Strain for preventing and treating finger disease of bergamot and application thereof
By using Bacillus subtilis B702 as a microbial agent, the environmental pollution and drug resistance problems caused by the control methods of citronella dry finger disease were solved, achieving efficient and safe biological control and providing a new resource for biological pesticides.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-29
- Publication Date
- 2026-05-29
AI Technical Summary
Existing methods for controlling citron sclerosis are prone to leaving residues that pollute the environment, and the use of chemical pesticides leads to pathogen resistance and environmental pollution.
Bacillus subtilis B702 was used as a microbial agent to control citron rot by soil drenching, foliar spraying, or fruit dipping. The formulations included liquid inoculants, wettable powders, or granules.
It effectively and specifically inhibits Alternaria alternata, the pathogen causing citrus dandruff, with an inhibition rate of over 92%. It is safe, environmentally friendly, and does not pollute the environment, meeting the requirements of green production and providing a new resource for biological pesticides.
Smart Images

Figure CN122104539A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of agricultural biotechnology, specifically relating to a strain of bacteria used to prevent and treat citronella rot and its application. Background Technology
[0002] Buddha's Hand ( Citrus medica L. var. Sarcodactylis Citrus sempervirens (Citrus sempervirens) is a plant belonging to the Rutaceae family and the Citrus genus. Its fruit has high medicinal and ornamental value. In recent years, Citrus sempervirens disease has seriously damaged the Citrus sempervirens industry. This disease causes the fingertips of the fruit to dry out and shrink, severely affecting the quality and yield of the fruit.
[0003] Alternaria ( Alternaria alternata This fungus is the main pathogen causing dry finger disease in Buddha's Hand. On PDA medium, the colony center is dark green with a white edge, and the texture is felt-like. After 7 days of growth, the colony diameter reaches 74-82 mm. The conidia are elliptical, oval, or obclavate, with 1-5 transverse septa and 0-4 longitudinal septa, and the spore size is approximately 15-70 μm.
[0004] Currently, the control of bergamot dry finger disease mainly relies on chemical pesticides. However, long-term use of chemical pesticides can lead to problems such as pathogen resistance, environmental pollution, and pesticide residues. Biological control, as an environmentally friendly alternative, is receiving increasing attention. Bacillus species, due to their ability to produce highly resistant spores and their ease of production and preservation, show great promise for application in biological control. However, no reports have been published on the screening of biocontrol strains for bergamot dry finger disease and related research. Summary of the Invention
[0005] This invention provides a strain for the prevention and control of citron dermatitis and its application, aiming to solve the technical problem that existing methods for the prevention and control of citron dermatitis are prone to leaving residues and polluting the environment.
[0006] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides a Bacillus subtilis strain that inhibits the pathogenic fungus causing bergamot rot. Bacillus subtilis B702, the strain described is classified as Bacillus subtilis strain. Bacillus subtilis B702 was deposited at the China Center for Type Culture Collection on November 10, 2025, at No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, with accession number CCTCC NO: M 20252497.
[0007] Secondly, the present invention provides the Bacillus subtilis strain described in the first aspect. Bacillus subtilis Application of B702 in the prevention and control of plant diseases caused by Alternaria.
[0008] In a preferred embodiment, the plant disease is citron leaf spot.
[0009] Thirdly, the present invention provides a microbial preparation for preventing and treating citronella rotundifolia, comprising the Bacillus subtilis strain described in the first aspect. Bacillus subtilis B702.
[0010] In a preferred embodiment, the microbial preparation is a liquid inoculant, a wettable powder, or granules.
[0011] Fourthly, the present invention provides a method for preventing and treating dry finger disease in Buddha's Hand, comprising applying the microbial preparation described in the third aspect to Buddha's Hand plants or the Buddha's Hand growing environment.
[0012] The preferred method is to apply the solution by one or more of the following: soil irrigation, foliar spraying, or fruit dipping.
