Bidirectional promoter of andrographis paniculata and application thereof
The bidirectional promoter P1 of Andrographis paniculata enabled the coordinated expression of multiple genes, solving the problems of gene expression imbalance and host compatibility in the synthesis of andrographolide, improving synthesis efficiency and stability, and simplifying the vector construction process.
Patent Information
- Application Number
- CN202610551802.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-24
- Publication Date
- 2026-05-29
AI Technical Summary
Existing technologies lack endogenous bidirectional promoters suitable for the synergistic expression of multiple genes of andrographolide. The construction of heterologous synthesis system vectors is complex, resulting in gene expression imbalance. Exogenous promoters have poor compatibility with the host genome, leading to unstable expression and the risk of silencing.
A bidirectional promoter P1 for Andrographis paniculata is provided, which drives the co-expression of multiple genes through a single promoter, simplifies vector construction, reduces the risk of recognition by the host defense system, achieves precise spatiotemporal regulation of genes, and improves the stability of expression vectors.
This study achieved balanced expression and synergistic regulation of key enzyme genes in the andrographolide biosynthesis pathway, increased andrographolide accumulation, simplified vector construction steps, reduced gene silencing risk, and improved expression efficiency and stability.
Smart Images

Figure CN122104710A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a bidirectional promoter of Andrographis paniculata and its applications. Background Technology
[0002] Plant endogenous bidirectional promoters are special DNA sequences that can simultaneously drive the transcription of two adjacent genes in opposite directions. Due to their unique synergistic regulatory characteristics, they have become highly efficient tools for multi-gene expression regulation in plant genetic engineering and synthetic biology. In traditional transgenic technology, while virus-derived 35S promoters possess constitutive strong expression characteristics, they have significant drawbacks: strong heterologous expression is easily recognized by the plant host's defense system, triggering gene silencing and leading to target gene expression decline; repeated use exacerbates the silencing risk, affecting transgenic efficiency; and the lack of spatiotemporally specific sustained expression increases the plant's metabolic burden, wastes resources, and may also induce toxic effects in non-target tissues, affecting crop agronomic traits and application safety. These problems are particularly prominent in the heterologous synthesis of secondary metabolites involving multiple genes.
[0003] In contrast, plant endogenous bidirectional promoters offer significant technical advantages: they naturally carry tissue-specific, developmentally dependent, or environment-inducible regulatory elements, enabling precise spatiotemporal regulation of target genes and reducing metabolic load and unexpected risks; their sequences have high conformity to the plant genome, reducing the probability of being recognized as abnormal by the host, facilitating long-term stable gene expression, and avoiding silencing problems caused by repetitive sequences; their genetic background originates from the plant itself, aligning with green and safe breeding principles and making them more easily accepted by the public and regulators; their evolutionarily formed synergistic regulatory logic can drive the coordinated expression of multiple functionally related genes through a single promoter, reducing the number of promoters used in the vector, lowering the proportion of repetitive sequences, improving the genetic stability and gene expression balance of the expression vector, and significantly optimizing the efficiency of multi-gene stacking. Therefore, screening and utilizing plant endogenous promoters has become an inevitable trend driving the development of transgenic technology towards precise regulation and synthetic biology design.
[0004] Andrographolide, the core diterpenoid active ingredient of Andrographis paniculata, a plant in the Acanthaceae family, possesses various pharmacological activities, including anti-inflammatory, antibacterial, antiviral, and antitumor effects. It also protects the liver, cardiovascular system, and nervous system, demonstrating significant medicinal and clinical value. However, the industrial production of this ingredient currently relies on natural plant extraction, which has significant limitations: the content of andrographolide in natural Andrographis paniculata plants is relatively low, and its yield and quality are easily affected by environmental and planting conditions, making it difficult to meet the growing market demand; furthermore, its biosynthesis involves multi-step oxidative modification, requiring the coordinated regulation of multiple key enzyme genes. Traditional heterologous synthesis systems require the tandem use of multiple genes and multiple promoters to construct vectors, which is not only cumbersome but also prone to gene silencing due to repetitive sequences, making it impossible to achieve balanced expression of each synthetic gene and severely limiting the efficiency of large-scale development.
