Chitosanase mutant wp-e80a, plasmid, recombinant bacteria and application thereof

Abstract

The present application relates to a kind of chitosanase mutant WP-E80A, plasmid, recombinant bacteria and its application, belong to enzyme engineering technical field, the amino acid sequence of the chitosanase mutant as shown in SEQ ID NO:1, the amino acid sequence of wild-type chitosanase CsnWP as shown in SEQ ID NO:2.Compared with wild-type chitosanase CsnWP, the 80th amino acid is subjected to site-directed mutagenesis.The present application also provides plasmid and recombinant engineering bacteria comprising the chitosanase mutant WP-E80A gene, and the chitosanase mutant WP-E80A can be prepared to generate chitotriose with chitobiose as substrate.

Description

[0001] This patent claims priority to the application filed on March 19, 2025, application number 2025103264033, entitled "A chitosanase mutant WP-E80A, plasmid, recombinant bacteria and its application". Technical Field

[0002] This invention belongs to the field of enzyme engineering technology, specifically relating to a chitosanase mutant WP-E80A, a plasmid, a recombinant bacterium, and their applications. Background Technology

[0003] Chitosan is a derivative of chitin. N The acetylated product, chitosan oligosaccharide, is the only naturally occurring basic cationic polysaccharide with excellent adsorption and viscosity properties, making it suitable for use in food, materials, and other fields. Compared to chitosan, its degradation product, chitosan oligosaccharide, possesses a variety of biological activities, such as antitumor, antibacterial, antioxidant, and cholesterol-lowering effects, and has wide applications in the medical, food, agricultural, and cosmetic fields. Studies have also shown that the biological activity of chitosan oligosaccharide largely depends on its molecular weight, i.e., its degree of polymerization. Chitosan oligosaccharides with a degree of polymerization of 3-6 exhibit anti-infective effects, and the activity increases with increasing degree of polymerization. Therefore, the production of chitosan oligosaccharides with specific degrees of polymerization, especially those with higher degrees of polymerization, has attracted widespread interest from researchers.

[0004] Currently, the main methods for preparing chitosan oligosaccharides from chitosan include physical methods, chemical methods, and enzymatic methods. Physical methods suffer from low product yield, uncontrollable product quality, and high equipment requirements; chemical methods involve harsh reaction conditions, easily causing environmental pollution, and the products have a wide degree of polymerization. Enzymatic methods, on the other hand, offer advantages such as mild reaction conditions, high product selectivity, and ease of preparation. Chitosanase (EC 3.2.1.132) is an enzyme that specifically degrades chitosan, hydrolyzing the β-1,4-glycosidic bonds of chitosan, and plays a crucial role in the preparation of chitosan oligosaccharides. Currently, there is a scarcity of chitosanases capable of preparing high-polymerization-degree chitosan oligosaccharides, a deficiency that severely restricts the development of enzymatic methods for producing chitosan oligosaccharides. Recent studies have found that some chitosanases not only possess hydrolytic activity but also transglycosylation activity, exhibiting advantages such as readily available substrates and low production costs in transglycosylation reactions for producing high-polymerization-degree oligosaccharides. Therefore, it is urgent to discover chitosanase genes with transglycosylation activity, identify key amino acid sites that affect their hydrolysis / transglycosylation activity, and perform targeted modification to achieve efficient enzymatic preparation of highly polymerized chitosan oligosaccharides. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a chitosanase with transglycosylation activity, which can generate chitosan oligosaccharides with high degree of polymerization from low degree of polymerization chitosan oligosaccharides.

[0006] To address the shortcomings of existing technologies, this invention provides a chitosanase mutant WP-E80A, a plasmid, a recombinant bacterial strain, and their applications. By implementing site-directed mutagenesis on the active site of chitosanase CsnWP, its hydrolytic activity is effectively inhibited, thereby enhancing its transglycosylation function. This enables the targeted synthesis of high-polymerization-degree chitosan oligosaccharides from low-polymerization-degree products. This technological breakthrough not only provides an innovative solution for the industrial-scale preparation of high-polymerization-degree chitosan oligosaccharides but also lays the foundation for the iterative upgrading of chitosan oligosaccharide production technology and the high-value utilization of chitosan resources in my country.

[0007] This invention is achieved through the following technical solution: A chitosanase mutant WP-E80A, the amino acid sequence of which is shown in SEQ ID NO:1, and the amino acid sequence of wild-type chitosanase CsnWP, as shown in SEQ ID NO:2. Compared to wild-type chitosanase CsnWP, a site-directed mutation is made at amino acid position 80.