[0013] Compared with the prior art, the present invention has the following significant advantages: 1. High efficiency and specificity: This invention provides a Bacillus subtilis strain with high antagonistic activity against Alternaria alternata, the pathogen causing citrus dandruff. Bacillus subtilis B702 exhibits significant antibacterial effects on plates, with an inhibition rate exceeding 92%, demonstrating enormous potential for biocontrol.
[0014] 2. Safe and environmentally friendly: The strains are naturally occurring beneficial bacteria in the plant rhizosphere, which are safe for humans and animals, do not pollute the environment, meet the requirements of green agricultural production and organic agriculture, and can effectively reduce the use of chemical pesticides.
[0015] 3. Reliable source: The strain was isolated from the rhizosphere soil of healthy Buddha's Hand plants. It has good environmental compatibility, is easy to colonize and play a role in the Buddha's Hand cultivation system, and has good application prospects.
[0016] 4. Providing new resources for the development of biopesticides: Bacillus subtilis strains Bacillus subtilis B702 can be used as an active ingredient to develop novel and highly efficient microbial biopesticides, providing a new solution and technical support for the prevention and control of plant diseases caused by Alternaria alternata and other plant diseases. Attached Figure Description
[0017] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation of the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.
[0018] Figure 1 This is a colony morphology diagram of the purified pathogens used in the experiments of this invention.
[0019] Figure 2 This is a graph showing the pathogenicity test results of the pathogen inoculated on Buddha's Hand in the experiment of this invention.
[0020] Figure 3 This is a morphological diagram of the pathogen.
[0021] Figure 4 This is an electrophoretic gel imaging result of PCR amplification of rDNA-ITS and ATPase according to the present invention.
[0022] Figure 5 This is a phylogenetic tree of NJ constructed based on Plasma membrane ATPase sequences.
[0023] Figure 6 The initial screening results of antagonistic strains against dry finger disease in the experiment of this invention are shown in the figure.
[0024] Figure 7 This is a diagram showing the results of a secondary screening test for antagonistic strains of Dry Fingers in this invention.
[0025] Figure 8 This is a comparison diagram of the blank control and the dry finger disease antagonistic strain B702 in the experiment of this invention. Detailed Implementation
[0026] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the protection scope of the present invention.
[0027] Example 1: This embodiment provides a Bacillus subtilis strain that inhibits the pathogen causing citrus dandruff. The strain is classified as Bacillus subtilis strain B702 and was deposited at the China Center for Type Culture Collection (CCTCC) on November 10, 2025. The deposit address is No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the accession number is CCTCC NO: M 20252497.
[0028] The Bacillus subtilis strain B702 was isolated and screened from the rhizosphere soil of healthy bergamot trees. Its 16S rRNA gene sequence showed over 99% similarity to the known standard sequence of Bacillus subtilis. This strain exhibited strong inhibitory activity against Alternaria alternata, the pathogen causing bergamot rot, with plate confrontation tests showing an inhibition rate exceeding 92%.
[0029] Example 2: This embodiment provides the Bacillus subtilis strain described in Embodiment 1. Bacillus subtilis Application of B702 in the prevention and control of plant diseases caused by Alternaria.
[0030] The plant disease mentioned is Buddha's Hand Dry Finger Disease.
[0031] Example 3: This embodiment provides a microbial preparation for preventing and treating dry finger disease of Buddha's Hand, including the Bacillus subtilis strain described in Example 1. Bacillus subtilis B702.
[0032] The microbial preparation is a liquid inoculant, a wettable powder, or granules.
[0033] Specifically, the microbial preparation contains the Bacillus subtilis strain as described above. Bacillus subtilis B702 strain and agriculturally acceptable carriers. The inoculum can be in the form of liquid, wettable powder, or granules, etc., including the Bacillus subtilis strain. Bacillus subtilis B702 has an effective viable bacteria count of not less than 1×10⁻⁶. 8 CFU / mL or CFU / g.
