Brucella attenuated live vaccine strain M5ΔpyrE and construction method and application thereof

By knocking out the pyrE gene in the M5 strain of Brucella mesenteriae, an M5ΔpyrE attenuated live vaccine was constructed, which solved the safety and differential diagnosis problems of existing vaccines, achieved stronger immune protection, and is suitable for the prevention and control of brucellosis in animals.

CN122104545APending Publication Date: 2026-05-29SHANGHAI VETERINARY RESEARCH INSTITUTE CAAS (CHINESE ANIMAL HEALTH & EPIDEMIOLOGY CENTER SHANGHAI BRANCH)

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SHANGHAI VETERINARY RESEARCH INSTITUTE CAAS (CHINESE ANIMAL HEALTH & EPIDEMIOLOGY CENTER SHANGHAI BRANCH)
Filing Date
2026-04-20
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing brucellosis vaccines have shortcomings such as insufficient safety, potential risk of virulence reversion, inability to identify and diagnose brucellosis, and pathogenicity to humans, which limit their application in the prevention and control of brucellosis.

Method used

By knocking out the pyrE gene of Brucella mesenteroides M5 strain, an attenuated live vaccine strain M5ΔpyrE was constructed. The suicide plasmid was constructed using homologous recombination technology and electroporated into competent cells to obtain the deletion strain M5ΔpyrE.

Benefits of technology

M5ΔpyrE has significantly reduced virulence and survival rate, resulting in better safety and immune protection. It can effectively overcome the limitations of traditional vaccines and is suitable for the prevention of brucellosis in animals.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104545A_ABST
    Figure CN122104545A_ABST
Patent Text Reader

Abstract

This invention provides a live attenuated Brucella vaccine strain M5Δ pyrE Its construction methods and applications belong to the field of biotechnology. The M5... pyrE The strain was obtained by knocking out Brucella mesenteriae strain M5. pyrE Genetically constructed and deposited at the China Center for Type Culture Collection. This invention discovers that... pyrE The gene is associated with Brucella virulence; knocking out this gene significantly weakens Brucella virulence and reduces its intracellular and mouse viability. Compared to the existing vaccine strain M5-9026, M5... pyrE The strain exhibits superior immunoprotective effects, effectively inducing humoral and Th1 cellular immune responses, and demonstrates good safety. The M5 strain constructed in this invention... pyrE This strain has promising potential as a candidate strain for a live attenuated vaccine to prevent brucellosis in animals.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a live attenuated Brucella vaccine strain M5Δ. pyrE Its construction methods and applications. Background Technology

[0002] Brucellosis is a zoonotic infectious disease caused by Brucella bacteria. As a Gram-negative facultative intracellular parasite, Brucella has a wide host range, infecting various domestic and wild animals with high pathogenicity. This disease is listed as a notifiable animal disease by the World Organisation for Animal Health (OIE) and is also a Class B infectious disease under legal management in my country. In animals, infection is primarily characterized by reproductive system disorders, clinically manifesting as abortion in females and orchitis in males, possibly accompanied by symptoms such as arthritis. Humans are mainly infected through contact with infected animals or their products. Clinical symptoms are complex and diverse, including characteristic undulating fever, as well as inflammation of various tissues and organs such as arthritis, spondylitis, and myocarditis; severe cases can lead to impaired fertility.

[0003] Brucellosis is widespread globally, with particularly severe outbreaks in Asia, Africa, and South America, posing a significant public health challenge to the sustainable development of livestock farming in developing countries and threatening human health. Currently, brucellosis control relies primarily on a comprehensive strategy combining quarantine, culling, and vaccination of high-risk animals, with vaccination being a key means of controlling transmission among animals. Existing vaccines are mainly traditional live attenuated vaccines, such as strains A19, S2, and M5. While these have reduced the incidence of outbreaks to some extent, they still have significant limitations: including toxicity to pregnant animals, the potential risk of virulence reversion, the inability to differentiate between infection and immunization, and pathogenicity to humans. These shortcomings severely restrict vaccine safety and its practical effectiveness in eradication procedures.

[0004] In conclusion, developing new vaccines that can overcome the limitations of existing vaccines in terms of safety and diagnostic capabilities has become a critical issue that urgently needs to be addressed in the field of brucellosis prevention and control, and is also the core direction of current vaccine research and development. Summary of the Invention

[0005] This invention provides a live attenuated Brucella vaccine strain M5Δ pyrE Its construction method and application, through knocking out Brucella mesenteriae M5 strain pyrE Genes were used to construct the attenuated live vaccine strain M5. pyrE This deletion strain exhibits significantly reduced virulence, with drastically decreased intracellular and in vivo survival in mice, and is significantly less viable than the existing vaccine strain M5-90. 26 has a better immune protection effect and can effectively overcome the shortcomings of traditional vaccines such as insufficient safety and inability to identify and diagnose, and can be used as a candidate live attenuated vaccine for the prevention of brucellosis in animals.

