Serreatia plymuthica and application thereof in preventing and treating atractylodes rhizome root rot
By screening and applying Serratia puchengensis R72, the problem of root rot in Atractylodes lancea has been solved, achieving efficient and environmentally friendly biological control and meeting the needs of green and safe production of Chinese medicinal materials.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-11
- Publication Date
- 2026-05-29
AI Technical Summary
The prevention and control of root rot in Atractylodes lancea mainly relies on agricultural measures and chemical pesticides, which have problems such as long cycle, slow effect and easy environmental pollution, making it difficult to meet the requirements of green and safe production of Chinese medicinal materials.
The *Serratia pluvialis* strain R72, which exhibits highly efficient antagonistic activity, was screened out for use against *Fusarium oxysporum*. This strain was then used to prepare biocontrol agents or agricultural pesticides for the prevention and control of root rot in *Atractylodes lancea*.
Serratia puchengensis R72 has a significant inhibitory effect on Fusarium oxysporum, the main pathogen causing root rot in Atractylodes lancea, with an inhibition rate of 89.3%. It also has a strong antagonistic effect on a variety of plant diseases, providing a safe and efficient biological control solution.
Smart Images

Figure CN122104516A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biocontrol microbial technology, specifically relating to a strain of Serratia puchengensis and its application in controlling root rot in Atractylodes lancea. Background Technology
[0002] In recent years, with the continuous growth in market demand for the medicinal herb Atractylodes lancea, wild resources have become increasingly depleted due to over-harvesting and habitat destruction, making artificial cultivation the main method of supply. However, in the large-scale cultivation of Atractylodes lancea (especially Southern Atractylodes lancea), problems such as irregular field management, prominent continuous cropping obstacles, and frequent outbreaks of diseases, pests, and weeds have led to a serious decline in yield and quality, posing a severe challenge to the industry's development. Among these challenges, root rot caused by soil-borne pathogens has become the primary disease restricting the production of Southern Atractylodes lancea, potentially causing an incidence rate as high as 90% and resulting in huge economic losses. Currently, the control of root rot mainly relies on agricultural measures and chemical pesticides. Agricultural control has a long cycle and slow effect; while chemical control is effective in the short term, it easily leads to environmental pollution, excessive pesticide residues in medicinal materials, and the development of drug resistance in pathogens, which does not meet the requirements for green and safe production of medicinal herbs. Therefore, developing efficient and environmentally friendly biological control technologies has become an urgent need for the industry's development. Summary of the Invention
[0003] To address the aforementioned technical problems, this invention isolates and screens a biocontrol strain R72 with highly efficient antagonistic effects from the rhizosphere soil of Atractylodes lancea. Its inhibitory effect on major pathogens and its disease prevention ability against Atractylodes lancea were evaluated, and its disease prevention mechanism was preliminarily explored. The aim is to provide a safe and efficient microbial preparation and supporting application method for the green control of root rot in Atractylodes lancea, which is of great significance for ensuring the quality of medicinal materials and promoting the sustainable development of the industry.
[0004] The technical objective of this invention is achieved through the following technical solution: In a first aspect, the present invention provides a *Serratia pluvialis* R72 strain, which is deposited at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, on February 2, 2026, with accession number CCTCC M 2026311, and its classification is named as follows: Serratia plymuthica It belongs to Serratia marcescens.
[0005] Secondly, the present invention provides the aforementioned Serratia pluvialis R72 in antagonizing Fusarium oxysporum (… Fusarium falciforme Applications of Serratia marcescens R72 in the prevention and control of root rot in Atractylodes lancea.
[0006] Finally, the present invention also provides the application of the aforementioned Serratia pluvialis R72 in the preparation of biocontrol agents or agricultural agents for the prevention and control of root rot in Atractylodes lancea, and the corresponding prepared biocontrol agents or agricultural agents.
[0007] The pathogen causing root rot in Atractylodes lancea is a fungus of the genus Fusarium.
[0008] Preferably, the pathogen causing root rot in Atractylodes lancea is Fusarium wilt (Fusarium wilt). Fusarium falciforme ).
[0009] Compared with the prior art, the advantages and beneficial effects of the present invention are: This invention provides a strain of Serratia puchengensis R72 that is effective against Fusarium oxysporum, the main pathogen causing root rot in Atractylodes lancea. Fusarium falciforme It exhibits significant antibacterial effects; in plate confrontation experiments, it showed an 89.3% control effect against Fusarium tumefaciens, the main pathogen causing root rot of Atractylodes lancea; simultaneously, the Serratia pumila R72 strain provided by this invention has strong antagonistic effects against the pathogens of damping-off, sclerotinia rot of rapeseed, Fusarium head blight, gray mold of tomato, Pythium spp. of melons, black shank of rapeseed, rice blast, leaf spot of rice sesame, and Fusarium wilt of tomato, with an inhibition rate of over 88%. The R72 strain significantly inhibits the mycelial growth of Fusarium tumefaciens by causing the mycelial tips to swell and branch more. The experiment also found that the volatile gases of Serratia pluvialis R72 could significantly alter its colony morphology and inhibit spore production. Meanwhile, 20% fermentation filtrate of Serratia pluvialis R72 had no significant effect on its mycelial growth. The inventors detected organic sulfides, heterocyclic compounds, ketones, phenols, and lipids in the volatile gases of Serratia pluvialis R72. Pyrazine and 2-nonanone may be related to antibacterial activity. Attached Figure Description
[0010] To more clearly illustrate the technical solution of the present invention, the applicant will now provide a brief introduction to the drawings used in the description of the embodiments or prior art.