[0008] Furthermore, the wild-type chitosanase CsnWP of the chitosanase WP-E80A is derived from... Paenibacillus anaericanus (GenBank ID: WP_127192817.1).

[0009] The present invention also provides a gene encoding the chitosanase mutant WP-E80A, the nucleotide sequence of which is shown in SEQ ID NO.3, and the nucleotide sequence of the wild-type chitosanase CsnWP is shown in SEQ ID NO:4.

[0010] The present invention also provides a recombinant plasmid carrying the gene shown in SEQ ID NO.3, and the expression vector is preferably pET-28a(+).

[0011] This invention also provides a recombinant engineered strain obtained by transformation containing the above-mentioned recombinant plasmid, wherein the preferred expression host is... E. coli BL21(DE3).

[0012] The present invention also provides an enzyme preparation containing the above-mentioned chitosanase mutant WP-E80A.

[0013] The present invention also provides the application of the chitosanase mutant WP-E80A in the preparation of chitotrisaccharide using chitobiose as a substrate.

[0014] The beneficial effects of this invention compared to the prior art are as follows: This invention addresses the problem of low polymerization degree in chitosan products prepared by existing chitosanases. Starting with CsnWP, a mutant WP-E80A was obtained by site-directed mutagenesis of its active site (glutamic acid at position 80 was mutated to alanine). Results show that CsnWP can convert chitobiose to a small amount of chitotriose via transglycosylation, with a ratio of approximately 5:1. However, after losing its hydrolytic activity, the transglycosylation function of the mutant WP-E80A becomes more prominent, allowing chitobiose to generate more chitotriose, with a ratio of 1.5:1. This discovery lays the foundation for the targeted modification of the transglycosylation activity of chitosanase to generate high-polymerization-degree chitosan oligosaccharides from low-polymerization-degree chitosan oligosaccharides. Attached Figure Description

[0015] Figure 1 The first image shows the product analysis chromatograms of glucosamine, chitosan oligosaccharides (degree of polymerization 2-6), and chitosan catalyzed by wild-type chitosanase CsnWP; image a shows the TLC analysis chromatogram of glucosamine, chitosan oligosaccharides (degree of polymerization 2-6), and chitosan catalyzed by wild-type chitosanase CsnWP; image b shows the ESI-MS analysis of chitobiose catalyzed by wild-type chitosanase CsnWP. (GlcN)2 (+K + , m / z 379), (GlcN)3 (+K + , m / z 541); Figure 2 The first image shows the product analysis of chitosanase CsnWP and its mutant WP-E80A catalyzing chitobiose; a is a TLC analysis; b is a liquid phase analysis. Detailed Implementation

[0016] The method of the present invention will be further described below with reference to the accompanying drawings and embodiments. However, the experimental conditions used in the embodiments can be selected based on existing technologies. For experimental methods where specific conditions are not specified in the embodiments, they can generally be operated under conventional conditions or according to the conditions recommended by the manufacturer.

[0017] The present invention will be further described below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0018] Example 1: Preparation of recombinant chitosanase CsnWP strain To discover chitosanases with transglycosylation specificity, this invention screened a chitosanase derived from [a specific source] through NCBI search and comparison. Paenibacillus anaericanusA chitosanase (GenBank ID: WP_127192817.1) with potential transglycosylation activity, whose sequence is shown in SEQ ID NO.2, was named chitosanase Csn-WP. The full-length gene was synthesized and ligated into the expression vector pET-28a(+) to obtain a recombinant plasmid. The plasmid was then transformed into the host cell. E. coli Recombinant chitosanase CsnWP was obtained from BL21(DE3) competent cells.

[0019] Example 2: Construction of chitosanase mutant WP-E80A Using chitosanase CsnWP as a template, with its active sites at E80 and D98, the 80th amino acid was mutated. PCR amplification was performed using primers E80A-F and E80A-R from Table 1, and the product was then subjected to... Dpn After digestion with enzyme I, it is converted to E. coli In BL21(DE3), a chitosanase mutant WP-E80A was constructed, in which glutamic acid at position 80 was mutated to alanine; Table 1 Primer Sequences .

[0020] Example 3: Induction and purification of chitosanase CsnWP and mutant WP-E80A Wild-type chitosanase CsnWP and recombinant mutant WP-E80A were inoculated into LB liquid medium (containing 100 μg / mL kanamycin) and cultured at 37°C until OD500. 600 After reaching a concentration of 0.6–0.8, IPTG was added to a final concentration of 0.1 mM, and the cells were incubated at 20°C for another 18 h. The cells were collected by centrifugation at 4°C, sonicated, and the protein was purified using a Ni-NTA affinity column. Impurities were eluted with NPI-20 and the target protein was eluted with NPI-100. The purified chitosanase CsnWP and its mutant WP-E80A were then obtained by ultrafiltration to remove salt and concentration.