[0034] Example 4: This embodiment provides a method for preventing and treating dry finger disease in Buddha's Hand, which includes applying the microbial preparation described in Example 3 to Buddha's Hand plants or the Buddha's Hand growing environment.
[0035] The application methods include one or more of soil irrigation, foliar spraying, or fruit dipping.
[0036] 1. Isolation and identification of pathogens causing citrus dandruff 1.1 Isolation of pathogens Collect Buddha's Hand fruits exhibiting typical dry finger symptoms mailed from the Jinhua Academy of Agricultural Sciences. After washing the surface of the diseased fruits with sterile water, cut 0.5 cm × 0.5 cm tissue blocks from the boundary between diseased and healthy tissue. In a clean bench, disinfect the tissue blocks by immersing them sequentially in 1% sodium hypochlorite solution for 1 min, then in 75% ethanol for 35 s, and finally washing them 2-3 times with sterile water for 30 s each time. After blotting off the surface moisture with sterile filter paper, evenly place the tissue blocks onto PDA solid culture medium plates and incubate at 28℃ for 5-7 days, observing mycelial growth.
[0037] The PDA culture medium is prepared as follows: Take 200 g of peeled potatoes, cut them into pieces, boil for 30 min, and filter through gauze to obtain the filtrate. Add 20 g of glucose and 15 g of agar to the filtrate, and bring the volume to 1 L with distilled water. Autoclave at 121°C for 20 min.
[0038] 1.2 Purification of pathogens See Figure 1 After mycelia grow around the tissue block, use sterile forceps to pick up the tips of the mycelia and transfer them to a fresh PDA plate containing ampicillin (100 μg / mL) and kanamycin (50 μg / mL) for purification. Incubate at 28°C for 5-7 days to obtain a pure culture.
[0039] 1.3 Pathogenicity assay The purified strain was cultured on a PDA plate at 28°C for 14 days. Spores were washed with 5 mL of sterile water, scraped off with a glass slide, and filtered through four layers of sterile gauze to prepare a spore suspension (concentration approximately 1×10⁻⁶). 6 (spores / mL). Using a sterile syringe, the spore suspension was injected into the fingertips of healthy Buddha's Hand citron plants, with an equal volume of sterile water used as a control. The inoculated Buddha's Hand citrons were placed in a humidified incubator at 25°C with alternating light and dark conditions (12h / 12h) for 5-7 days to observe disease development. After leaf disease, the pathogen was isolated again from the lesions and tested to determine if it was the same as the inoculated strain. The experiment was repeated three times.
[0040] See Figure 2 The results showed that the Buddha's Hand citron inoculated with the pathogen exhibited the same dry finger symptoms as those in naturally occurring cases (see attached). Figure 1 B in the middle, appendix Figure 1 C and appendix Figure 1 (D in the middle), while the control group was asymptomatic (attached) Figure 1 (A) The pathogen was isolated again from the site of infection and identified morphologically as being consistent with the inoculated strain.
[0041] 1.4 Identification of Pathogens Morphological identification: A small amount of purified hyphae was picked up and placed on a glass slide, about 10 μL of sterile water was added, and a coverslip was placed on top. The morphology of the hyphae and conidia was observed under a microscope. If a sufficient number of conidia are required, morphological identification can be performed after the conidial stage, using the same method.
[0042] See Figure 3 , strain Bacillus subtilis After incubation at 30°C for 24 hours on LB agar plates, B702 colonies were dark green in the center, milky white at the edge, felt-like, opaque, with a rough surface and irregular, rod-shaped margins. The colony diameter was 74-82 mm, and they were Gram-positive. Microscopic observation revealed conidia that were elliptical, oval, or obclavate, with 1-5 transverse septa and 0-4 longitudinal septa, and a spore size of 15-70 μm. These characteristics are similar to those of *Alternaria* (…). Alternaria alternata It matches the typical form of ).
