used interchangeably and refer to a homogeneous group of antibodies, meaning that the individual antibodies constituting the group are identical except for a small number of naturally occurring mutations and / or post-translational modifications (e.g., isomerization, amidation). A "monoclonal antibody" is highly specific, exhibiting a single binding specificity and affinity for the same or substantially identical epitopes on an antigen. The modifier "monoclonal" indicates that the antibody is obtained from a substantially homogeneous group of antibodies and should not be interpreted as limiting the source or method of preparation of the antibody. This antibody can be prepared by a variety of methods, including but not limited to hybridoma, phage display, yeast display, recombinant DNA, single-cell screening, or single-cell sequencing.

[0035] The term “specific binding” is a well-known term in the art. A molecule exhibits “specific binding” if it reacts more frequently, more rapidly, for a longer duration, and / or with greater affinity for a particular target antigen or epitope than it reacts with other target antigens or epitopes. “Specific binding”, or “preferred binding”, does not necessarily require (although may include) exclusive binding.

[0036] To make the above-mentioned objectives and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below.

[0037] An embodiment of the present invention provides an antibody against the YTE mutant of the Fc segment of IgG, wherein the antibody is selected from one of Ab1 to Ab3; the antibody includes a light chain variable region (VL) and a heavy chain variable region (VH), both VL and VH including three complementarity-determining regions (CDRs), named CDR1, CDR2 and CDR3 respectively; wherein: the amino acid sequences of CDR1, CDR2 and CDR3 on the VL of antibody Ab1 are shown in SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5 respectively, and the amino acid sequences of CDR1, CDR2 and CDR3 on the VH are shown in SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10 respectively; the amino acid sequences of CDR1, CDR2 and CDR3 on the VL of antibody Ab2 are shown in SEQ ID NO.13, SEQ ID NO.14 and SEQ ID NO.15 respectively, and the amino acid sequences of CDR1, CDR2 and CDR3 on the VH are shown in SEQ ID NO.18, SEQ ID NO.19 and SEQ ID NO.10 respectively. As shown in NO.20; the amino acid sequences of CDR1, CDR2 and CDR3 on VL of antibody Ab3 are shown in SEQ ID NO.23, SEQ ID NO.24 and SEQ ID NO.25, respectively, and the amino acid sequences of CDR1, CDR2 and CDR3 on VH are shown in SEQ ID NO.28, SEQ ID NO.29 and SEQ ID NO.30, respectively.

[0038] This invention uses the Fc fragment of an IgG antibody with a YTE mutation as an immunogen to immunize rabbits, developing three rabbit monoclonal antibodies. These antibodies can bind with high affinity to the therapeutic IgG antibodies Tixagevimab and Cilgavimab with YTE mutations, with an affinity constant K. D With a specificity at the 0.01 nM-0.001 nM level and no cross-reactivity with human IgG antibodies and wild-type Fc fragments, this antibody exhibits high specificity and can serve as a capture antibody. It effectively recognizes and sensitively captures target antigens in the reaction system at extremely low working concentrations, providing a high-performance antibody tool for the qualitative or quantitative detection of therapeutic IgG antibodies with YTE mutations. The antibody of this invention can be used to detect the blood concentration of IgG antibodies with YTE mutations in the Fc fragment, monitor the pharmacokinetic characteristics of drugs, etc., and has significant application value in PK / PD research and detection technology for therapeutic IgG, possessing advantages such as high detection specificity, strong anti-interference ability, high sensitivity, and accurate and reliable results.

[0039] It should be noted that in this invention, the terms "IgG Fc YTE mutant," "Fc YTE mutation," "IgG YTE mutation," "YTE mutant," and similar terms have the same meaning, all referring to the M252Y / S254T / T256E (YTE) mutation in the Fc domain (or fragment) of IgG antibodies or proteins with IgG antibody-like structures. Therefore, the antibodies of this invention can be used to bind Fc domains with only the YTE mutation form, or to bind IgG antibodies or similar proteins with the YTE mutation form.