[0011] Figure 1 The above are the strain morphology and phylogenetic tree of the fungi in Example 1; where A: morphology of strain B12, B: morphology of strain 3-C1, C: phylogenetic tree of strain B12, and D: phylogenetic tree of strain 3-C1. Figure 2 The images show the morphology and phylogenetic tree of strain R72 in Example 2, where A: morphology of strain R72; B: morphology of strain R72 under transmission electron microscopy; and C: phylogenetic tree of strain R72. Figure 3The results of the plate experiment of R72 in Example 2 are as follows: A: Plate antagonism of R72 on 3-C1 (a) 3-C1 control, (b) Effect of R72 on 3-C1; B: Plate antagonism of R72 on B12 (a) B12 control, (b) Effect of R72 on B12; C: Scanning electron microscopy observation of the effect of R72 on B12 hyphal morphology (a)(b) B12 control, (c)(d) Effect of R72 on B12 hyphae; D: Effect of R72 fermentation filtrate on B12 (a) B12 control, (b) Effect of 20% R72 fermentation filtrate on B12, (c) B12 control (d) Effect of R72 volatile gases on B12; E: Effect of R72 volatile gases on B12 sporulation. Figure 4 The results of the cultivation of strain R72 in Example 3 in various culture media are shown below. A: (a) colloidal chitosan medium; (b) protease detection medium; (c) cellulase detection medium; B: (a) amylase detection medium; (b) CAS detection medium; (c) phosphate-solubilizing bacteria organic phosphorus solid medium; (d) phosphate-solubilizing bacteria inorganic phosphorus solid medium; (e) Columbia blood agar medium. Figure 5 The antibacterial spectrum of R72 in Example 5; Figure 6 Statistics on the antibacterial rate of R72 in Example 5; Figure 7 To verify the effect of R72 on the prevention and control of root rot of Atractylodes lancea in pot experiment in Example 6, A: disease index of F and F+R72, B: overall condition of potted plants of F and F+R72, C: plant condition of F and F+R72. Detailed Implementation
[0012] The applicant will now provide a clear and complete description of the technical solutions in the embodiments of the present invention with reference to the accompanying drawings, and will give a detailed description of the present invention. These embodiments are only for illustrating the present invention and are not intended to limit the scope of protection claimed by the present invention.
[0013] The culture medium used in the following examples: Standard Potato Dextrose Agar (PDA): 200 g / L peeled potatoes, 20 g / L glucose, 20 g / L agar, diluted to volume with distilled water, autoclaved at 121°C for 30 min. Potato Dextrose Broth (PDB) does not contain agar.
[0014] LB (Luria-Bertani) solid medium: Tryptone 10 g / L, Yeast extract 5 g / L, Sodium chloride (NaCl) 10 g / L, Agar 20 g / L, diluted to volume with distilled water, autoclaved at 121°C for 30 min. LB liquid medium does not contain agar.
[0015] CAS medium: Chromium azurite S (CAS) 60.5 mg / L, hexadecyltrimethylammonium bromide (HDTMA) 72.9 mg / L, ferric chloride hexahydrate 2.645 mg / L, sodium dihydrogen phosphate dihydrate 295.25 mg / L, agar 9000 mg / L, ammonium chloride 125 mg / L, potassium dihydrogen phosphate 37.5 mg / L, sodium chloride 62.5 mg / L, pH 6.8 ± 0.2 (25℃) Organophosphate bacteria culture medium: glucose 10 g / L, ammonium sulfate 0.5 g / L, yeast extract 0.5 g / L, sodium chloride 0.3 g / L, potassium chloride 0.3 g / L, magnesium sulfate 0.3 g / L, ferrous sulfate 0.03 g / L, manganese sulfate 0.03 g / L, lecithin 0.2 g / L, calcium carbonate 1.0 g / L, agar 15.0 g / L.
[0016] Inorganic phosphorus bacteria culture medium: glucose 10.0 g / L, ammonium sulfate 0.5 g / L, yeast extract 0.5 g / L, sodium chloride 0.3 g / L, potassium chloride 0.3 g / L, magnesium sulfate 0.3 g / L, ferrous sulfate 0.03 g / L, manganese sulfate 0.03 g / L, tricalcium phosphate 5.0 g / L, agar 15.0 g / L.