[0006] On the one hand, the present invention provides a Brucella attenuated live vaccine strain M5Δ pyrE The following technical solution is adopted: A live attenuated Brucella vaccine strain M5Δ pyrE Brucella medullaris M5 strain deletion pyrE The gene was subsequently obtained and deposited at the China Center for Type Culture Collection, with accession number CCTCC M 2026529.

[0007] On the other hand, the present invention also provides a Brucella attenuated live vaccine strain M5Δ pyrE The construction method adopts the following technical solution: A live attenuated Brucella vaccine strain M5Δ pyrE The construction method specifically includes the following steps: S1, PCR amplification pyrE After amplification, the upstream and downstream homologous arm fragments of the gene are fused together using fusion PCR to obtain the fused fragment. S2. Using homologous recombination, the fusion fragment is ligated to the linearized suicide plasmid pKB to obtain a recombinant plasmid. After screening and extraction, the suicide plasmid pKB-Δ is obtained. pyrE ; S3, the suicide plasmid pKB-Δ pyrE Electroporation was performed on competent cells of Brucella mesenteriae strain M5, and M5Δ was obtained after double selection. pyrE Deletion strain.

[0008] Preferably, in step S1, PCR amplification pyrE The primer sequences used for amplifying upstream and downstream homologous arm fragments are shown in SEQ ID NO. 1-4. Among them, primer sequences pyrE-UF (SEQ ID NO. 1) and pyrE-UR (SEQ ID NO. 2) are used to amplify the upstream homologous arm fragment, and primer sequences pyrE-DF (SEQ ID NO. 3) and pyrE-DR (SEQ ID NO. 4) are used to amplify the downstream homologous arm fragment. The primer set used for fusion PCR is pyrE-UF (SEQ ID NO. 1) and pyrE-DR (SEQ ID NO. 4).

[0009] Preferably, in step S2, the screening method involves transforming the recombinant plasmid into *E. coli* DH5α competent cells, sequentially screening for kanamycin-resistant strains using LB solid medium and liquid medium containing kanamycin, followed by PCR identification of the bacterial culture and extraction of pKB-Δ... pyrE Suicide plasmids.

[0010] Preferably, in step S3, the dual screening method is as follows: the suicide plasmid pKB-Δ extracted in step S2 is used... pyrE Electroporation was performed on competent Brucella cells, and the product was plated on Brucella broth solid medium containing kanamycin. Positive clones were picked and inoculated into Brucella broth medium for culture. Negative selection was then performed on Brucella broth solid medium containing 10% sucrose. Single colonies were picked and cultured in Brucella broth liquid medium. M5Δ was then identified by PCR using inner and outer identification primers. pyrE Deletion strain.

[0011] Preferably, the inner identification primers are In-pyrE-F with sequences as shown in SEQ ID NO. 5 and In-pyrE-R with sequences as shown in SEQ ID NO. 6; the outer identification primers are Out-pyrE-F with sequences as shown in SEQ ID NO. 7 and Out-pyrE-R with sequences as shown in SEQ ID NO. 8.

[0012] This invention also provides a live attenuated Brucella vaccine strain M5Δ pyrE The application of its construction method in the preparation of agents for the prevention of brucellosis.

[0013] Preferably, the formulation is a live attenuated Brucella vaccine.

[0014] pyrE Gene deletion strain M5 pyrE It is deposited at the China Center for Type Culture Collection, located at No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, on March 26, 2026, with accession number CCTCC M2026529.

[0015] In summary, the beneficial effects of the present invention are as follows: This invention discloses for the first time pyrE The correlation between genes and Brucella virulence, and the M5 gene obtained by knocking out this gene. pyrEThe deletion strain exhibits significantly reduced virulence, with greatly decreased survival in macrophages and colonization in mice, along with a markedly slower growth rate, demonstrating good safety and attenuation properties. Furthermore, this deletion strain shows stable genetic characteristics both in vivo and in vitro, with a low risk of virulence reversion, providing a new technological pathway for the development of live attenuated Brucella vaccines.

[0016] Compared with the existing vaccine strain M5-90 Compared to 26, the M5 constructed in this invention pyrE This strain demonstrates superior immunoprotective efficacy, more effectively inducing the production of specific antibodies and Th1-type cellular immune responses, and exhibiting more durable protective efficacy in the later stages of immunization. This vaccine candidate strain overcomes the limitations of traditional vaccines in terms of safety, immunogenicity, and differential diagnosis, and can serve as a candidate strain for a live attenuated vaccine to prevent brucellosis in animals, showing promising prospects for industrial application. Attached Figure Description