[0040] Optionally, both the light chain variable region (VL) and the heavy chain variable region (VH) include four frame regions (FRs), which are arranged alternately with three core parameters (CDRs) to form the variable region. The amino acid sequence of the VL of antibody Ab1 is shown in SEQ ID NO.2, and the amino acid sequence of the VH is shown in SEQ ID NO.7; the amino acid sequence of the VL of antibody Ab2 is shown in SEQ ID NO.12, and the amino acid sequence of the VH is shown in SEQ ID NO.17; the amino acid sequence of the VL of antibody Ab3 is shown in SEQ ID NO.22, and the amino acid sequence of the VH is shown in SEQ ID NO.27.

[0041] Optionally, the antibody further includes a light chain constant region (CL) and a heavy chain constant region (CH), where CL and VL constitute the light chain (FL), and CH and VH constitute the heavy chain (FH). The constant regions of the antibody are typically available through public searches, such as searching for mouse IgG gamma C reign to obtain CH and searching for mouse IgG Kappa Creign to obtain CL using the IMGT online database (www.imgt.org).

[0042] Specifically, the amino acid sequence of the light chain of antibody Ab1 (corresponding to 6H2) is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.6; the amino acid sequence of the light chain of antibody Ab2 (corresponding to 6C1) is shown in SEQ ID NO.11, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.16; the amino acid sequence of the light chain of antibody Ab3 (corresponding to 3D4) is shown in SEQ ID NO.21, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.26.

[0043] In a preferred embodiment, the antibody is preferably Ab1 or Ab2, more preferably Ab2.

[0044] Optionally, the antibody is a full-length antibody (with a typical Y-shaped molecular structure) or an antigen-binding region of a full-length antibody; the antigen-binding region refers to a polypeptide that substantially retains the same biological function or activity as the full-length antibody. Specifically, the antigen-binding region includes the CDR region as described above, and more preferably has the variable region as described above, thereby retaining an intact antigen recognition and binding site, capable of binding to the same antigen as the full-length antibody, especially to the same epitope. Optionally, the antigen-binding region is selected from at least one of Fab, F(ab)2, Fab', F(ab')2, Fv, (Fv)2, scFv, and sc(Fv)2. These antigen-binding regions can be obtained using conventional techniques.

[0045] Another embodiment of the present invention provides a nucleic acid molecule that encodes an antibody against the YTE mutant of the IgG Fc segment as described above.

[0046] Nucleic acid molecules can be in the form of DNA (e.g., cDNA, genomic DNA, or synthetic DNA) or RNA (e.g., mRNA or synthetic RNA). DNA can be single-stranded or double-stranded, and can be a coding strand or a non-coding strand. The sequence of a nucleic acid molecule can be derived from the amino acid sequence of the antibody using conventional methods such as codon coding rules.

[0047] Optionally, the nucleic acid sequence of the light chain of antibody Ab1 is as shown in SEQ ID NO.31 or its complementary sequence, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.32 or its complementary sequence; the nucleic acid sequence of the light chain of antibody Ab2 is as shown in SEQ ID NO.33 or its complementary sequence, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.34 or its complementary sequence; the nucleic acid sequence of the light chain of antibody Ab3 is as shown in SEQ ID NO.35 or its complementary sequence, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.36 or its complementary sequence.

[0048] Those skilled in the art will understand that, due to the degeneracy of the genetic code, nucleic acid molecules other than those in the foregoing examples can also encode the nanobodies of this invention. Therefore, such nucleic acid molecules should not be considered as limiting the scope of protection of this invention. The full-length sequence of a nucleic acid molecule or a fragment thereof can typically be obtained using PCR amplification, recombinant methods, or artificial synthesis.

[0049] Another embodiment of the present invention provides the application of the antibody against the YTE mutant of the Fc segment of IgG as described above in the preparation of a detection kit for IgG antibodies with YTE mutation or their Fc domain.

[0050] The advantages of the antibody against the YTE mutant of the Fc region of IgG in the preparation of detection kits for IgG antibodies with YTE mutations or their Fc domains are the same as the advantages of the antibody against the YTE mutant of the Fc region of IgG over the prior art as described above, and will not be repeated here.

[0051] Optionally, the IgG antibody is selected from Tixagevimab or Cilgavimab.

[0052] This invention also provides a detection kit for IgG antibodies with YTE mutations or their Fc domains, the detection kit comprising the antibody against the YTE mutant of the IgG Fc segment as described above.