[0043] Molecular biological identification: A small amount of purified hyphae was picked up in a clean bench and added to sterilized PDB medium. It was usually dispensed into 50ml centrifuge tubes, labeled, and placed in a constant temperature shaker at 28℃ and 180 rpm for 24-48h. After a large number of hyphae grew in the PDB, the hyphae were filtered, placed in a mortar, ground, and DNA extracted. After DNA extraction, PCR reaction was performed.
[0044] The PCR reaction system consisted of 50 μL of each medium, including 1 μL each of the upstream primer (10 μmol / L) and the downstream primer (10 μmol / L), 2 μL of template DNA, 25 μL of 2×Taq PCR Master Mix (Norway Zan), and 21 μL of double-distilled water.
[0045] Two genes, rDNA-ITS and ATPase, were amplified by PCR. The corresponding primers and reaction procedures for the two genes are shown in Table 1.
[0046] Table 1 PCR amplification Gene Primer names and sequences (5'-3') Pre-variation transsexual annealing extend Final extension rDNA-ITS ITS1:TCCGTAGGTGAACCTGCGCITS4:TCCTCCGCTTATTGATATGC 94°C for 5 minutes 94°C for 30 seconds 50℃30s 72℃30s 72℃ for 5 minutes ATPase ATPDF1:ATCGTCTCCATGACCGAGTTCGATPDR1:TCCGATGGAGTTCATGATAGCC 94°C for 4 minutes 94°C for 30 seconds 59℃30s 72℃ for 1 minute 72℃ for 5 minutes PCR products were sent to Changsha Youkang Biotechnology Co., Ltd. for sequencing. The sequences obtained from the tested strains were placed in GenBank for BLAST alignment. Sequences of three species, A. alternata, A. tenuissima, and A. longipes, as well as the megasporophytes A. alternantherae, A. porri, A. sonchi, and A. brassicicola, and the standard strain A. infectoria as an out-of-group control were downloaded from GenBank. The sequence alignment results were used to construct a phylogenetic tree in MEGA 7.0 using the Neighbor Joining (NJ) method (self-tested 1000 times).
[0047] See Figure 5 Genomic DNA was extracted from the pathogen, and the rDNA-ITS region and ATPase gene were amplified using primers ITS1 / ITS4 and ATPase F1 / R1, respectively. The Plasma membrane ATPase sequences obtained from the sequencing of eight strains were compared with similar sequences in GenBank. The results showed that the Plasma membrane ATPase sequences of all eight Alternaria strains had a similarity of over 99% to the *A. alternata* sequences registered in GenBank. Phylogenetic results showed that ( Figure 4Eight strains identified morphologically as A. alternata clustered in one branch with the standard strain A. alternata (EGS34-016), with a confidence level of 59%. The results of molecular identification and morphological identification were consistent. In summary, it can be determined that the pathogen of bergamot dry finger disease is Alternaria alternata.
[0048] 2. Screening of antagonistic bacteria 2.1 Isolation and purification of bacteria Rhizosphere soil was collected from healthy Buddha's Hand plants mailed from Jinhua Academy of Agricultural Sciences, placed in sterile sample bags, and stored at 4°C in the laboratory. 10g of soil sample was weighed and added to an Erlenmeyer flask containing 90mL of sterile water and glass beads, and shaken for 30min to prepare a soil suspension. This suspension was then serially diluted 10-fold to 10⁻⁶. -6 Spread 0.1 mL of each dilution of the suspension onto LB agar plates and incubate at 30°C for 24 h. Based on differences in colony morphology, color, and edge, select single colonies for streak purification, obtaining several pure bacterial strains, which are then numbered for later use.
[0049] 2.2 Initial screening of antagonistic bacteria The plate confrontation method was used. Activated Alternaria alternata bacterial cakes (6 mm in diameter) were inoculated in the center of a PDA plate. The bacterial strains to be screened were then spotted at four symmetrical positions 25 mm from the center of the plate. Plates without bacterial inoculation served as a control. After incubation at 28°C for 7 days, the inhibition zone was measured and observed when the control group colonies completely covered the plate.