[0017] Cellulose-decomposing bacteria culture medium: ammonium sulfate 2.0 g / L, sodium chloride 6.0 g / L, potassium hydrogen phosphate 0.5 g / L, calcium chloride 0.1 g / L, dipotassium hydrogen phosphate 2 g / L, CMC-Na 15 g / L, magnesium sulfate heptahydrate 0.1 g / L, agar 15 g / L Colloidal chitosan culture medium: Solution A: Weigh 1g of chitosan, add 75mL of 0.4mol / L HCl, grind with a magnetic stirrer until it becomes a colloid, adjust the pH to 5.0 with 2mol / L NaOH, and bring the volume to 100mL; Solution B: 0.4% (w / v) NaNO3, 0.2% (w / v) K2HPO4, 0.1% (w / v) KCl, 0.1% (w / v) MgSO4·7H2O, 0.002% (w / v) FeSO4, 1.5% (w / v) agar; Sterilize solutions A and B separately at 121℃ for 15min, and mix equal volumes before use.
[0018] Example 1: Isolation and Identification of Pathogenic Fungi 1.1 Isolation of the pathogenic fungus: The junction of diseased and healthy tissue was cut from diseased Atractylodes lancea plants. The tissue was disinfected with 75% alcohol for 30 seconds, rinsed three times with sterile water, then disinfected with 2% sodium hypochlorite for 1 minute, and rinsed six times with sterile water. The tissue fragments were crushed, and sterile water was added. The mixture was shaken on a shaker at 28°C and 120 rpm for 30 minutes to obtain the stock solution. The stock solution was diluted to 10... -2 10 -3 Afterwards, absorb 10 -2 10 -3 200 μL of the dilution was spread on a PDA plate containing kanamycin (final concentration 50 μg / mL). After incubation at 28 °C for 5 days, the fungus was isolated by the hyphal tip method. After purification three times, the fungus was stored at 4 °C by the slant method.
[0019] 1.2 Determination of pathogenicity of fungi: The pathogen was re-inoculated using hydroponics. (1) Preparation of spore solution: Three 5 mm fungal cakes were placed in PDB medium and cultured at 20℃ (3-C1) and 28℃ (B12) at 180 rpm for 4 days. After filtering the mycelium, the spore solution was centrifuged at 5000 rpm for 10 minutes, the supernatant was removed, and the solution was resuspended twice in distilled water. The concentration of the spore solution was then adjusted to 1×10⁻⁶. 7 (2) Seedling treatment: Take about 25-day-old Atractylodes lancea seedlings, cut off about 3cm of the tip of the main root, soak the roots in spore solution, culture at 25℃, observe the disease situation of the seedlings every day, count the disease situation, and re-isolate and identify the pathogens.
[0020] 1.3 Identification of Pathogenic Fungi DNA of pathogenic fungi validated by Koch's postulates was extracted using the CTAB method. EF-1H (SEQ ID NO.1) (ATGGGTAAGGAAGACAAGAC) / EF-2T (SEQ ID NO.2) (GGAAGTACCAGTGATCATGTT) and RPB2-5F2 (SEQ ID NO.3) (GGGGWGAYCAGAAGAAGGC) / RPB2-7Cr (SEQ ID NO.4) (CCCATRGCTTGYTTRCCCAT) were used for PCR amplification of strain B12. EF-1H / EF-2T and CYLH3F (SEQ ID NO.5) (AGGTCCACTGGTGGCAAG) / CYLH3R (SEQ ID NO.1) were used for DNA extraction. PCR amplification of strain 3-C1 was performed using primers NO.6 (AGCTGGATGTCCTTGGACTG), and the products were sent to Wuhan Tianyi Huayu Gene Technology Co., Ltd. for sequencing. BLAST alignment was performed using the NCBI database, and sequences with similarity greater than 99% were downloaded for homology analysis. The sequences were then tandemly constructed, and an IQtree phylogenetic tree of the pathogen was built. The PCR reaction system and conditions are shown in Tables 1 and 2.
[0021] Table 1 PCR reaction system
[0022] Table 2 PCR reaction conditions
[0023] Pathogenicity experiments were conducted to screen for pathogenic fungi B12 and 3-C1, which exhibit strong pathogenicity against Atractylodes lancea, proving that strains B12 and 3-C1 are pathogenic fungi with Atractylodes lancea as their host. To determine the taxonomic position of B12 and 3-C1, morphological and molecular biological identification was performed. B12, cultured on PDA plates at 28°C, showed white hyphae. Microscopic observation revealed that the conidia of B12 were sickle-shaped with tapering ends. The morphology of strain B12 was basically consistent with that of Fusarium fungi. A phylogenetic tree was constructed using tandem primers EF-1α (Elongation Factor-1 Alpha) and RPB2 (RNA polymerase II), revealing that B12 and... Fusarium falciforme They clustered in the same branch. These results all indicate that B12 belongs to... Fusarium falciforme Fusarium spp. The 3-C1 strain was found to produce yellow-white hyphae and club-shaped conidia after 15 days of culture on PDA plates at 20°C. A phylogenetic tree was constructed using EF-1α and Histone H3 primers, revealing that 3-C1... With Ilyonectria vredehoekensis Clustering together with high support rates indicates that they are most closely related. For example... Figure 1 As shown, this indicates that 3-C1 fungus belongs to the genus *Cypripedium*. Ilyonectria vredehoekensis ).