[0053] It should be noted that the antibodies of the present invention can be used alone or combined with or conjugated with detection markers to form antibody-drug conjugates. In some embodiments, the antibodies of the present invention are used as antigen-binding antibodies, which specifically recognize and bind to antigens such as IgG antibodies with YTE mutations or their Fc domains in the sample to be tested. Then, a recognizable signal change is generated by the detection marker attached to them to achieve qualitative or quantitative detection of therapeutic IgG antibodies. In other embodiments, the antibody against the YTE mutant of the Fc segment of IgG is not labeled (as a primary antibody or capture antibody), but the detection marker is conjugated to a secondary antibody (as a detection antibody) or other molecules that can bind to the primary antibody. For example, if the antibody against the YTE mutant of the Fc segment of IgG is a rabbit-derived IgG antibody, then the secondary antibody can be an anti-rabbit IgG antibody. Thus, after the secondary antibody conjugated with the detection marker specifically binds to the antibody of the present invention, a recognizable signal change is generated, thereby achieving qualitative or quantitative detection of therapeutic IgG antibodies.

[0054] The detection markers used to generate identifiable signal changes include, but are not limited to: biotin, fluorescent dyes (such as umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazineamine fluorescein, dansyl chloride), fluorescent proteins (such as isophycocyanin, phycoerythrin, PerCP and phycocyanin), enzymes (such as alkaline phosphatase, acid phosphatase, β-galactosidase, glucose oxidase, horseradish peroxidase, acetylcholinesterase), colloidal gold, colored magnetic beads, latex particles, radionuclides, detection antibodies or combinations thereof.

[0055] The detection methods described above include, but are not limited to, enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunospot assay (ELISPOT), immunohistochemistry (IHC), immunofluorescence assay (IF), Western blotting (WB), and flow cytometry (FC). Samples to be tested include, but are not limited to, serum, plasma, urine, cell culture medium, and tissue homogenate.

[0056] Optionally, the detection kit is an enzyme-linked immunosorbent assay (ELISA) kit, and the detection kit further includes a secondary antibody, which is used to bind an antibody against an IgG Fc fragment YTE mutant or to bind an IgG antibody with a YTE mutation or its Fc domain.

[0057] The present invention will be further illustrated below with reference to specific embodiments. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions, such as those described in *Molecular Cloning: A Laboratory Manual (Fourth Edition)* published by Cold Spring Harbor Laboratory, or as recommended by the manufacturer.

[0058] Example 1: Preparation of Antibody Against IgG Fc Fragment YTE Mutant

[0059] 1. Preparation of YTE mutant of IgG Fc segment

[0060] The binding mechanism of the crystallizable fragment (Fc segment) of IgG to FcRn can reduce antibody degradation by lysosomes and promote antibody recycling. Triple mutations in the CH2-CH3 region of the IgG antibody Fc segment, such as the M252Y / S254T / T256E (YTE) mutation, can alter the antibody's affinity for FcRn, increasing binding by 11-fold at acidic endosomal pH while maintaining the same binding at extracellular pH. This prolongs the half-life of the antibody drug in serum, thereby enhancing its efficacy. The neutralizing antibody combination tixagevimab / cilgavimab (formerly known as AZD7442), after YTE modification of its Fc segment, has a half-life of approximately 90 days in humans and is used for pre-exposure prophylaxis against SARS-CoV-2.

[0061] In this embodiment, human IgG Fc fragments containing YTE mutants were used as immunogens (or antigens) and detectors to immunize New Zealand white rabbits and to isolate and screen target antibodies, resulting in the development of three rabbit monoclonal antibodies: 3D4, 6C1, and 6H2. Additionally, human IgG Fc fragment mix (including a mixture of IgG1-IgG4 Fc fragments), Tixagevimab, and Cilgavimab monoclonal antibodies were used as detectors to verify the performance of the target antibodies in recognizing and binding to YTE mutants. The protein sequences of hIgG1 Fc in the human IgG (hIgG) Fc mix are shown in NCBI GenBank accession number AEV43323.1, hIgG2 Fc in uniprot accession number P01859-2 (corresponding to 99-326aa), hIgG3 Fc in uniprot accession number P01860-2 (corresponding to 99-377aa), and hIgG4 Fc in uniprot accession number P01861-2 (corresponding to 99-327aa). The YTE mutant (YTE hIgG1 Fc) can be found in the literature "Acqua WFD, Woods RM, Ward ES, et al. Increasing the Affinity of a Human IgG1 for the Neonatal Fc Receptor: Biological Consequences[J]. Journal of Immunology, 2002, 169(9):5171-80." The full-length sequences of Tixagevimab and Cilgavimab monoclonal antibodies were obtained from the KEGG database, and their antibody numbers are D11993 (link: https: / / www.kegg.jp / entry / D11993) and D11994 (link: https: / / www.kegg.jp / entry / D11994), respectively. Specifically, the amino acid (AA) and nucleotide (DNA) sequences of the antigen and detector in this embodiment are shown in Table 1.