[0017] Figure 1 This is a diagram showing the PCR amplification results of the target gene fragment in Example 1; in, Figure 1 A represents PCR amplification. pyrE Upstream and downstream homologous arms of a gene; Figure 1 B represents Overlap-PCR fusion amplification. pyrE Upstream and downstream homologous arms of a gene; Figure 2 In Example 1, the suicide plasmid pKB-Δ was identified using universal primers M13F(-47) / R(-48). pyrE Resulting image; Figure 3 In Example 1, inner and outer primers were used respectively for PCR identification of M5Δ pyrE Schematic diagram of the deletion strain; Figure 4 For the PCR identification of M5Δ in Example 1 pyrE Results of the missing strain; in, Figure 4 A represents the PCR identification of parental strains M5 and M5ΔpyrE deletion strains using the inner identification primers In-pyrE-F and In-pyrE-R. Figure 4 B uses the outer identification primers Out-pyrE-F and Out-pyrE-R to perform PCR identification of the parental strains M5 and M5ΔpyrE deletion strains; Figure 5 This is a graph showing the growth curve of Brucella in Example 2; Figure 6The M5 parental strain and M5Δ in Example 3 pyrE Figure showing the experimental results of the deletion strain adhering to and invading RAW264.7 cells; Figure 7 The M5 parental strain and M5Δ in Example 3 pyrE Figure showing the survival results of the deletion strain in RAW264.7 cells. Figure 8 To evaluate the deletion strain M5Δ in the mouse infection experiment of Example 4 pyrE Residual virulence results for strain M5-90Δ26 and vaccine strain M5-90Δ26; Figure 9 In Example 4, mice were infected with parental strain M5 and vaccine strain M5-90. 26 and deletion strain M5Δ pyrE The subsequent liver lesions; Figure 10 For the mouse immunization M5Δ in Example 5 pyrE Strain M5-90 A graph showing the humoral immunity status of 26 strains; Figure 11 For the mouse immunization M5Δ in Example 6 pyrE Peripheral blood IFN-γ levels of strain M5-90Δ26 and strain M5-90Δ26; Figure 12 M5Δ in Example 7 pyrE Strain and M5-90 A graph showing the results of immunoprotective trials using 26 strains as vaccines; in, Figure 12 A represents the spleen weight and bacterial load in mice 45 days after immunization and 2 weeks after M5 challenge. Figure 12 B represents the spleen weight and bacterial load in mice 56 days after immunization and 2 weeks after M5 challenge. Figure 13 M5Δ in Example 7 pyrE Strain and M5-90 Liver lesions in 26 immunized mice after challenge with the virus; in, Figure 13 A shows the histopathological changes in the liver of mice 45 days after immunization and 2 weeks after M5 challenge; Figure 13 B represents the histopathological changes in the liver of mice 56 days after immunization and 2 weeks after M5 challenge. Figure 14 The deletion strain M5Δ in Example 7 pyrE and vaccine strain M5-90 26. Statistical results on the number and diameter of Brucella granulomas formed in the liver of mice immunized for 45 days and 56 days respectively and challenged with M5 for 2 weeks. Detailed Implementation

[0018] The present invention will be further described in detail below with reference to the embodiments.

[0019] Example Example 1 Build pyrE Gene deletion strain M5 pyrE The specific method is as follows: S1, Primer Design Using the complete genome sequence of Brucella mesenteriae M28 (from NCBI GenBank, sequence number: NC_017244.1) as a template, primers were designed as follows: Amplification pyrE Primer pair for the upstream homologous arm fragment pyrE-U of the gene: pyrE-UF (SEQ ID NO. 1): GGTACCCGGGGATCCTTGGCGACAGCTGCGTGGGC; pyrE-UR (SEQ ID NO. 2): GAAACGGGTTTGGGTTTCAGTCCTATCCGTTCACAC; Amplification pyrE Primer pair for the downstream homologous arm fragment pyrE-D of the gene: pyrE-DF (SEQ ID NO. 3): CGGATAGGACTGAACCCAAACCCGTTTCGGGGCCG; pyrE-DR (SEQ ID NO. 4): TGCCTGCAGGTCGACTCTATAGTCAGGATTTACGG; Inner identification primers: In-pyrE-F (SEQ ID NO. 5):ACAGAAGGCGCCGTGTTCA; In-pyrE-R (SEQ ID NO. 6): TCTGCCGGATAGGCTGGAAC; External identification primers: Out-pyrE-F (SEQ ID NO. 7): CGCATCGTGGGCATCTTGCA; Out-pyrE-R (SEQ ID NO. 8): TCCTATACTGCGGGGTAGC.

[0020] S2, Amplification and Fusion of the Target Gene Using the Brucella mesenteriae M5 genome as a template, PCR amplification was performed using primer pairs pyrE-UF / UR and pyrE-DF / DR, respectively. pyrE The upstream homologous arm fragment pyrE-U and the downstream homologous arm fragment pyrE-D of the gene were used. The PCR amplification system was 50 μL, including 1 μL DNA template (100 ng / μL), 2 μL each of the upstream primer (10 pmol / μL) and the downstream primer (10 pmol / μL), 25 μL of 2×PrimeSTAR Max Premix (Takara), and deionized water to a final volume of 50 μL. The PCR reaction conditions were: 98℃ pre-denaturation for 2 min, 98℃ for 10 sec, 55℃ for 15 sec, 72℃ for 1 min, for 35 cycles, followed by a final extension at 72℃ for 10 min. The PCR products were subjected to 1% agarose gel electrophoresis, and the results are shown below. Figure 1 As shown. By Figure 1 As shown in A, the upstream homologous arm fragment pyrE-U and the downstream homologous arm fragment pyrE-D obtained by amplification are approximately 1000 bp in size, which is consistent with the expected result.