[0050] See Figure 6 After culturing in a 28℃ incubator for 7 days, the control group and the fully grown culture dish were compared. At this point, 20 bacterial strains with significant inhibitory effects on pathogens were obtained in the initial screening, including B1, B2, B3, etc.
[0051] 2.3 Secondary screening of antagonistic bacteria For strains that were initially effective, a second screening was performed. The method was the same as the initial screening, but three strains were symmetrically inoculated at a distance of 25 mm from the pathogen cake.
[0052] See Figures 7-8 The results confirmed that the initial screening was reliable, and the strains included... Bacillus subtilis B702 exhibited the most stable and significant antibacterial effect, with a clear inhibition zone; therefore, B702 was selected for further identification.
[0053] 3. Bacillus subtilis strain Bacillus subtilis Identification of B702 3.1 DNA extraction and PCR amplification strain Bacillus subtilisB702 cells were cultured in LB broth at 37°C with shaking until the logarithmic growth phase, and then collected by centrifugation. PCR reaction mixtures were prepared aseptically in 50 μL volumes. The mixture included 1 μL each of upstream primer (27F) (10 μmol / L) and downstream primer (1492R) (10 μmol / L), 2 μL of template DNA, 25 μL of 2×Taq PCR Master Mix (Norway Zan), and 21 μL of double-distilled water.
[0054] Place the prepared PCR reaction tubes into the PCR instrument and set the following PCR amplification program: Pre-denaturation: 94℃, 5 min Loop (30-35 loops): Denaturation: 94℃, 45S Annealing: 55℃, 45s Extension: 72℃, 90s Final extension: 72℃, 10min Termination: 4℃, ∞ Take 5-8 μL of PCR product and perform electrophoresis on a 1.0% agarose gel. After electrophoresis, observe the results under a gel imaging system. Successful amplification is indicated by a clear, bright single band at approximately 1500 bp. Send the remaining PCR product to Youkang Biotechnology Sequencing Company for sequencing. Upon receiving the sequencing results, perform alignment analysis using NCBI BLAST (Basic Local Alignment Search Tool). Select the sequence with the highest percentage identity and lowest E-value as the identification result. Generally, when the similarity reaches 99% or higher, species-level identification can be considered.
[0055] 3.2 Sequence Analysis and Identification Referring to Table 2, the results show that the strain Bacillus subtilis The 16S rRNA gene sequence of B702 is similar to... Bacillus subtilis The type strain of *Bacillus subtilis* showed a sequence similarity of 99.66%. Therefore, the strain... Bacillus subtilis B702 was identified as Bacillus subtilis ( Bacillus subtilis ).
[0056] Table 2 Sequence Analysis and Identification Scientific name MaxScore (Maximum Score) TotalScore QuenyCover query coverage Evalue Per.ident Each identification ACC.len accuracy length Accession ID Bacillus subtilis 1587 1587 99% 0.0 99.66% 1450 JN366795.1 4. Antagonistic strains Bacillus subtilis Quantitative determination of the antibacterial effect of B702 After culturing for 7 days using the plate confrontation method, the radius of the pathogenic colony was measured.
[0057] The formula for calculating the inhibition rate is: Inhibition rate (%) = [(Coronary radius of control group - Colony radius of treatment group) / Colony radius of control group] × 100% Table 3 Antagonistic strains Bacillus subtilis B702's antibacterial effect Experiment repeat Control group colony radius (mm) Colony radius (mm) of the treatment group Antibacterial rate calculation process Antibacterial rate (%) Repeat 1 40.0 3.0 (40.0-3.0) / 40.0 × 100% 92.5% Repeat 2 42.5 3.2 (42.5-3.2) / 42.5 × 100% 92.5% Repeat 3 41.0 3.1 (41.0-3.1) / 41.0 × 100% 92.4%
[0058] The plate confrontation test results showed that biocontrol agent B702 significantly inhibited the mycelial growth of the pathogen. The average colony radius of the pathogen in the control group was 41.17±1.26 mm, while the colony radius of the B702-inoculated group was only 3.10±0.10 mm. A two-tailed heteroscedastic t-test analysis showed a highly significant difference between the treatment group and the control group (t=52.23, p<0.001). The calculated inhibition rate was 92.47±0.06%.