[0005] In recent years, researchers have fully elucidated the biosynthetic pathway of andrographolide and successfully achieved its heterologous synthesis in systems such as Nicotiana benthamiana, laying a solid foundation for technological optimization. However, the following technical problems still urgently need to be solved in the current technology:
[0006] First, there is a lack of endogenous bidirectional promoters suitable for the co-expression of multiple genes involved in andrographolide biosynthesis. Although the theoretical advantages of endogenous bidirectional promoters in plants are widely recognized, no endogenous bidirectional promoters have been identified and cloned for the specific medicinal plant Andrographis paniculata, which can drive the co-expression of multiple key enzyme genes in the andrographolide biosynthesis pathway. This fails to meet the practical needs of heterologous andrographolide synthesis.
[0007] Second, existing heterologous synthesis systems suffer from complex vector construction and gene expression imbalance. Traditional methods require each synthetic gene to be equipped with an independent promoter, resulting in cumbersome and time-consuming vector construction steps. At the same time, the repeated use of multiple heterologous promoters can easily lead to host gene silencing, and the expression levels of each gene are difficult to coordinately regulate, resulting in an imbalance of metabolic pathways and affecting the efficiency of final product accumulation.
[0008] Third, there is a lack of regulatory elements that are highly compatible with the host genome. Exogenous promoters differ greatly from the genetic background of the host plant and are easily recognized as exogenous sequences by the host defense system, leading to unstable expression or silencing. Furthermore, the lack of tissue-specific spatiotemporal regulation increases the metabolic burden on the host and affects overall transformation efficiency and product yield.
[0009] In summary, obtaining a bidirectional promoter derived from Andrographis paniculata that can synergistically drive the efficient expression of multiple synthetic genes, and constructing a simplified multi-gene expression vector based on this promoter to achieve balanced expression and synergistic regulation of key enzyme genes in the andrographolide biosynthesis pathway, is an urgent problem to be solved in this field. Summary of the Invention
[0010] To address the aforementioned issues, this invention provides a bidirectional promoter for Andrographis paniculata containing natural regulatory elements, exhibiting high compatibility with the plant genome, enabling precise spatiotemporal gene regulation, mitigating the risk of gene silencing, and aligning with the principles of green breeding. Furthermore, it can drive multi-gene synergistic expression through a single promoter, optimizing vector stability and gene expression balance, and enhancing the efficiency of multi-gene stacking.
[0011] The specific technical solution provided by this invention is as follows: In a first aspect, the present invention provides a bidirectional promoter for Andrographis paniculata, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0012] In a second aspect, the present invention provides an expression cassette containing the aforementioned Andrographis paniculata bidirectional promoter.
[0013] In a third aspect, the present invention provides a recombinant vector containing the aforementioned Andrographis paniculata bidirectional promoter.
[0014] In a preferred embodiment of the present invention, the recombinant vector comprises the Andrographis paniculata bidirectional promoter and the target gene connected to both sides of the promoter.
[0015] More preferably, the recombinant vector is constructed using pGreenII 0800-Luc or pCambia 1300 as the vector backbone.
[0016] In a fourth aspect, the present invention provides a transgenic cell line containing the aforementioned Andrographis paniculata bidirectional promoter.
[0017] In a fifth aspect, the present invention provides a recombinant bacterium containing the aforementioned Andrographis paniculata bidirectional promoter.
[0018] More preferably, the recombinant bacteria is Agrobacterium (…). Agrobacterium spp. (or Escherichia coli).
[0019] More preferably, the recombinant bacteria is Agrobacterium tumefaciens (Gastrointestinal rust) Agrobacterium tumefaciens ) GV3101 strain.
[0020] In a sixth aspect, the present invention provides the application of the Andrographis paniculata bidirectional promoter, the expression cassette, the recombinant vector, the transgenic cell line, or the recombinant bacteria in driving the expression of a target gene in a plant, improving plant traits, cultivating transgenic plants, or cultivating new plant varieties.