[0024] EF-1α gene sequence of B12 strain (SEQ ID NO.7): AGAAGGTTGGTGACATCTCCCCCGATCGCGCCTTGCTATTCCACATCGAATTCCCTCCCTCGCGATACGCTCTGCGCCCGCTTCTCCCGAGTCCCAAAATTTTTGCGGTCCGACCGTAATTTTTTTGGTGGGGCTTTTACCCCGCCACTCGGGCGACGTTGGACAAAGCCCTGATCCCTGCACACAAAAAACACCAAACCCTCTTGGCGCGCATCATCACGTGGTTCACAACAGACGCTAACCGGTCCAACAATAGGAAGCCGCTGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTCCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCCGCTACTATGTCACCGTCATTGGTATGT B12 strain RPB2 gene sequence (SEQ ID NO.8): GCCAAGCCCCGTCAGCTACACAACACCCATTGGGGTCTGGTCTGTCCAGCCGAGACGCCTGAGGGTCAGGCTTGTGGTCTGGTCAAGAACTTGTCCCTGATGTGCTACGTCAGTGTCGGCTCTCCCTCTGAACCTCTGATTGAGTTCATGATCAACCGAGGTATGGAAGTCGTGGAAGAGTACGAGCCCCTGAGATACCCGCATGCTACCAAGATCTTTGTCAATGGTGTCTGGTGCGGTGTTCACTCAGACCCCAAGCATCTCGTCAGCCAGGTTCTGGACACACGACGAAAGTCGTACCTGCAGTATGAGGTGTCGCTTGTTCGTGACATTCGAGATCGAGAGTTCAAGGTCTTCTCCGACGCTGGCCGAGTCATGAGGCCGGTCTTTACGGTCCAGCAGGAGGATGACCACGAGTCTGGTATTGCCAAGGGAGCTTTGGTTCTGACCAAGGACCTTGTCAACAAGCTTGCTAAGGAGCAGGCGGAGCCACCAGAGGACCCATCAATGAAGATTGGATGGGAGGGTCTGATCCGAGCCGGAACCATTGAGTACCTCGATGCTGAGGAAGAGGAGACGGCTATGATTTGCATGACTCCTGAGGATCTTGATCTCTATCGCATGCAAAAGGCTGGTTACGTCGTAGATGACGATAACACGGACGACCCCAACAGGAGATTGAAGACCAAGACGAACCCCACAACTCACATGTACACTCATTGTGAGATTCACCCCAGTATGATTCTTGGCATTTG EF-1α gene sequence of strain 3-C1 (SEQ ID NO.9): TCACCTCAACGTCGTGGTCATCGTAAGTTCACCCCGCATGGATATCTCATCGCGACTGTTGACTGACCTGATTCTCTAGGGGTTCGTACCACTTCTCTCCAAGACGAGTTCTCACCAAGCAGCTTGCTGACACCCTCGACAGCCACGTCGACTCTGGCAAGTCGACCACTGTAAGTTTTCCCGCCGTCTTATCTCGGTTGTCATACCCCGCCATGACCATCGCGGGGTTTCTTATCACAGCCTGCTAACATACATCGACAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCCTCTTTTCCCGATTCTGCCCTCAACGATCGTCGATTTCAACGTCGCTGCGTCTGCCCACGAAACACAACCCCTCATCCTTCGATCAAAAATTTTCACCCACCCTCCATTGTTTTTTGGTGGGGGCGAATTTTACCCCGCCGCACACTGGTGGTTGAAATTTACCCCGCCCCACCACAGCATCATTCAATCATCATCGCGGGACCCTTCACACGCTTTGCACAGAATACTGACAGTGCCCTCTCACAGGAAGCTGCCGAGCTCGGCAAGGGTTCCTTCAAGTATGCCTGGGTTCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATTGCCCTGTGGAAGTTCGAGACTCCCCGCTACTTCGTCACCGTCATTGGTAAGCTGTCACTGCTCTGAGTTTCTTCACTCGTCACATTCTAACTCTCACTCAACAGATGCCCCCGGTCACCGTGACTTCATCAAGA 3-C1 strain Histone H3 gene sequence (SEQ ID NO.10): CCTCCGCAAGCAGCTTGCTTCCAAGGCTGGTGAGTTTTTCTCCGGCGCCGACCTGGCCTGACCGTCCCGTCTTCGACTCGACGCGTCTCGCATCGCGCACACCCGGCATCATCCTCACATACTAACATCACACAGCCCGCAAGAGCGCCCCCTCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCCGGTACCGTCGCTCTC CGTGAGATTCGACGATACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTCCCCTTCCAGCGCCTGGTAAGCATCTCCCACTCACGCCTCGCATCAAGCATCGGCTCTAACGCGCCCAACACAGGTCCGTGAGATCGCCCAGGACTTCAAGAGCGACCTTCGCTTCCAGTCCTCCGCCATCGGCGCCCTCCAGGAGTCCGTCGAGTCCTACCTCG Example 2. Isolation and Identification of Biocontrol Bacteria 2.1 Isolation and purification of biocontrol strain (Serratia pluvialis R72)
[0025] Isolation of biocontrol bacteria: Rhizome of Atractylodes lancea was collected, and the rhizosphere soil was washed off with sterile water. After adding sterile water, the mixture was shaken on a shaker at 28°C and 120 rpm for 30 min to obtain the stock solution. The stock solution was then serially diluted to 10-1. -4 10 -5 Afterwards, absorb 10 -4 10 -5 200 μL of the dilution solution was spread on LB agar plates and incubated at 28°C for 1-2 days. Single colonies were then picked using an inoculation loop for isolation and purification. The obtained single colonies were stored at -80°C. The strain obtained after isolation and screening was tentatively designated as R72.