[0021] The target gene fragment was then recovered using the Tiangen agarose gel extraction kit. Using the gel-recovered pyrE-U and pyrE-D as templates and pyrE-UF / DR as primers, overlap-PCR was performed to fuse the upstream and downstream fragments. In a 50 μL PCR amplification system, 1 μL each of the gel-recovered pyrE-U (10-20 ng / μL) and pyrE-D (10-20 ng / μL), 2 μL each of the upstream primer pyrE-UF (10 pmol / μL) and the downstream primer pyrE-DR (10 pmol / μL), 25 μL of 2× PrimeSTAR Max Premix (Takara), and deionized water was added to bring the total volume to 50 μL. The PCR reaction conditions were: 98℃ pre-denaturation for 2 min, 98℃ for 10 sec, 55℃ for 15 sec, 72℃ for 2 min, for 35 cycles, and a final extension at 72℃ for 10 min. The PCR products were subjected to 1% agarose gel electrophoresis, and the results are as follows: Figure 1 As shown in B, the upstream and downstream fused fragment pyrE-UD is approximately 2000bp, consistent with the expected size.

[0022] S3, Construction of suicide plasmid: The fusion gene fragment pyrE-UD and the linearized plasmid pKB were ligated using a homologous recombination kit (Novizumab). The ligated fusion product was transformed into *E. coli* DH5α competent cells. Cells were screened sequentially on LB solid and liquid media containing 50 μg / mL kanamycin. PCR identification of the bacterial culture was performed using universal primers M13F(-47) / R(-48). The PCR reaction volume was 20 μL, including 1 μL of bacterial culture, 1 μL each of forward and reverse primers, 10 μL of 2× Taq Master Mix (Novizumab), and 7 μL of deionized water. The PCR conditions were: 95℃ pre-denaturation for 2 min, 95℃ for 15 sec, 60℃ for 15 sec, 72℃ for 2 min, for 35 cycles, followed by a final extension at 72℃ for 10 min.

[0023] Figure 2 PCR identification results showed that the target fragment was approximately 2000 bp in size, consistent with the expected result. After expanding the correctly identified bacterial culture in kanamycin-resistant LB liquid medium, the suicide plasmid was extracted using a high-purity small-scale extraction kit (Tiangen), and named pKB-Δ. pyrE Store correctly sequenced plasmids for later use.

[0024] S4. Construction of gene-deleted strains: Brucella M5 strain cultured in Brucella broth to early logarithmic growth phase (OD) 600 =0.6~0.8). After placing the bacterial culture on ice for 15~30 min, centrifuge at 8000× g for 5 min at 4℃ to collect the bacterial pellet. Wash the bacterial cells twice with pre-cooled sterile deionized water. During the second wash, transfer the pellet to a new centrifuge tube and centrifuge, discarding the supernatant. Resuspend the bacterial pellet in pre-cooled sterile 10% glycerol solution and aliquot into 90 μL / vial. Add 1~2 μg of recombinant plasmid to the prepared M5 competent cells, mix gently, and incubate on ice for 10 min. Add 100 μL of the mixture to a pre-cooled disposable electroporation cuvette and electroporate the plasmid into the competent cells at 2.4kV, 400Ω. Slowly add 800 μL of preheated 37℃ Bournez broth to the electroporation cuvette and mix by pipetting. Add 900 μL of the mixture to a sterile 2 mL EP tube and label it. Incubate at 37℃, 220 rpm for 6~8 h. Centrifuge the bacterial suspension at 8000 rpm for 5 min, discard 800 μL of supernatant, resuspend the suspension, and spread it entirely onto Brucella broth solid medium containing kanamycin. Incubate statically at 37℃ with 5% CO2 for 3–5 days. Pick single colonies and spread them onto Brucella broth liquid medium, incubate at 37℃ with shaking for 2–3 days. After serial dilution, spread 100 μL of the bacterial suspension onto Brucella broth solid medium containing 10% sucrose for a second round of screening. The bacterial suspension is then analyzed using In-... pyrE -F / R and Out- pyrE -F / R are the inner and outer identification primers, used for PCR identification of bacterial cultures. The PCR reaction system and conditions are the same as described in step (3). A schematic diagram of PCR identification is shown below. Figure 3 As shown.

[0025] Depend on Figure 3 As shown in the diagram, when the bacterial culture was identified by PCR using the inner primer In-pyrE-F / R, the size of the M5 fragment of the parental strain was 420bp, while the deleted strain should not have this band. When the bacterial culture was identified by PCR using the outer primer Out-pyrE-F / R, the size of the M5 band of the parental strain was 1113bp, while the deleted strain, due to the deletion of 579bp, should have a band size of 534bp.

[0026] Figure 4 PCR identification results showed that the band size of the parental strain M5 was approximately 420 bp when identified by PCR using the inner primers; the deletion strain M5Δ pyrE No obvious band amplification was observed. PCR identification using the outer primers showed that the parental strain M5 had a band size of approximately 1113 bp; the deletion strain M5Δ... pyrE The band size was approximately 579 bp, and the identification results were consistent with the expected results.