[0062] Table 1. Amino acid and nucleotide sequence information of the antigen and detector in this embodiment.

[0063]

[0064]

[0065]

[0066] Protein expression: The gene sequences of WT hIgG1 Fc, hIgG2 Fc, hIgG3 Fc, hIgG4 Fc, YTE hIgG1 Fc, Tixagevimab, and Cilgavimab were synthesized by Anhui General Biotechnology Co., Ltd. and constructed into the mammalian expression vector pcDNA3.4. Sequencing was used to verify the correctness of the vector construction. HEK293F cells were cultured in a cell culture incubator at 37℃ and 5% CO2 until the logarithmic growth phase, typically at 1-3 × 10⁻⁶ cells / year. 6 cells / mL; HEK293F cells were transfected with the correctly sequenced expression vector using electroporation, and cell viability was recorded every 24 h after transfection; after 72-96 h of transfection, the culture supernatant was obtained by centrifugation at 15000g and 4℃ for 30 min, and the supernatant was collected and filtered through a 0.22 μm filter to remove residual cells and cell debris. It should be noted that when transfecting HEK293F cells with Tixagevimab and Cilgavimab monoclonal antibodies, the light chain and heavy chain expression vectors must be co-transfected.

[0067] Protein purification: hIgG1 Fc protein, hIgG2 Fc protein, hIgG3 Fc protein, hIgG4 Fc protein, YTE hIgG1 Fc protein, Tixagevimab monoclonal antibody, and Cilgavimab monoclonal antibody were purified from the culture supernatant after transfection with the corresponding expression vectors using Protein A resin (purchased from Suzhou Nanomicrobial Technology Co., Ltd., catalog number 17013-070100). After protein identification, the proteins were aliquoted and stored at -20°C.

[0068] 2. Preparation of antibodies against the YTE mutant of IgG Fc fragment

[0069] Based on monoclonal antibody development technology using single B lymphocyte screening and culture, New Zealand white rabbits were immunized with YTE hIgG1 Fc protein as the immunogen. Each rabbit received 200 μg of the immunogen. Before the first immunization, the immunogen was mixed with an equal volume of complete Freund's adjuvant to form an emulsion, which was injected subcutaneously at multiple sites on the rabbit's abdomen and back. Every three weeks after the first immunization, 150 μg of the immunogen was mixed with an equal volume of incomplete Freund's adjuvant to form an emulsion, which was then injected subcutaneously at multiple sites on the rabbit's abdomen and back for two booster immunizations. After three immunizations, rabbit serum samples were collected, and the titers against Tixagevimab or Cilgavimab monoclonal antibodies were determined using ELISA. The serum from the last immunization was purified into antibodies. Rabbits with high serum titers and the best ELISA results were selected for a booster immunization with 200 μg of the immunogen injected subcutaneously at multiple sites. The spleen was harvested three days later.

[0070] Fresh single spleen cells were isolated from the spleen and cultured overnight in B cell culture medium to obtain a fresh single-cell suspension. Individual B cells were then isolated from the single-cell suspension and sorted using an MA900 Flow Cell Sorter (purchased from SONY, Japan, catalog number MA900). Primary B cells with specific recognition ability for the hIgG1 YTE mutant were cultured at 37°C and 5% CO2 for 10–14 days. At the end of the primary B cell culture, positive clones were identified by ELISA coated with Tixagevimab or Cilgavimab. Generally, the OD of positive B cell clones is [missing information]. 450nm The value is more than 5 times that of the background noise.

[0071] B cells from positive clones were lysed, RNA was extracted, and reverse transcribed into cDNA. The cDNA was amplified by PCR to obtain the genes for the heavy chain variable region (VH) and light chain variable region (VL) of naturally paired rabbit monoclonal antibodies; the primer sequences are shown in Listing 2.