[0059] After three independent replicate tests, the *Bacillus subtilis* strain was determined to be... Bacillus subtilis B702 showed inhibition rates of 92.5%, 92.5%, and 92.4% against Alternaria alternata, the pathogen causing citrus dander disease, with an average inhibition rate of 92.47% and a standard deviation of ±0.06%. These results indicate that the strain... Bacillus subtilis B702 has an extremely strong and stable inhibitory effect on the growth of pathogens, and its antibacterial ability is outstanding.
[0060] 5. Summary This invention successfully isolated the pathogenic strain from typical diseased fruits using a tissue isolation method. Combined with microscopic observation of colony morphology and spore characteristics, as well as molecular phylogenetic analysis of rDNA-ITS and ATPase genes, the pathogen was definitively identified as *Alternaria*. Alternaria alternata This laid an accurate target foundation for subsequent targeted screening of biocontrol bacteria. Using the identified *Alternaria* species as the target, primary and secondary screening were conducted from the rhizosphere soil microbial community of healthy *Citrus medica* var. *citri* plants using the plate confrontation method. A strain with extremely significant antibacterial effect was successfully obtained. Bacillus subtilis B702. Based on 16S rRNA gene sequence analysis, this strain was identified as Bacillus subtilis (B. subtilis). Bacillus subtilis The effectiveness of the Bacillus subtilis strain was verified through plate confrontation experiments. Bacillus subtilis The biocontrol potential of B702. Repeated experimental data show that this strain has an average inhibition rate of over 92.5% against Alternaria alternata, the pathogen of bergamot rot, and the results are stable and reliable, fully demonstrating its great application potential as a biocontrol agent.
[0061] This invention is not limited to the above-described optional embodiments. Anyone can derive other various forms of products under the guidance of this invention. However, regardless of any changes made in their shape or structure, any technical solution that falls within the scope of the claims of this invention shall be protected by this invention.
Claims
1. A strain of bacteria used to control citronella sclerosis, characterized in that: The strain is classified as follows: Bacillus subtilis B702 was deposited at the China Center for Type Culture Collection on November 10, 2025, at No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, with accession number CCTCC NO: M 20252497.
2. The application of the strain of claim 1 for controlling citron rot in the prevention and control of plant fungal diseases caused by Alternaria.
3. The application of the strain of claim 2 for controlling citronella scab in the control of plant fungal diseases caused by Alternaria alternata, characterized in that, The plant disease mentioned is citron driersis.
4. A microbial preparation for preventing and treating dry finger disease of Buddha's Hand, characterized in that, Including the strain described in claim 1 Bacillus subtilis B702.
5. A microbial preparation for preventing and treating dry finger disease of Buddha's Hand as described in claim 4, characterized in that, The microbial preparation is a liquid inoculant, a wettable powder, or granules.
6. A method for preventing and treating dry finger disease in Buddha's Hand, characterized in that, This includes applying the microbial preparation for preventing and treating dry finger disease of Buddha's Hand as described in claims 4-5 to Buddha's Hand plants or the Buddha's Hand growing environment.
7. A method for preventing and treating dry finger disease of Buddha's Hand according to claim 6, characterized in that, The application methods include soil irrigation, foliar spraying, or fruit dipping, or one or more of these.
Citation Information
Patent Citations
Bacterial strain antagonistic to pathogenic bacteria of jujube fruit shrink disease and application of bacterial strain
CN103981137A
Bacillus subtilis S1703 and application thereof
CN121472093A