[0027] Example 2 Brucella M5 obtained in Example 1 pyrE The basic phenotypes of the strain and its parental Brucella M5 strain were verified using the following methods: In vitro culture of Brucella M5 parent strain and pyrE Gene deletion strain M5 pyrE To reach the logarithmic growth phase, adjust OD 600 The bacterial culture was inoculated into Brucella broth at a ratio of 1:10 and cultured at 37°C and 220 rpm. OD values ​​were measured at 100 μL of the culture every 6 hours. 600 Values ​​were used to plot bacterial growth curves, and the results are shown in [the table]. Figure 5 .

[0028] Figure 5 Showing the parental Brucella strain M5 and the deletion strain M5Δ pyrE Comparison of growth curves in Brucella broth. After adjusting both strains to the same initial concentration, they were cultured at 37°C and 220 rpm, and OD was measured every 6 hours. 600 Value. The results show that M5Δ pyrE The growth rate of the deletion strain was significantly slower than that of the parent strain M5, and statistical analysis showed a highly significant difference between the two. p ≤0.001). This result indicates that pyrEThe deletion of the gene significantly affects the growth ability of Brucella in vitro, further confirming the correlation between the gene and the physiological characteristics of the bacteria.

[0029] Example 3 Brucella M5 prepared in Example 1 pyrE The strain underwent adhesion and cell invasion assays and intracellular survival tests. The specific steps are as follows: (1) Brucella M5 pyrE Adhesion and invasion of cells assay Brucella M5 parental strain and M5 cultured overnight pyrE Deletion strain adjusted to OD 600 =1.0. One day prior to treatment, mouse macrophages RAW264.7 were injected at a rate of 2.5~3×10⁻⁶. 5 Cells were seeded into 24-well cell culture plates at a concentration of 1 mL per well and cultured for 20–24 h until a monolayer was formed. Macrophages were then centrifuged at 400 × g for 5 min to simultaneously infect cells at a multiplicity of infection (MOI) of 100:1 (bacteria:cells). After 1 h of culture at 37°C and 5% CO2, the infection time was recorded as 0. After cell infection, cells were washed three times with PBS, and 200 μL of 0.25% Triton-X 100 PBS solution was added to each well to lyse the cells. 100 μL of the cell lysate was serially diluted 10-fold and plated. Cells were incubated at 37°C and 5% CO2 for 3–4 days, and the CFU (cell FU) count was performed to estimate the initial CFU in each well, representing the amount of bacteria adhered. After cell infection, cells were washed three times with PBS and treated with gentamicin (100 μg / mL) for 1 h to kill extracellular bacteria. Wash three times with PBS. Add 200 μL of 0.25% Triton-X 100 PBS solution to each well to lyse the cells. Take 100 μL of cell lysis buffer and serially dilute it 10-fold. Take 100 μL of the diluted solution and plate it. Incubate at 37 ℃ and 5% CO2 for 3-4 days. Count the bacterial CFU and estimate the original CFU in each well. This represents the amount of invading bacteria. The results are as follows: Figure 6 As shown.

[0030] Depend on Figure 6 It can be seen that, compared with the parental strain M5, M5 pyrE The ability of the strain to adhere to and invade RAW264.7 cells was significantly reduced, indicating that... pyrE Gene deletion affects Brucella's ability to adhere to and invade RAW264.7 cells.

[0031] (2) Intracellular survival assay Based on Brucella M5 pyrE In the infection procedure of the Brucella adhesion and invasion cell assay, cells were infected. After infection, the cells were incubated in DMEM containing 100 μg / mL gentamicin for 1 h to kill extracellular bacteria. The cells were washed three times with PBS. After washing away the extracellular bacteria, the culture medium was replaced with DMEM solution containing 50 μg / mL gentamicin and 2% FBS to maintain the cells. Cell plates were removed at 1 h, 8 h, 24 h, and 48 h post-infection. The cells were washed three times with PBS, and 300 μL of 0.25% Triton-X 100 PBS solution was added to each well to lyse the cells for 15 min. 100 μL of cell lysate was serially diluted 10-fold and plated. The cells were cultured at 37℃ and 5% CO2 for 3-4 days. CFU were counted, and the original CFU in each well was estimated. The intracellular survival curve of Brucella was plotted. The results are shown below. Figure 7 As shown.

[0032] Depend on Figure 7 It can be seen that M5 pyrE Although the intracellular bacterial load of the deletion strain showed a continuous upward trend when infecting RAW264.7 cells compared to the parental strain M5, it remained at a low level and was significantly lower than that of the parental strain M5. This result indicates that... pyrE Gene deletion significantly weakens Brucella's ability to proliferate and survive in host cells, reflecting Δ pyrE The deletion strain exhibits reduced virulence.