[0021] In a preferred embodiment of the present invention, the plant is Andrographis paniculata or tobacco.
[0022] In a seventh aspect, the present invention provides a method for multi-gene synergistic expression, which utilizes the Andrographis paniculata bidirectional promoter to simultaneously drive the expression of two target genes.
[0023] In a preferred embodiment of the present invention, the two target genes include the cobazin pyrophosphate synthase gene. CPS2 and 3-hydroxy-3-methylglutaryl-CoA reductase gene HMGR .
[0024] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) This invention identifies and clones a bidirectional promoter P1 from the genome of Andrographis paniculata for the first time. The promoter is derived from Andrographis paniculata itself and has high sequence compatibility with the plant genome. It can effectively reduce the risk of being recognized as a foreign sequence by the host defense system, avoid gene silencing, and ensure the long-term stable expression of the target gene.
[0025] (2) The present invention has been verified by a dual-luciferase reporter system. The bidirectional promoter P1 has significant transcriptional activity in both the forward and reverse directions, and can simultaneously drive the efficient expression of two reverse-distributed target genes. Utilizing this characteristic, a single promoter can replace two independent 35S promoters in the traditional method to achieve synergistic regulation of multiple genes, simplify the vector construction process, reduce the use of repetitive sequences in the vector, and improve the genetic stability of the expression vector.
[0026] (3) The bidirectional promoter P1 provided by this invention was applied to the andrographolide biosynthesis pathway, and a CPS2-P1-HMGR dual-gene expression vector was successfully constructed. Transient transformation experiments showed that, compared with the traditional 35S1-CPS2-35S2-HMGR dual-promoter vector, the P1 bidirectional promoter driving… CPS2 and HMGR The co-expression system significantly increased the accumulation of andrographolide. This demonstrates that the bidirectional promoter of this invention can achieve balanced expression and synergistic regulation of key enzyme genes in the synthetic pathway, effectively overcoming the gene expression imbalance problem caused by traditional multi-promoter systems.
[0027] (4) Sequence alignment results show that the bidirectional promoter P1 provided by this invention is heterologous to the DNA sequences of other species (e-value < 1e-5), indicating that it has high species specificity and sequence uniqueness, providing exclusive regulatory element resources for genetic engineering research of Andrographis paniculata and its closely related species.
[0028] (5) The bidirectional promoter provided by the present invention can not only be used for the optimization of the andrographolide biosynthesis pathway, but also can be widely applied to other plant genetic engineering scenarios that require multi-gene co-expression, such as secondary metabolite synthesis, stress resistance improvement, quality improvement, etc., providing a highly efficient new regulatory tool for plant synthetic biology and precision breeding. Attached Figure Description
[0029] Figure 1 This study uses bioinformatics to mine the bidirectional promoter P1 in Andrographis paniculata. RNA-seq1, 2, and 3 represent three transcriptome datasets; ATAC-seq1, 2, and Input represent ATAC-seq data. P1 is a candidate bidirectional promoter.
[0030] Figure 2 This is an electrophoresis diagram of P1 promoter amplification. 1: P1 promoter forward orientation; 2: P1 promoter reverse orientation.
[0031] Figure 3This is a dual-luciferase assay to verify P1 promoter activity. (A) Schematic diagram showing the DNA fragment of the structural gene promoter ligated to the luciferase reporter gene vector. (B) Phenotypic diagram of the dual-luciferase assay. 35S: CaMV 35S promoter, Rluc: Renilla Luciferase, Luc: Firefly Luciferase, P(A): CaMV poly(A) signal, P1-F: P1 promoter forward, P1-R: P1 promoter reverse.
[0032] Figure 4 The transient transformation of Andrographis paniculata by 35S1-CPS2-35S2-HMGR and CPS2-P1-HMGR increased the andrographolide content. (A) Schematic diagram of the structural genes. (B) Andrographolide content after transient transformation of Andrographis paniculata. 35S: CaMV35S promoter. ***, P<0.001. Detailed Implementation
[0033] To further illustrate the technical means and effects of this invention, the following description, in conjunction with embodiments and accompanying drawings, provides a further explanation of the invention. It is understood that the specific embodiments described herein are merely illustrative of the invention and not intended to limit it.