[0072] Table 2. PCR primers for rabbit anti-variable region amplification

[0073] sequence Sequence information Light kappa primers (5') CAGCATGGACACGAGGGCCCCACTC (see SEQ ID NO.55) Light kappa primers (3') GTGTCAGAGTGCTGCTGAGGTTGTAGGTAC (see SEQ ID NO.56) heavy primers (5') CTCACCATGGAGACTGGGCTGCGCTGGC (see SEQ ID NO. 57) heavy primers (3') GAGGGTGCCCGAGTTCCAGGTCACG (see SEQ ID NO.58)

[0074] The naturally paired rabbit monoclonal antibody light and heavy chain variable region genes (VH and VL) were amplified from the cDNA of the corresponding positive clones using PCR, and their sequences were determined by sequencing. The selected clones' VL and VH genes were then loaded into the expression vector pcDNA3.4, which contains the heavy chain constant region (CH) and light chain constant region (CL), respectively, to obtain full-length IgG heavy and light chain gene expression vectors. The CL and CH genes were obtained by searching the IMGT online database (www.imgt.org) for rabbit-derived IgG gamma Creign to obtain CH, and for rabbit-derived IgG Kappa C reign to obtain CL.

[0075] HEK293F cells were co-transfected with IgG heavy and light chain gene expression vectors. The supernatant containing recombinant rabbit IgG protein transfected with HEK293T cells was screened for specificity against Tixagevimab and Cilgavimab using ELISA. The cell culture supernatant was purified by Protein A affinity chromatography to obtain the target antibody strains 3D4, 6C1, and 6H2. The purity of the antibody strains was verified by SDS-PAGE. For details of the above process, please refer to our prior patent "Anti-human CD40 protein monoclonal antibody, preparation method and application (Publication No.: CN115947854A, Publication Date: 2023-04-11)".

[0076] 3. Large-scale production of antibodies against the YTE mutant of IgG Fc fragment

[0077] In large-scale antibody production, recombinant genetic engineering technology is used to obtain them. First, DNA molecules encoding the heavy and light chain genes of antibodies 3D4, 6C1, and 6H2 are obtained through whole-genome synthesis or PCR amplification (see SEQ ID NO. 31-36). Typically, a signal peptide sequence is added to the front end of the DNA molecule to achieve secretory expression. Then, the DNA molecule with the signal peptide is inserted into the multiple cloning site of the expression vector. The expression vector carrying the heavy and light chain encoding genes is then co-transfected into host cells. The transfected host cells are cultured under specific conditions. After routine culture, the culture supernatant from the host cells transfected with the heavy and light chain expression vectors is collected and purified using protein A resin. Commonly used expression vectors are pcDNA3.4, and the host cells are HEK293F cells. Commonly used upstream signal peptides for VL cells are “MDTRAPTQLLGLLLLWLPGATF” or “MDTRAPTQLLGLLLLWLPGARC”, and for VH cells, “METGLRWLLLVAVLKGVQC”. For details of the aforementioned process, please refer to the patents “Rabbit Monoclonal Antibody Against Human Interferon α2 and Its Application (Publication No.: CN116063487A, Publication Date: 2023-05-05)” and “High Affinity Rabbit Monoclonal Antibody Against Human IL-5 and Its Application (Publication No.: CN115819578A, Publication Date: 2023-03-21)”.

[0078] Antibody sequencing was performed by Kinkai Biotechnology Co., Ltd. The AA and DNA sequences of antibody strains 3D4, 6C1, and 6H2 are shown in Tables 3-5, respectively. VH and VL are rabbit-derived sequences, while CH1, CL, and Fc are rabbit-derived IgG sequences. For ease of description, the light chain complementarity-determining regions (CDRs) 1-3 are denoted as LCDR1-3, and the heavy chain complementarity-determining regions (CDRs) 1-3 are denoted as HCDR1-3.

[0079] Table 3. Sequence information of rabbit monoclonal antibody 6H2 in this embodiment.

[0080]

[0081] Table 4. Sequence information of rabbit monoclonal antibody 6C1 in this embodiment.

[0082]

[0083]

[0084] Table 5. Sequence information of rabbit monoclonal antibody 3D4 in this embodiment.

[0085]

[0086]

[0087] Example 2: ELISA identification of the specificity of rabbit monoclonal antibody against IgG Fc fragment YTE mutant.