[0026] 2.2 Screening of biocontrol strains The biocontrol strains isolated and purified above were incubated at 28°C and 120 rpm for 1 day until the logarithmic growth phase (OD200). 600 (0.6-0.8) Take 10 μL of bacterial solution and streak it on a 90 mm PDA plate 2.5 cm from the center on both sides. After incubating upside down for one day, inoculate the pathogen in the center. Use the plate inoculated only with the pathogen as a control. Incubate at 28 °C until the mycelium of the control strain fills the culture dish. Measure the colony diameter using the cross-cross method and calculate the inhibition rate.
[0027] Inhibition rate = (Control strain diameter - (Treatment strain diameter - Mycelial block diameter)) / (Control strain diameter - Mycelial block diameter) Plate confrontation experiments revealed that R72 exhibited significant spatial competition and inhibitory effects on the growth of Fusarium oxysporum B12, significantly inhibiting the mycelial growth of Fusarium oxysporum B12. Some mycelia appeared red, and microscopic observation showed that the tips of Fusarium oxysporum B12 hyphae were deformed and branched more. Through cross-sectional measurements and calculation of the inhibition rate, the inhibition rate of R72 against B12 was 89.3%. Figure 3 As shown in Figure B, a clear and broad inhibition zone formed in front of the R72 colony on day 6 of the confrontation culture. Calculations showed that R72 achieved an average inhibition rate of 89.3% against Fusarium B12, indicating that this biocontrol strain has a strong antagonistic effect on the pathogen Fusarium B12 under in vitro conditions. In a plate confrontation culture between R72 and 3-C1, R72 inhibited the growth of 3-C1, exhibiting a certain antagonistic effect with an inhibition rate of 44.16%. The R72 strain showed a stronger antagonistic effect against the B12 strain.
[0028] 2.3 Identification of biocontrol strains 2.3.1 Morphological identification The above-mentioned strain R72 was activated by streak plating and cultured at 28°C for 48 hours. Single colony morphology was then observed. Simultaneously, the morphology of strain R72 was observed using transmission electron microscopy.
[0029] 2.3.2 Molecular biological identification DNA was extracted from strain R72 using a bacterial DNA extraction kit from Nanjing Novizan Biotechnology Co., Ltd. PCR amplification was performed using primers 27F (SEQ ID NO. 11) (TACGGYTACCTTGTTACGACTT) / 1492R (SEQ ID NO. 12) (AGAGTTTGATCMTGGCTCAG) and gyrBR (SEQ ID NO. 13) (GACAAGCTGGTTTCTTCCGA) / gyrBF (SEQ ID NO. 14) (CATCTCGCCCAGACCTTTGT). PCR amplification conditions are shown in Tables 3 and 4. The PCR products were sent to Tianyi Huiyuan Biotechnology Co., Ltd. for sequencing. Sequences with greater than 99% similarity were downloaded using the BLAST program in the NCBI database for homology analysis. A phylogenetic tree of the biocontrol bacteria was constructed using IQtree with the maximum likelihood method.
[0030] Table 3 PCR reaction system
[0031] Table 4 PCR reaction conditions
[0032] After being cultured at a constant temperature of 28℃ on LB solid medium for 48 hours, strain R72 formed single colonies with regular morphology and distinct characteristics. The colonies were pale white in appearance, with a smooth and moist surface, complete and neat edges, regular circular shape, moderate elevation, and a diameter of about 1-2 mm, exhibiting typical bacterial colony morphology.
[0033] To further clarify its taxonomic position, molecular biological identification was performed on this strain. Total DNA was extracted from the strain using the Nanjing Novizan DNA extraction kit, and fragments of the 16S rRNA gene, which is of important significance in bacterial taxonomy, and the gyrB gene, commonly used for precise species-level identification, were amplified. The obtained sequences were compared with databases such as NCBI, and a phylogenetic tree was constructed using the maximum likelihood method for multiple sequence analysis. Figure 2 As shown, phylogenetic analysis revealed that the 16S rRNA gene sequence of strain R72 is similar to... Serratia plymuthica The corresponding sequences of multiple strains of *Serratia pluvialis* are highly homologous. To further improve the identification resolution, combined analysis with the gyrB gene sequence showed that R72 is similar to the reference strain. Serratia plymuthica 4Rx13 clustered in a single line on the phylogenetic tree with high support. Calculations showed that R72 shared 99% comprehensive sequence similarity with this type strain. This result strongly suggests that strain R72 taxonomically belongs to [the type strain]. Serratia plymuthica *Serratia pluvialis*, a strain of this species, is known to be widely distributed in soil and plant rhizosphere environments. Some strains have been reported to possess biocontrol potential, including antagonistic effects against plant pathogens and promotion of plant growth. This aligns closely with the goal of this study to screen for biocontrol strains. *Serratia pluvialis* R72 is deposited at the China Center for Type Culture Collection (CCTCCM), Wuhan University, Wuhan, China, on February 2, 2026, with accession number CCTCM 2026311. Its taxonomic name is... Serratia plymuthica.