[0034] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.
[0035] The *Andrographis paniculata* and tobacco involved in this invention were collected from the Plant Resource Nursery of Lushan Botanical Garden, Chinese Academy of Sciences (No. 9, Zhiqing Road, Jiujiang City, Jiangxi Province).
[0036] The nucleotide sequence of the 35S promoter involved in this invention is shown in SEQ ID NO.20: TGAGACTTTTCAACAAAGGGTAATTTCGGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCATCGAAAGGACAGTAGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCATTCAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGACATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTCATTTCATTTGGAGAGGACA CPS2 The nucleotide sequence of, as shown in SEQ ID NO.21: HMGR The nucleotide sequence is shown in SEQ ID NO.22: This invention discloses a plant endogenous bidirectional promoter that can simultaneously drive the expression of two genes, promoting synergistic gene expression and improving expression efficiency. It also replaces the traditional vector construction process that uses two 35S promoters (35S1 and 35S2) to drive two genes, reducing vector construction steps and operational time. The specific implementation scheme is as follows:
[0037] 1. Data Analysis The Andrographis paniculata transcriptome data used in this invention are from doi: 10.1016 / j.apsb.2024.06.012. The specific processing procedure is as follows: The raw transcriptome data was quality controlled using TrimGalore software (https: / / github.com / FelixKrueger / TrimGalore, version 0.6.10) to remove adapter sequences and low-quality reads. The filtered reads were then aligned to the Andrographis paniculata reference genome (https: / / doi.org / 10.1111 / tpj.14162) using HISAT2 (version 2.2.1). The gene expression levels of the mapped transcriptome data were quantitatively analyzed using Cuffnorm software (version 2.2.1, http: / / cole-trapnell-lab.github.io / cufflinks / cuffnorm). The final value was expressed as Fragments Per Kilobaseof transcript per Million mapped reads (FPKM).
[0038] 2. Data processing of ATAC-seq The raw ATAC-seq data were quality filtered using the TrimGalore tool, and then aligned to the lentil genome using Bowtie2 software with the parameter set to "-X 1000". Subsequent data processing included sorting, indexing, filtering (with filtering parameters set to -F 4 -q 30), and statistical analysis using Samtools software. Using Tn5-treated lentil genomic DNA as an input control, chromatin peak calling was performed using MACS3 software with the parameters set to "-nomodel -shift 100 -extsize 200". Reproducible peaks identified between two biological replicate samples were defined as accessible chromatin regions (ACRs). The HOMER software (official website: http: / / homer.ucsd.edu / homer) was used to annotate the ACRs mentioned above; the ATAC-seq signals were visualized using Deeptools software (official website: http: / / deeptools.ie-freiburg.mpg.de) and IGV software (official website: https: / / igv.org / ).
[0039] 3. Identification of bidirectional promoters Genome sequencing analysis of Andrographis paniculata genes was performed, first identifying two adjacent, reverse-distributed genes (gene start positions not exceeding 1000 bp). These two adjacent genes were then ranked according to their expression levels, and candidates for bidirectional promoters were selected based on the similar expression ratios of the adjacent genes. Furthermore, these bidirectional promoters also exhibited ATAC-seq signal coverage.