[0088] The binding specificity of the prepared rabbit monoclonal antibody against the YTE mutant was identified by enzyme-linked immunosorbent assay (ELISA), including: (1) coating Tixagevimab, Cilgavimab, WT human IgG Fc mix or total human IgG as detection agents onto an ELISA plate (purchased from Corning, catalog number 9018) and incubating overnight at 4°C and pH 7.4 in 1×PBS; wherein, Tixagevimab and Cilgavimab were used as positive detection agents, and WT human IgG Fc mix (mixed from hIgG1, hIgG2, hIgG3, and hIgG4 in a molar ratio of 1:1:1:1) and total human IgG were used as positive detection agents. IgG (purchased from Sigma, catalog number I4506-100MG) was used as the negative detection agent, and the detection agent coating concentration was 1 μg / mL; (2) The ELISA plate coated with the detection agent was washed 3 times with washing buffer (1×PBS with 0.5% Tween-20 added) and then blocked with blocking buffer (1×PBS with 5% skim milk added); (3) After blocking, serially diluted monoclonal antibody (3D4, 6C1 or 6H2) was added to the ELISA plate and incubated at room temperature for 1 h. The antibody was diluted with dilution buffer (with 0.5% Tween-20 and B) SA was diluted to 1 μg / mL with 1×PBS, and then serially diluted down 3-fold for a total of 12 concentrations, with the following concentrations: 1 μg / mL, 333.3333 ng / mL, 111.1111 ng / mL, 37.0370 ng / mL, 12.3456 ng / mL, 4.1152 ng / mL, 1.3717 ng / mL, 0.4572 ng / mL, 0.1524 ng / mL, 0.0508 ng / mL, 0.0169 ng / mL, and 0.0056 ng / mL. This was in response to the total... For the human IgG binding ELISA assay, the antibody was diluted to 10 μg / mL using dilution buffer, and then serially diluted down 4-fold for a total of 7 concentrations: 10 μg / mL, 2.5000 μg / mL, 0.6250 μg / mL, 0.1562 μg / mL, 0.0391 μg / mL, 0.0098 μg / mL, and 0.0.024 μg / mL; blank control (NC) added to dilution buffer; (4) washed 5 times with washing buffer, then incubated with HRP GoatAnti-Rabbit IgG (H+L) diluted with blocking buffer (Jackson Immuno Research, catalog number 111-035-045) (dilution ratio 1:5000); (5) washed 5 times with washing buffer, then added 25 μL of TMB substrate (Thermo Fisher, catalog number 34029), and placed in the dark at room temperature for 3 min, then stopped the colorimetric reaction of the TMB substrate with 20 μL of 1M sulfuric acid. The optical density (OD) values ​​at 450 nm and 630 nm were measured using an Epoch microplate spectrophotometer (Biotek, USA), and the correction value was OD. 450 Subtract OD 630 get.

[0089] The results are as follows Figure 1 As shown, from left to right and top to bottom, the binding curves of the positive detectants Tixagevimab and Cilgavimab, and the negative detectants WT human IgG Fc mix and total human IgG with different concentrations of antibodies are displayed. The horizontal axis represents antibody concentration, and the vertical axis represents OD correction value. The results show that rabbit monoclonal antibodies 3D4, 6C1, and 6H2 can cross-recognize the therapeutic IgG antibodies Tixagevimab and Cilgavimab containing the YTE mutation, achieving a half-maximal effective concentration (EC50) for Tixagevimab. 50 The values ​​were 9.289 ng / mL, 9.122 ng / mL, and 9.327 ng / mL, respectively; for the half-maximal effective concentration (EC50) of Cilgavimab... 50 The values ​​were 10.01 ng / mL, 2.540 ng / mL, and 5.737 ng / mL, respectively. At low concentrations, the antibodies showed no binding signal with WT hIgG Fc mix and Total HumanIgG, while at high concentrations, they exhibited weaker binding. Specifically, 6C1 and 6H2 showed even weaker binding to the negative detection antigen, demonstrating high antigen recognition specificity and sensitivity.

[0090] Example 3: Rabbit monoclonal antibody applied to capture ELISA for detection of IgG Fc fragment YTE mutant.