[0033] Example 4 Brucella M5 prepared in Example 1 pyrE The residual toxicity test of the strain was conducted using the following steps: The Brucella M5-90Δ26 vaccine strain cultured overnight and M5 pyrE Deletion strain adjusted to OD 600 =1.0. (At this point, the bacterial concentration is approximately 5 × 10⁻⁶.) 9 (CFU / mL), diluted with PBS to 1×10⁻⁶. 6 CFU / mL. Eighteen female BALB / c mice aged 6-8 weeks were divided into 3 groups (n=6 per group) and intraperitoneally inoculated with 0.1 mL of bacterial suspension (containing 1×10⁻⁶ bacteria). 5CFU), with the PBS group serving as a negative control. Mice were rapidly euthanized by cervical dislocation at weeks 2, 4, 6, and 8 post-infection. Spleens were harvested, and the degree of spleen swelling and weight were observed. 3 mL of 0.25% Triton-X 100 PBS solution was added to the spleen and ground. After a 10-fold serial dilution, 100 μL of the solution was collected and plated to count bacterial CFU. The original bacterial load in each spleen was calculated to assess the residual virulence of the bacteria.

[0034] To further evaluate M5-90 26 and M5 pyrE The pathogenicity of Brucella M5 strain and M5-90 cultured overnight was investigated. 26 vaccine strains and M5 pyrE Deletion strain adjusted to OD 600 =1.0. (At this point, the bacterial concentration is approximately 5 × 10⁻⁶.) 9 (CFU / mL), diluted with PBS to 1×10⁻⁶. 6 CFU / mL. Twenty female BALB / c mice aged 6-8 weeks were divided into 4 groups (n=4 per group) and intraperitoneally inoculated with 0.1 mL of bacterial suspension (containing 1×10⁻⁶ bacteria). 5 CFU and PBS groups served as negative controls. Mouse livers were harvested on day 45 post-infection, fixed by immersion in 4% paraformaldehyde for 24–48 h, and then sent to Shanghai Boerfu Company for tissue section preparation and HE staining to observe pathological changes in the liver.

[0035] Depend on Figure 8 To date, spleen weight and bacterial load remained low in the PBS group mice for 2-8 weeks post-infection; M5-90Δ26 and M5 pyrE The spleen weight of the M5 group was significantly higher than that of the PBS group at 2 weeks. pyrE The spleen weight in the PBS group was higher (significantly different from the M5-90Δ26 group), and subsequently, the spleen weight in both groups gradually decreased over time, showing no significant difference by week 8. Regarding spleen bacterial load, at week 2, the bacterial load in both groups was significantly higher than that in the PBS group. Over time, the bacterial load in both groups showed a decreasing trend, with no significant difference observed.

[0036] Depend on Figure 9 It can be seen that, compared with the PBS-inoculated group, the parental strain M5 inoculated mice formed obvious granulomas in the liver tissue (indicated by arrows). pyrE In mice inoculated with the M5-90Δ26 vaccine strain, very small granulomas occasionally formed in the liver tissue, but the overall liver tissue essentially returned to normal. This indicates that... pyrEGene deletion significantly reduced the pathogenicity of Brucella M5 strain in mice, especially in the early stages of M5 inoculation. pyrE The residual virulence of the strain was slightly higher than that of the M5-90Δ26 vaccine strain. Four weeks after vaccination, the M5... pyrE The residual virulence of the strain is basically similar to that of the M5-90Δ26 vaccine strain.

[0037] Example 5 Brucella M5 prepared in Example 1 pyrE The antibody levels of the strain were measured in immunized mice. The specific steps are as follows: To evaluate M5 pyrE The antibody levels of strain M5-90Δ26 in mice after immunization were determined by ELISA using serum from mice immunized at 2, 4, 6, and 8 weeks post-immunization. M5 whole-cell protein was coated onto 96-well plates at 25 μg / well and incubated overnight at 4°C. Wash three times with 1×PBST, 5 min each time. Block with 5% skim milk at room temperature for 2 h. Wash three times with 1×PBST, 5 min each time. Incubate with primary antibody (mouse serum diluted 200-fold), 100 μL / well, at 37°C for 1 h. Wash three times with 1×PBST, 5 min each time. Incubate with HRP-labeled rabbit anti-mouse secondary antibody (rabbit anti-mouse IgM diluted 1:10000; rabbit anti-mouse IgG, IgG1, IgG2a diluted 1:20000), 100 μL / well, at 37°C for 1 h. Wash three times with 1×PBST, 5 min each time. Add 100 μL / well of TMB substrate chromogenic solution and incubate in the dark for 20 min. Add 100 μL / well of stop solution and allow the OD to develop within 5 min. 450 The antibody titer was then determined.