[0034] The gyrB gene sequence of strain R72 (SEQ ID NO).16):TGGATCTGGCCGGCCTGCCGGGCAAACTGGCGGACTGCCAGGAACGCGATCCGGCGTTGTCCGAACTCTACCTGGTGGAAGGGGACTCTGCGGGCGGCTCTGCCAAGCAGGGGCGTAACCGTAAGAACCAGGCGATTCTGCCGCTGAAAGGTAAAATCCTCAACGTCGAGAAGGCGCGCTTCGACAAGATGCTGTCTTCGCAGGAAGTGGCGACGCTGATCACCGCGCTGGGTTGCGGCATCGGCCGTGACGAGTACAACCCGGACAAGCTGCGTTACCACAGCATCATCATCATGACCGATGCCGACGTCGACGGTTCGCACATCCGTACGCTGCTGTTGACCTTCTTCTACCGCCAGATGCTGGAAATCATTGAACGCGGCCACGTGTTCATTGCCCAGCCGCCGCTGTACAAGGTGAAAAAAGGCAAGCAGGAACAGTACATCAAAGATGACGAGGCGATGGATCAGTATCAGATCGCCATCGCGATGGACGGCGCAACCCTGCACACCAATGCCAACGCGCCGGCGCTTGCCGGCGAACCACTGGAAAAACTGGTGGCCGAGCACTACAGCGTGCAGAAGCTGATCGGTCGTATGGAACGCCGCTACCCGCGCGCGCTGCTGAACAACCTGATCTACCAGCCAACCCTGAATGAAAGCGATCTGAGCGATCAGGGCAAAGTGCAGGTATGGATTGAGTCGCTGGTGAAACTGCTGAACGATAATGAGCAGCATGGCAGCAGCTATGACTCGGTGATCTTCGAGAACCGCGAACGCCAGATGTTTGAGCCGGTGCTGCGCATCCGTACCCACGGCGTGGATACCGACTACCCGCTGGACTTCGAGTTCTTCCACGGCGGCGAATATCGCAAAATCTGTCAGCTGGGCGAAAAACTGCGTGGCCTGATCGAAGAAGATGCCTTCATCGAACGTGGCGAACGCCGTCAGCCGGTAGACAGCTTCGAGCAAGCGCTGGAGTGGC. Example 3. Effect of biocontrol strain R72 on Fusarium oxysporum B12 isolated in Example 1 3.1 Effects of strain R72 on the mycelium of the pathogen Strain R72 was incubated at 28°C and 120 rpm for 1 day until the logarithmic growth phase (OD200). 600 (0.6-0.8), take 10 μL of bacterial suspension and streak 2.5 cm on both sides of the center position in a 90 mm PDA plate covered with cellophane. After incubating upside down for one day, inoculate the pathogen Fusarium B12 extracted in Example 1 in the center position. Use the plate inoculated only with the pathogen as a control. Incubate at 28℃ for 3-4 days. Cut 5 mm × 5 mm cellophane from the tip of the hyphae and place it in 2% glutaraldehyde fixative to prepare the sample. Observe the difference between normal hyphae and pathogen hyphae affected by R72 using a biological scanning electron microscope.
[0035] 3.2 Effects of fermentation filtrate of strain R72 on pathogens Seed culture of strain R72 was obtained after two days of shaking culture. The seed culture was added at 1% to a 250mL Erlenmeyer flask containing 200mL LB medium. After shaking culture for 2 days, 50mL of bacterial culture was taken into a 100mL centrifuge tube and centrifuged at 5000rpm for 10 minutes. The culture was then filtered twice through a 0.2μm bacterial filter to obtain sterile filtrate. The sterile filtrate was mixed with solid PDA medium cooled to about 50℃ at a ratio of 20% (v / v). Plates with only PDA medium were used as controls. Triple replicates were set up and cultured for 7 days to observe the diameter of the strain and calculate the inhibition rate.
[0036] Inhibition rate = (Control strain diameter - (Treatment strain diameter - Mycelial block diameter)) / (Control strain diameter - Mycelial block diameter) 3.3 Effects of volatile substances from strain R72 on the pathogen. Seed culture of strain R72 was obtained after two days of shaking culture. 1% of the seed culture was added to a 250mL Erlenmeyer flask containing 200mL LB broth. After two days of shaking culture, 100μL of the R72 culture was spread onto a 90mm LB agar plate and allowed to dry. Simultaneously, pathogenic bacterial pellets were inoculated onto a PDA plate. The two petri dishes were sealed with their mouths together, and the PDA plate was placed on top for incubation. A blank LB plate without R72 culture and a PDA plate inoculated with pathogenic bacteria were used as controls. The plates were incubated at 28℃, and the growth of the strain was observed. The inhibition rate was determined when the diameter of the pathogenic bacteria in the control plate nearly filled the PDA plate.