[0091] The capture ELISA method was used to identify the capture ability of the prepared rabbit monoclonal antibody against the YTE mutant, including: (1) adding 25 μL / well of monoclonal antibody (3D4, 6C1 or 6H2) dilution to a high-binding ELISA plate, with a coating concentration of 1 μg / mL, and coating overnight at 4°C; (2) washing the antibody-coated ELISA plate with washing buffer and then blocking it with blocking buffer; (3) adding serially diluted Tixagevimab or Cilgavimab to the blocked ELISA plate at a dose of 25 μL / well, starting at a concentration of 1 μg / mL, and then continuously diluting it 3-fold downward for 7 gradients, and incubating it at room temperature for 1 h; adding dilution buffer to the blank control (NC); (4) washing with washing buffer and then adding Donkey anti Human IgG-HRP (purchased from Jackson Immuno) diluted with blocking buffer. Research, catalog number 709-035-149 (dilution ratio 1:5000) incubated; (5) after cleaning the well plate after the above incubation, the optical density (OD) values ​​at 450 nm and 630 nm were measured using an Epoch microplate spectrophotometer (Biotek, USA) with HRP-catalyzed colorimetric reaction, and the correction value was calculated using OD. 450 Reduce OD 630 get.

[0092] The results are as follows Figure 2 As shown, from left to right and top to bottom, the capture curves of antibody strains 3D4, 6C1, and 6H2 with different concentrations of antigen are displayed. The horizontal axis represents the antigen concentration, and the vertical axis represents the OD correction value. The results show that rabbit monoclonal antibodies 3D4, 6C1, and 6H2 all have the ability to capture the therapeutic YTE mutant antibodies Tixagevimab and Cilgavimab.

[0093] Example 4: Affinity determination of rabbit monoclonal antibodies 3D4, 6C1, and 6H2 binding to Tixagevimab

[0094] The affinity of antibody strains 3D4, 6C1, and 6H2 was accurately determined using a GE Biacore 3000 biomolecular interaction analyzer. The steps were as follows: (1) The probe Anti-Rabbit FC (purchased from Cytiva, catalog number BR-1008-39) was immersed in a diluted antibody solution to bind the probe to the antibody at a binding height of about 0.8 nm, and then the residual antibody was washed off; (2) The probe bound to the antibody was immersed in a diluted Tixagevimab solution with antigen concentrations of 100 nM, 50 nM, 25 nM, 12.5 nM, and 6.25 nM, respectively, to allow the antibody bound to the probe to bind to different concentrations of antigen, and the antigen-antibody binding curve was monitored. Finally, the affinity curves of the antibodies were obtained by curve fitting and calculation, as shown in Table 6. Among them, Kon (1 / MS) is the binding rate constant, describing the rate at which the antibody binds to the antigen; K off (1 / s) is the dissociation rate constant, describing the rate at which the antibody separates from the antigen, representing the number of events per second that dissociate from the bound state; K D (M) is the dissociation equilibrium constant, representing the stability of the binding between the antibody and antigen under equilibrium conditions, reflecting the affinity of the binding. It should be noted that the dissociation rates (K2) of 6H2 and 6C1 are also related. off The affinity constant (K) is so low that no obvious dissociation can be observed within the experimental timeframe; this typically occurs when the affinity constant (K) is very low. D At picomolar (pM) levels or lower, therefore the K values ​​of these two antibodies are... off Take the minimum value from this experiment.

[0095] Table 6. Results of Affinity-Related Parameter Measurements for Monoclonal Antibodies

[0096] Antibody <![CDATA[K off (1 / s)]]> <![CDATA[K on (1 / Ms)]]> <![CDATA[K D (M)]]> 6H2 <![CDATA[3.76×10 -6 ]]> <![CDATA[7.34×10 -5 ]]> <![CDATA[5.12×10 -12 ]]> 6C1 <![CDATA[3.76×10 -6 ]]> <![CDATA[6.40×10 -5 ]]> <![CDATA[5.87×10 -12 ]]> 3D4 <![CDATA[2.66×10 -5 ]]> <![CDATA[5.02×10 -5 ]]> <![CDATA[5.30×10 -11 ]]>

[0097] As can be seen from Table 6, the antibody of the present invention has high affinity for Tixagevimab, a therapeutic antibody with Fc YTE mutation, with affinity constants reaching the level of 1 nM to 0.001 nM. No binding signal was detected between the antibody and 50 nM WT hIgG, confirming that the antibody has high specificity.