[0038] Depend on Figure 10 As shown in the figure, at various time points from 2 to 8 weeks post-infection, M5 pyrE The levels of IgM, IgG, IgG1, and IgG2a antibodies in the serum of mice immunized with M5-90Δ26 were significantly higher than those in the PBS group, demonstrating that both vaccines effectively activated the humoral immune response against Brucella. Intergroup comparisons showed that in the early stages of immunization (weeks 2, 4, and 6), M5... pyrEThe overall levels of IgM, IgG, and IgG2a antibodies in the M5-90Δ26 group were higher than those in the M5-90Δ26 group, with significant differences at some time points (e.g., IgM at 2 weeks immunization, IgG and IgG2a at 4 weeks immunization), while there was no significant difference in IgG1 levels between the two groups. By week 8, the levels of all antibodies in the two groups were similar, with no significant difference. Furthermore, regardless of whether it was week 2 or week 8, the IgG2a levels in both groups were significantly higher than IgG1, suggesting a bias towards a Th1-type immune response (facilitating the clearance of intracellular bacteria), with the M5 group showing the most significant difference. pyrE The group showed slightly better induction of IgM, IgG, and IgG2a in the early stage of immunity than the M5-90Δ26 group.

[0039] Example 6 Brucella M5 prepared in Example 1 pyrE The cytokine assay of the strain in immunized mice was performed using the following steps: The IFN-γ content in mouse serum at different immunization stages was detected using the Mouse IFN-γ Precoated ELISA Kit (Beijing DaKeWei). The reagents were first diluted and mixed according to the instructions, and then added sequentially to the standard wells, sample wells, and blank wells. The detection antibody was added and incubated at 37°C for 90 minutes, followed by four washes. The enzyme working solution was then added and incubated for 30 minutes, followed by repeated washes. TMB was added and incubated in the dark for 10–20 minutes. The reaction was terminated with stop solution. The plate was read from the plate within the last 10 minutes using a microplate reader at a detection wavelength of 450 nm and a reference wavelength of 610–630 nm.

[0040] Depend on Figure 11 It can be seen that within 2-8 weeks after immunization, M5-90Δ26 and M5 pyrE The serum IFN-γ levels in the M5 group were significantly higher than those in the PBS group at all time points, indicating that both vaccines effectively activated Th1 cellular immune responses. Intergroup comparisons showed that at each time point from 2 to 8 weeks, M5... pyrE There was no significant difference in IFN-γ levels between the M5-90Δ26 group and the M5-90Δ26 group, but the M5 group... pyrE The IFN-γ level in the M5-90Δ26 group was slightly higher than that in the M5-90Δ26 group at all stages. With prolonged immunization time, the IFN-γ levels in both groups remained within a stable range, reflecting a sustained state of cellular immune activation. This result indicates that the two vaccines have similar overall ability to induce Th1-type cellular immunity, with the M5-90Δ26 group showing a higher level of IFN-γ. pyrE The ability of immune-activated mice to secrete IFN-γ was slightly superior.

[0041] Example 7 Brucella M5 prepared in Example 1 pyrE The following are the specific steps for conducting an immunoprotective test on mice immunized with the strain: S1, Brucella M5 cultured overnight. pyrE Deletion strain and M5-90Δ26 vaccine strain adjusted to OD 600 =1.0 (At this point, the bacterial concentration is approximately 5 × 10⁻⁶) 9 (CFU / mL). Dilute the bacterial culture with PBS to approximately 1×10⁻⁶. 6 CFU / mL. Eighteen female BALB / c mice aged 6-8 weeks were randomly divided into PBS group and M5 group. The pyrE group and the M5-90Δ26 group each had 6 mice, and each mouse received 1×10⁻⁶ phosphate feed. 5 Mice in the CFU group were immunized with a dose of 0.1 mL / mouse, and those in the PBS group were intraperitoneally injected with 0.1 mL of PBS. 45 or 56 days post-vaccination, mice were immunized with 1×10⁻⁶ CFU. 5 All mice were challenged with M5 at a dose of CFU / mouse. Two weeks after challenge, all mice were euthanized by rapid cervical dislocation. The spleens were harvested, and the degree of spleen swelling was observed and the spleen weight was measured. 3 mL of 0.25% Triton-X100 PBS solution was added to the spleen and ground. After 10-fold serial dilution, 100 μL of the solution was taken and plated to count the bacterial CFU and estimate the original bacterial load in the spleen.

[0042] S2, for further evaluation of M5 pyrE and M5-90 To assess the immunoprotective efficacy of the 26 vaccine strains, livers were harvested from mice 45 and 56 days after immunization and challenged with M5 for two weeks. The livers were fixed in 4% paraformaldehyde for 48 hours and then sent to Shanghai Boerf Pharmaceutical Co., Ltd. for tissue section preparation and HE staining to observe pathological changes. Simultaneously, panoramic scanning and quantitative analysis of the sections were performed using Slide Viewer software. Five 15 mm² regions were randomly selected from each group to count the number of granulomas, and the diameter of 50 granulomas was measured.

[0043] Depend on Figure 12 It can be seen that, compared with the PBS vaccination group, M5 pyrE and M5-90 In mice immunized with 26 antibodies, spleen weight and bacterial load were significantly reduced. Intergroup comparisons showed that 45 days post-immunization, M5... pyrE There was no significant difference in spleen bacterial load between M5-90Δ26 immunized mice and M5-90Δ26 immunized mice; however, 56 days post-immunization, M5 pyrEThe bacterial load in the spleen of the immunized group was significantly lower than that of the M5-90Δ26 immunized group, indicating a more durable protective efficacy. Furthermore, there was no significant difference in spleen weight between the two vaccine immunized groups at any time point.