[0037] Inhibition rate = (Control strain diameter - (Treatment strain diameter - Mycelial block diameter)) / (Control strain diameter - Mycelial block diameter) 3.4 Determination of volatile substances in strain R72 Seed culture of strain R72 (2%) was added to 30 mL of LB medium in a 50 mL headspace vial. After incubation at 28 °C and 120 rpm for 2 days, the sample was heated to 50 °C and extracted by headspace microextraction for 30 min. The sample was then injected splitlessly at 200 °C with a solvent delay of 2 min using a CTC autosampler. The initial column temperature was 35 °C, increased to 280 °C at a rate of 10 °C / min, and held at 280 °C for 15 min. Helium was used as the carrier gas at a flow rate of 1.1 mL / min. Mass spectrometry was performed in (70 eV, total ion count, 40–280 m / z) scan mode.
[0038] like Figure 3 As shown, to study the antagonistic effect of R72 on pathogenic fungi, a plate confrontation test was conducted between R72 and B12. The results showed that R72 had a strong antagonistic effect on B12, significantly inhibiting its growth. The diameter of the control strain was 74.75±0.58 mm, while the diameter of the strain affected by R72 was 8.00±0.89 mm, with an inhibition efficiency of 89.3%. To further explore the antibacterial mechanism of R72 against Fusarium B12, the main pathogenic fungus of Atractylodes lancea, scanning electron microscopy was used to observe the effect of R72 on B12 hyphal growth. The results showed that R72 significantly inhibited B12 hyphal growth, causing swelling of the hyphal tips and increased branching. To clarify the antibacterial activity of R72, strain B12 was treated with R72 fermentation filtrate and volatile gas, respectively. It was found that 20% R72 fermentation filtrate had no significant effect on B12 mycelial growth, but R72 volatile gas significantly altered B12 colony morphology and inhibited spore production. To determine the substances in R72 volatile gas that produce antibacterial activity, GC-MS was used to qualitatively determine the composition of the volatile gas. Organic sulfides, heterocyclic compounds, ketones, phenols, and lipids were detected. Existing research indicates that pyrazine and 2-nonanone are associated with antibacterial activity. As shown in Table 5, the results indicate that pyrazine and 2-nonanone are potential substances responsible for the antibacterial effect of strain R72.
[0039] Table 5. Top 20 substances by GCMS peak area percentage
[0040] Example 4. Characteristic Study of Biocontrol Strains 4.1 Study on the disease control characteristics of biocontrol strains: 5 μL of bacterial suspension was inoculated into colloidal chitosan medium, protease detection medium, cellulase detection medium and amylase detection medium by spot inoculation method, with 3 replicates for each strain. After drying the bacterial suspension, the strains were incubated upside down at 28℃ and the growth of the strains was observed after 48 hours.
[0041] 4.2 Study on the growth-promoting characteristics of biocontrol strains: 5 μL of bacterial suspension was inoculated into solid medium for ferrophilic detection, solid medium for phosphate-solubilizing bacteria with organic phosphorus, and solid medium for phosphate-solubilizing bacteria with inorganic phosphorus using the spot inoculation method. Each strain was in triplicate. After drying the bacterial suspension, the strains were incubated upside down at 28℃. The growth of the strains was observed after 7-10 days.
[0042] 4.3 Other characteristics of the biocontrol strain were studied. The strain was inoculated on Columbia blood agar medium using the streak method, with Escherichia coli JM108 as the control strain. The strain was incubated upside down at 28°C for 48 hours to observe whether the strain produced a clear zone.
[0043] To better explore the biocontrol characteristics of strain R72, various culture media were used to study its characteristics. Disease control-related characteristics studies revealed that R72 has a strong ability to produce proteases, but lacks the ability to produce chitinase and cellulase. Growth-promoting characteristics studies showed that R72 has the ability to utilize siderophores, has a weak ability to dissolve inorganic and organic phosphorus, and lacks the ability to produce amylase. Existing research indicates that some... Serratia sp. bacteria are pathogenic bacteria in humans; therefore, Columbia blood agar plates were chosen to initially verify whether R72 has hemolytic ability. R72 was inoculated into Columbia blood agar plates and incubated at 28°C for 48 hours. Figure 4 As shown, no hemolytic zone was observed, indicating that R72 does not have hemolytic ability, which preliminarily proves that R72 is harmless to the human body.