[0098] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. An antibody against the YTE mutant of the IgG Fc fragment, characterized in that, The antibody is selected from one of Ab1 to Ab3; the antibody includes a light chain variable region and a heavy chain variable region, wherein: The amino acid sequences of CDR1, CDR2 and CDR3 on the light chain variable region of antibody Ab1 are shown in SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5, respectively, and the amino acid sequences of CDR1, CDR2 and CDR3 on the heavy chain variable region are shown in SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10, respectively. The amino acid sequences of CDR1, CDR2 and CDR3 on the light chain variable region of antibody Ab2 are shown in SEQ ID NO.13, SEQ ID NO.14 and SEQ ID NO.15, respectively, and the amino acid sequences of CDR1, CDR2 and CDR3 on the heavy chain variable region are shown in SEQ ID NO.18, SEQ ID NO.19 and SEQ ID NO.20, respectively. The amino acid sequences of CDR1, CDR2 and CDR3 on the light chain variable region of antibody Ab3 are shown in SEQ ID NO.23, SEQ ID NO.24 and SEQ ID NO.25, respectively, and the amino acid sequences of CDR1, CDR2 and CDR3 on the heavy chain variable region are shown in SEQ ID NO.28, SEQ ID NO.29 and SEQ ID NO.30, respectively.

2. The antibody against the IgG Fc fragment YTE mutant according to claim 1, characterized in that, The amino acid sequence of the light chain variable region of antibody Ab1 is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.7; The amino acid sequence of the light chain variable region of antibody Ab2 is shown in SEQ ID NO.12, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.

17. The amino acid sequence of the light chain variable region of antibody Ab3 is shown in SEQ ID NO.22, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.

27.

3. The antibody against the IgG Fc fragment YTE mutant according to claim 2, characterized in that, The amino acid sequence of the light chain of antibody Ab1 is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.6; The amino acid sequence of the light chain of antibody Ab2 is shown in SEQ ID NO.11, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.

16. The amino acid sequence of the light chain of antibody Ab3 is shown in SEQ ID NO.21, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.

26.

4. The antibody against the IgG Fc fragment YTE mutant according to claim 1, characterized in that, The antibody is a full-length antibody or the antigen-binding region of the full-length antibody; The antigen-binding region is selected from Fab, F(ab)2, Fab', F(ab')2, Fv, (Fv)2, scFv, or sc(Fv)2.

5. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes an antibody against the YTE mutant of the IgG Fc segment as described in any one of claims 1-4.

6. The nucleic acid molecule according to claim 5, characterized in that, The nucleic acid sequence of the light chain of antibody Ab1 is shown in SEQ ID NO. 31 or is complementary to it, and the nucleic acid sequence of the heavy chain is shown in SEQ ID NO. 32 or is complementary to it. The nucleic acid sequence of the light chain of antibody Ab2 is shown in SEQ ID NO.33 or is complementary to it, and the nucleic acid sequence of the heavy chain is shown in SEQ ID NO.34 or is complementary to it. The nucleic acid sequence of the light chain of antibody Ab3 is shown in SEQ ID NO.35 or is complementary to it, and the nucleic acid sequence of the heavy chain is shown in SEQ ID NO.36 or is complementary to it.

7. The use of the antibody against the YTE mutant of the Fc segment of IgG as described in any one of claims 1-4 in the preparation of a detection kit for IgG antibodies with YTE mutation or their Fc domain.

8. The use of the antibody against the YTE mutant of the IgG Fc segment according to claim 7 in the preparation of a detection kit for an IgG antibody with the YTE mutation or its Fc domain, characterized in that, The IgG antibody is selected from Tixagevimab or Cilgavimab.

9. A detection kit for an IgG antibody with a YTE mutation or its Fc domain, characterized in that, Including antibodies against the YTE mutant of the IgG Fc segment as described in any one of claims 1-4.

10. The detection kit for the IgG antibody with YTE mutation or its Fc domain according to claim 9, characterized in that, The detection kit is an enzyme-linked immunosorbent assay (ELISA) kit, which also includes a secondary antibody. The secondary antibody is used to bind an antibody against an IgG Fc fragment YTE mutant or to bind an IgG antibody with a YTE mutation or its Fc domain.

Images