[0021] The amino acid sequence of the chitosanase mutant WP-E80A is SEQ ID NO:1: MLNTKQNSGSKRLKFSLLVLLSFVITISFGLLSNPFQSKSYAATNPDSNFSPATLKFLKDNTGLDGEQWNNIMKLVNKPAQDDLNWTNYYGYCEKLTDKRGFTIGIFGATTGGANDTGPDGPDLFKEYDKVKGATNPSVSGALKRLGINGSMSGSILVIKDSDSAFIKKINALQNDPAWREAMWKTFYNVYIKYSVQQANQRGFKTALTIGSFVDAALNHGATGDSNSLQGLLKKSGTSTNEKTFMTSFYAKRTLIVDTNDYNQAPNGKNRVKQWSTLLSQGETDLKGADAAIVKVTNWEMQ Amino acid sequence of chitosanase CsnWP SEQ ID NO:2: MLNTKQNSGSKRLKFSLLVLLSFVITISFGLLSNPFQSKSYAATNPDSNFSPATLKFLKDNTGLDGEQWNNIMKLVNKPEQDDLNWTNYYGYCEKLTDKRGFTIGIFGATTGGANDTGPDGPDLFKEYDKVKGATNPSVSGALKRLGINGSMSGSILVIKDSDSAFIKKINALQNDPAWREAMWKTFYNVYIKYSVQQANQRGFKTALTIGSFVDAALNHGATGDSNSLQGLLKKSGTSTNEKTFMTSFYAKRTLIVDTNDYNQAPNGKNRVKQWSTLLSQGETDLKGADAAIVKVTNWEMQ; Nucleotide sequence of chitosanase mutant WP-E80A SEQ ID NO:3: ATGCTGAACACCAAACAGAACTCTGGTTCTAAACGTCTGAAATTCTCTCTGCTGGTTCTGCTGTCTTTCGTTATCACCATCTCTTTCGGTCTGCTGTCTAACCCGTTCCAGTCTAAATCTTACGCTGCTACCAACCCGGACTCTAACTTCTCTCCGGCTACCCTGAAATTCCTGAAAGACAACACCGGTCTGGACGGTGAACAGTGGAACAACATCATGAAACTGGTTAACAAACCGGCACAGGACGACCTGAACTGGACCAACTACTACGGTTACTGCGAAAAACTGACCGACAAACGTGGTTTCACCATCGGTATCTTCGGTGCTACCACCGGTGGTGCTAACGACACCGGTCCGGACGGTCCGGACCTGTTCAAAGAATACGACAAAGTTAAAGGTGCTACCAACCCGTCTGTTTCTGGTGCTCTGAAACGTCTGGGTATCAACGGTTCTATGTCTGGTTCTATCCTGGTTATCAAAGACTCTGACTCTGCTTTCATCAAAAAAATCAACGCTCTGCAGAACGACCCGGCTTGGCGTGAAGCTATGTGGAAAACCTTCTACAACGTTTACATCAAATACTCTGTTCAGCAGGCTAACCAGCGTGGTTTCAAAACCGCTCTGACCATCGGTTCTTTCGTTGACGCTGCTCTGAACCACGGTGCTACCGGTGACTCTAACTCTCTGCAGGGTCTGCTGAAAAAATCTGGTACCTCTACCAACGAAAAAACCTTCATGACCTCTTTCTACGCTAAACGTACCCTGATCGTTGACACCAACGACTACAACCAGGCTCCGAACGGTAAAAACCGTGTTAAACAGTGGTCTACCCTGCTGTCTCAGGGTGAAACCGACCTGAAAGGTGCTGACGCTGCTATCGTTAAAGTTACCAACTGGGAAATGCAG; Nucleotide sequence of chitosanase CsnWP SEQ ID NO:4: ATGCTGAACACCAAACAGAACTCTGGTTCTAAACGTCTGAAATTCTCTCTGCTGGTTCTGCTGTCTTTCGTTATCACCATCTCTTTCGGTCTGCTGTCTAACCCGTTCCAGTCTAAATCTTACGCTGCTACCAACCCGGACTCTAACTTCTCTCCGGCTACCCTGAAATTCCTGAAAGACAACACCGGTCTGGACGGTGAACAGTGGAACAACATCATGAAACTGGTTAACAAACCGGAACAGGACGACCTGAACTGGACCAACTACTACGGTTACTGCGAAAAACTGACCGACAAACGTGGTTTCACCATCGGTATCTTCGGTGCTACCACCGGTGGTGCTAACGACACCGGTCCGGACGGTCCGGACCTGTTCAAAGAATACGACAAAGTTAAAGGTGCTACCAACCCGTCTGTTTCTGGTGCTCTGAAACGTCTGGGTATCAACGGTTCTATGTCTGGTTCTATCCTGGTTATCAAAGACTCTGACTCTGCTTTCATCAAAAAAATCAACGCTCTGCAGAACGACCCGGCTTGGCGTGAAGCTATGTGGAAAACCTTCTACAACGTTTACATCAAATACTCTGTTCAGCAGGCTAACCAGCGTGGTTTCAAAACCGCTCTGACCATCGGTTCTTTCGTTGACGCTGCTCTGAACCACGGTGCTACCGGTGACTCTAACTCTCTGCAGGGTCTGCTGAAAAAATCTGGTACCTCTACCAACGAAAAAACCTTCATGACCTCTTTCTACGCTAAACGTACCCTGATCGTTGACACCAACGACTACAACCAGGCTCCGAACGGTAAAAACCGTGTTAAACAGTGGTCTACCCTGCTGTCTCAGGGTGAAACCGACCTGAAAGGTGCTGACGCTGCTATCGTTAAAGTTACCAACTGGGAAATGCAG。