[0040] like Figure 1 As shown, the candidate bidirectional promoter P1 in the Andrographis paniculata genome has the sequence shown in SEQ ID NO.1: CAAGATGGAATTCTTGGCTGGATATTTGCAGCCCTTCCTTTCCTTCCAATCACGTCACCATTACTCCCCCCACCCACCCGCTTCTGAAAGTAACCATACAAACCGCGAAATAAACCCTGATCGGATGGAAGTAATTGGAACAATAAATAATCGGTCGTGCGG CGCAGTGCAGTTCAGTTCTCAATTTACTGAACACACATCTAACGACACCGTATGGTCCAACTTTTTGTTTCCCTATGGGAGAGCCCGATTGACCTATGGGCTGGACGGACAACTGAATAATAGCTGTTTGGGTCAAAGACCAATAAAGCCTCATAAGCCCAT TTCGATACAGGCCTGCTGCAACGATACTCAAGCTGAAGGTTGTGGAATAGTTTGATAGTACGACGCCGCTTCTGCTAATTTCTTTTCAATTTTTAATTTAGCAAGTGAAGCAGAAAGGAGTCAAAAAATAAATAGTGCGTGCGTTGGTTCACAAAAATGAA ATGAAATGTAATTTAACCTCAAAAGATTTTTCCATGTGATGTAATAATGTAACGCCCAAAATTTCAAGGGATTAGCAATTAATCAATTATATGTGTGTATATATAATTAATAAGTTGGCCTTGGCAGTAGTAACCCGCGCCGACTGACTGAGTCACTGTGTG 4. Sequence alignment The P1 sequence was compared with NCBI, and with e-value < 1e-5 as the threshold, it was not from the same source as the DNA sequences of other species, indicating that P1 is unique.
[0041] 5. Cloning and functional verification of the P1 bidirectional promoter Primer design: P1 forward-F: 5'-CTATAGGGCGAATTGGGTACCCAAGATGGAATTCTGGCTGGAT-3', SEQ IDNO.2; P1 forward-R: 5'-TCGAGGGGGGGGCCCGGTACCCACACAGTGACTCAGTCAGTCG-3', SEQ IDNO.3; P1 reverse-F: 5'-TATAGGGCGAATTGGGTACCCACACAGTGACTCAGTCAGTC-3', SEQ ID NO.4; P1 Reverse-R: 5'-TCGAGGGGGGGGCCCGGTACCCAAGATGGAATTCTGGCTGGATATTTGC-3', SEQ ID NO. 5.
[0042] (1) Using Andrographis paniculata genomic DNA as a template, the target fragment was amplified using PrimeSTAR® Max DNA Polymerase (TaKaRa, R047A). The PCR reaction system (50µL) contained: 25µL PrimeSTAR Max Ver.2 Premix (2X), 2µL forward primer, 2µL reverse primer, 1µL DNA template and 20µL ddH2O.
[0043] (2) The PCR program was: 98°C pre-denaturation for 30s; 98°C denaturation for 10s, 60°C annealing for 15s, 72°C extension for 15s; a total of 35 cycles were performed, and finally 72°C extension for 10min.
[0044] (3) After the PCR products were verified by gel electrophoresis, they were purified using an agarose gel DNA recovery kit (Daling Biotechnology, DLN801).
[0045] (4) Combine the purified fragment with the... Kpn I. Linearized pGreenII 0800-Luc vector (purchased from Novopro Biotechnology, https: / / www.novopro.cn / vector / Vgiydgni, V010545) was ligated using a single enzyme digestion method (New England Biolabs, R3142). The digestion system (50µL) consisted of 2µg vector, 5µL 10× rCutSmart Buffer, 1µL KpnI, and ddH2O to make up the volume. The mixture was reacted at 37°C for 3 hours, followed by purification.
[0046] (5) The ligation reaction was performed according to the Clone ExpressII® One Step Cloning Kit (Vazyme, C112), and incubated at 37°C for 30 min. The ligation product was transformed into Escherichia coli DH5α competent cells. Positive clones were screened by kanamycin and identified by colony PCR, and sent to Shanghai Sangon Biotech Co., Ltd. for Sanger sequencing. The recombinant vectors with correct sequencing results were named P1-F-pGreenII 0800-Luc and P1-R-pGreenII 0800-Luc, respectively.
[0047] 6. Bidirectional promoter activity verification experiment (dual luciferase reporter assay) (1) The recombinant vectors P1-F-pGreenII 0800-Luc, P1-R-pGreenII 0800-Luc and empty vector containing the promoters of each structural gene were successfully constructed and transformed into GV3101 (pSoup) Agrobacterium competent cells.