[0044] Depend on Figure 13 It can be seen that typical granulomatous lesions were observed in the liver of the PBS group (indicated by arrows), while M5-90Δ26 and M5... pyrE The number of liver granulomas in the immune group was significantly reduced and the severity of the lesions was significantly alleviated, with only a few scattered small granulomas observed.

[0045] Depend on Figure 14 It can be seen that the quantitative analysis results of granuloma formation showed that at two time points, 45 days and 56 days post-immunization, M5-90Δ26 and M5 pyrE Unit area (mm) of the immunization group 2 The number and diameter of granulomas were significantly lower in the PBS group than in the PBS group, but there was no significant difference between the two vaccine groups.

[0046] In summary, this invention utilizes the absence of... pyrE M5 was constructed after gene generation pyrE This strain, compared to the original Brucella M5 strain, exhibits significantly reduced virulence and significantly decreased intracellular and in vivo survival in mice, compared to M5-90. Compared to the 26 vaccine, it has stronger immune protection and can be used as a candidate live attenuated vaccine strain for the prevention of brucellosis in animals.

[0047] The above are all preferred embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Therefore, all equivalent changes made in accordance with the structure, shape and principle of the present invention should be covered within the scope of protection of the present invention.

Claims

1. A live attenuated Brucella vaccine strain M5Δ pyrE Its characteristics are, The Brucella attenuated live vaccine strain M5Δ pyrE Brucella melioides M5 strain deletion pyrE After gene sequencing, the Brucella attenuated live vaccine strain M5Δ was obtained. pyrE It is deposited at the China Center for Type Culture Collection, with accession number CCTCC M 2026529.

2. The Brucella attenuated live vaccine strain M5Δ according to claim 1 pyrE The construction method is characterized by, Specifically, the following steps are included: S1, PCR amplification pyrE After amplification, the upstream and downstream homologous arm fragments of the gene are fused together using fusion PCR to obtain the fused fragment. S2. Using homologous recombination, the fusion fragment is ligated to the linearized suicide plasmid pKB to obtain a recombinant plasmid. After screening and extraction, the suicide plasmid pKB-Δ is obtained. pyrE ; S3, the suicide plasmid pKB-Δ pyrE Electroporation was performed on competent cells of the *Brucella mellitus* M5 strain, and M5Δ was obtained after double selection. pyrE Deletion strain.

3. The Brucella attenuated live vaccine strain M5Δ according to claim 2 pyrE The construction method is characterized by, In step S1, the PCR amplification pyrE The primer sequences used for amplifying the upstream and downstream homologous arm fragments are shown in SEQ ID NO. 1-4. Among them, primer sequences pyrE-UF (SEQ ID NO. 1) and pyrE-UR (SEQ ID NO. 2) are used to amplify the upstream homologous arm fragment, and primer sequences pyrE-DF (SEQ ID NO. 3) and pyrE-DR (SEQ ID NO. 4) are used to amplify the downstream homologous arm fragment. The primer set used for the fusion PCR is pyrE-UF (SEQ ID NO. 1) and pyrE-DR (SEQ ID NO. 4).

4. The Brucella attenuated live vaccine strain M5Δ according to claim 2 pyrE The construction method is characterized by, In step S2, the screening method involves transforming the recombinant plasmid into *E. coli* DH5α competent cells, screening for kanamycin-resistant strains sequentially on LB solid medium and liquid medium containing kanamycin, followed by PCR identification of the bacterial culture and extraction of pKB-Δ... pyrE Suicide plasmids.

5. The Brucella attenuated live vaccine strain M5Δ according to claim 2 pyrE The construction method is characterized by, In step S3, the dual screening method is as follows: the suicide plasmid pKB-Δ extracted in step S2 is... pyrE Electroporation was performed on competent Brucella cells, and the product was plated on Brucella broth solid medium containing kanamycin. Positive clones were picked and inoculated into Brucella broth medium for culture. Negative selection was then performed on Brucella broth solid medium containing 10% sucrose. Single colonies were picked and cultured in Brucella broth liquid medium. M5Δ was then identified by PCR using inner and outer identification primers. pyrE Deletion strain.

6. The Brucella attenuated live vaccine strain M5Δ according to claim 5 pyrE The construction method is characterized by, The inner identification primers are In-pyrE-F and In-pyrE-R as shown in SEQ ID NO. 5 and SEQ ID NO. 6, respectively; the outer identification primers are Out-pyrE-F and Out-pyrE-R as shown in SEQ ID NO. 7 and SEQ ID NO. 8, respectively.

7. The Brucella attenuated live vaccine strain M5Δ according to claim 1 pyrE Or the Brucella attenuated live vaccine strain M5Δ according to any one of claims 2-6 pyrE The application of the construction method in the preparation of agents for the prevention of brucellosis.

8. The application according to claim 7, characterized in that, The preparation is a live attenuated Brucella vaccine.