[0022] Example 4. Activity Detection of Chitosanase CsnWP and Mutant WP-E80A The chitosanase CsnWP obtained in Example 3 was tested for enzyme activity using the DNS method. The specific procedure was as follows: 350 μL of sodium phosphate buffer (50 mM, pH 8) and 100 μL of colloidal chitosan (1%) were added, followed by 50 μL of chitosanase CsnWP and the mutant WP-E80A. The mixture was incubated at 37°C for 30 min, then 300 μL of DNS reagent was added, followed by a boiling water bath for 5 min. After cooling to room temperature, the absorbance at 520 nm was measured. Enzyme activity (U) is defined as the amount of enzyme required to produce 1 μmol of reducing sugar per minute under standard conditions. The enzyme activity of wild-type chitosanase CsnWP was measured to be 75.59 U / mg, and the enzyme activity of the mutant WP-E80A was 0.91 U / mg.

[0023] Example 5: Product analysis of chitosanase CsnWP and mutant WP-E80A Chitosanase CsnWP and its mutant WP-E80A were reacted with colloidal chitosan (1%, w / v) and chitosan oligosaccharides (degree of polymerization 2–6, 10 mg / mL), respectively. After the reaction, an equal volume of ethanol was added and the mixture was centrifuged. A suitable sample was spotted onto a silica gel plate, using n-propanol-water-ammonia (8:3:1, v / v / v) as the mobile phase and aniline-diphenylamine solution as the colorimetric reagent. The results showed that the final products of the reaction between wild-type chitosanase CsnWP and chitosan were chitobiose and chitotriose. Chitotriose could be generated using chitobiose as a substrate (chitobiose:chitotriose = 5:1), indicating that chitosanase CsnWP has transglycosylation activity. Figure 1 The chitosanase mutant WP-E80A can no longer degrade chitosan, but it can continue to convert chitobiose into chitotriose at a ratio of 1.5:1, and its transglycosylation activity is more significant. Figure 2 Compared with the wild-type chitosanase CsnWP, the mutant WP-E80A showed a significant change in the product ratio, yielding more chitosan oligosaccharides with higher polymerization degree.

[0024] The above embodiments are only for illustrating the technical concept and features of the present invention and should not be construed as limiting the scope of protection of the present invention. Those skilled in the art can make various modifications or alterations to the present invention, and these equivalent forms are also covered within the scope defined by the appended claims.

Claims

1. A chitosanase mutant WP-E80A, characterized in that, The amino acid sequence of the chitosanase mutant WP-E80A is shown in SEQ ID NO:

1.

2. A recombinant plasmid, characterized in that, The recombinant plasmid carries a gene encoding the chitosanase mutant WP-E80A of claim 1, the nucleotide sequence of which is shown in SEQ ID NO.3, and the expression vector is pET-28a(+).

3. A recombinant engineered bacterial strain, characterized in that, The strain contains a gene encoding the chitosanase mutant WP-E80A as described in claim 1, and its expression host is... E. coli BL21(DE3).

4. An enzyme preparation, characterized in that, The enzyme preparation contains the chitosanase mutant WP-E80A as described in claim 1.

5. The application of the chitosanase mutant WP-E80A according to claim 1, characterized in that, The application involves using chitobiose as a substrate to prepare chitotriose using the chitosanase mutant WP-E80A described in claim 1.

Images