[0044] Example 5. R72 Antibacterial Spectrum The R72 strain was incubated at 28°C and 120 rpm for 1 day until the logarithmic growth phase (OD200) was reached. 600 (Range range: 0.6-0.8) 10 μL of bacterial suspension was inoculated onto a 90 mm PDA plate, streaked 2.5 cm to either side of the center. After incubating upside down at 28°C for one day, the plate was then inoculated with the following pathogens in the center. Plates inoculated only with pathogens served as controls. The plates were incubated at 28°C for 3-7 days. After a significant difference was observed between the control and treatment plates, the diameter of the bacterial strains was measured, and the inhibition rate was calculated. The tested pathogenic fungi (all preserved long-term by the National Key Laboratory of Agricultural Microbial Resources Discovery and Utilization, Huazhong Agricultural University) are shown in the table below. The corresponding pathogens are those for damping-off, rapeseed sclerotinia stem rot, Fusarium head blight, tomato gray mold, pyrophyllosis of melons and fruits, rapeseed black shank, rice blast, rice leaf spot, and tomato wilt.
[0045] Inhibition rate = (Control strain diameter - (Treatment strain diameter - Mycelial block diameter)) / (Control strain diameter - Mycelial block diameter) Table 6 Pathogenic Fungi
[0046] Through a flat plate confrontation experiment, such as Figure 5As shown, strain R72 exhibited strong antagonistic effects against the pathogens of damping-off, sclerotinia stem rot in rapeseed, Fusarium head blight, gray mold in tomato, pyrophyllosis in melons and fruits, black shank in rapeseed, rice blast, rice leaf spot, and Fusarium wilt in tomato, with an inhibition rate exceeding 88%. Specific statistical results are shown below. Figure 6 As shown. For the various pathogenic fungi mentioned above, the OD at inoculation of strain R72 is... 600 The range is 0.6-0.8.
[0047] Table 7 Antibacterial spectrum
[0048] Example 6. Pot Experiment To verify the control effect of biocontrol strain R72, a pot experiment was conducted, with two treatment groups: (F) the group inoculated only with the pathogen and (F+R72) the group treated with a combination of pathogen and biocontrol strain R72. Given that using a single Fusarium inoculation could result in unstable or mild disease progression and insignificant differences between the treatment and control, a mixed inoculation method was chosen for the pot experiment, resulting in more severe disease progression and significant differences between the treatment and control. In this example, multiple Fusarium pathogens, including the highly pathogenic Fusarium strain B12, isolated from Atractylodes lancea root rot plants and confirmed to be pathogenic through preliminary experiments as described in Example 1, were used as a composite inoculum. This composite inoculum was inoculated into sterilized wheat grains and cultured at 28°C until the Fusarium mycelium in the composite inoculum completely covered the wheat grains, producing Fusarium-infected wheat grains. These grains were then mixed with sterilized nutrient soil at a ratio of 1:2.5 to obtain pathogen-containing soil. Untreated healthy Atractylodes lancea seedlings (approximately 20 days old) and Atractylodes lancea seedlings (approximately 20 days old) were treated with OD... 600 After soaking the roots in a 0.5% R72 bacterial solution for 4 days, the plants were transplanted into the above-mentioned soil containing pathogens, namely the (F) treatment and (F+R72) treatment. After culturing at 28℃ and maintaining humidity for 7 days, the disease incidence of the plants was investigated and the disease index was calculated.
[0049] The pot experiment results showed that the disease index of treatment (F) was 79.17, and the disease index of treatment (F+R72) was 52.08. Figure 7 As shown, inoculation with R72 can significantly reduce the disease index of root rot in Atractylodes lancea, with a relative control effect of 34%, indicating that R72 has a certain control effect on root rot in Atractylodes lancea.
[0050] Prevention efficacy calculation: Relative prevention and control effect (%) = (Control disease index - Treatment disease index) / Control disease index × 100%.
[0051] Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.
[0052] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any transformations or substitutions that can be understood by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of the present invention.
Claims
1. A strain of Serratia procyonii R72, characterized in that, The *Serratia procyonii* R72 strain is deposited at the China Center for Type Culture Collection (CCTCC) on February 2, 2026, with accession number CCTCC M 2026311, and its classification is as follows: Serratia plymuthica .
2. The *Serratia marcescens* R72 according to claim 1 in antagonizing *Fusarium* (… Fusarium falciforme Applications in ).
3. The application of Serratia pluvialis R72 as described in claim 1 in the prevention and control of root rot.
4. The application of Serratia pluvialis R72 as described in claim 1 in the prevention and control of root rot in Atractylodes lancea.
5. The application as described in claim 4, characterized in that, The pathogen causing root rot in Atractylodes lancea is a fungus of the genus Fusarium.
6. The application as described in claim 4 or 5, characterized in that, The pathogen causing root rot in Atractylodes lancea is Fusarium (Fusarium oxysporum). Fusarium falciforme ).
7. The application of Serratia pluvialis R72 according to claim 1 in the preparation of biocontrol agents or agricultural agents.
8. The application of Serratia pluvialis R72 according to claim 1 in the preparation of a biocontrol agent or agricultural agent for controlling root rot of Atractylodes lancea.
9. A biocontrol agent or agricultural agent obtained based on the application described in claim 7 or 8.
10. The application of the biocontrol agent or agricultural agent as described in claim 9 in the prevention and control of root rot in Atractylodes lancea.