[0048] (2) After adjusting the concentration of Agrobacterium tumefaciens containing promoter fragments with resuspension buffer (10mM MES, 10mM MgCl2, 200μM acetylsyl syringone), the Agrobacterium tumefaciens solution was injected into tobacco leaves using a syringe.
[0049] (3) The tobacco plants were first cultured in the dark for 24 hours, and then transferred to normal light conditions for 48 hours.
[0050] (4) The luciferase substrate (GLPBIO, LUCK-100) was evenly sprayed onto the leaf surface of the injection site and left to stand in the dark for 10 hours. Finally, the chemiluminescence signal was collected and analyzed using a plant in vivo imaging system (Tano 5200, Tianneng Technology Co., Ltd., Shanghai, China).
[0051] 7. Construction of CPS2-P1-HMGR vector: Primer design: P1-LP: 5'-CGGTACCCGGGGATCCCAAGATGGAATTCTGGCTGGATATTTGC-3', SEQ IDNO.6; P1-RP: 5'-GCAGGTCGACTCTAGACACACAGTGACTCAGTCAGTCG-3', SEQ ID NO.7; HMGR-CDS-LP: 5'-TGTGTCTAGAGTCGACATGAAATCCATGGACGTTACCGAT-3', SEQ IDNO.8; HMGR-CDS-RP: 5'-GGCCAGTGCCAAGCTTCTAGGAGGAGCAAATATTCGCCACA-3', SEQ IDNO.9; CPS2-CDS-LP: 5'-CCATGATTACGAATTCTCACAGCACTTTTTCGAACAGTACCT-3', SEQ IDNO.10; CPS2-CDS-RP: 5'-TCTTGGGATCCCCGGGTACCATGAAGCTTTGGGAACAGATTGTGG-3', SEQ ID NO. 11.
[0052] (1) Using the constructed P1-F-pGreenII 0800-Luc plasmid as a template, the target fragment was amplified using PrimeSTAR® MaxDNA Polymerase (TaKaRa, R047A). The PCR reaction system (50µL) contained: 25µL PrimeSTAR Max Ver.2 Premix (2X), 2µL P1-LP forward primer, 2µL P1-RP reverse primer, 1µL DNA template, and 20µL ddH2O.
[0053] (2) The PCR program was: 98°C pre-denaturation for 30s; 98°C denaturation for 10s, 60°C annealing for 15s, 72°C extension for 15s; a total of 35 cycles were performed, and finally 72°C extension for 10min.
[0054] (3) After the PCR products were verified by gel electrophoresis, they were purified using an agarose gel DNA recovery kit (Daling Biotechnology, DLN801).
[0055] (4) Combine the purified fragment with the... BamH I and Xba I ligated the linearized pCambia 1300 vector (purchased from Novopro Biolabs, https: / / www.novopro.cn / vector / Vgm4dcni, V008765) by double digestion with enzymes (New England Biolabs, R3136S, R0145S). The digestion system (50µL) consisted of 2µg vector, 5µL 10× rCutSmart Buffer, and 1µL... BamH I, 1µL Xba Add I and ddH2O to make up the volume. React at 37°C for 3 hours, then purify.
[0056] (5) The ligation reaction was performed according to the Clone ExpressII® One Step Cloning Kit (Vazyme, C112), and incubated at 37°C for 30 min. The ligation product was transformed into E. coli DH5α competent cells. Positive clones were screened by kanamycin and identified by colony PCR, and sent to Shanghai Sangon Biotech Co., Ltd. for Sanger sequencing. The recombinant vectors with correct sequencing results were named P1-pCambia 1300.
[0057] (6) Using the Andrographis paniculata cDNA plasmid as a template, the target fragment was amplified using primers HMGR-CDS-LP and HMGR-CDS-RP according to the above PCR reaction system and program. After product purification, it was combined with... Sal I and HindI II. The linearized P1-pCambia1300 vector was ligated by double enzyme digestion. The ligation system was the same as (4). The ligation product was transformed, positive clones were identified and sequenced for verification. The correct recombinant vector was named P1-HMGR-pCambia 1300.
[0058] (7) The target fragment was amplified again using the Andrographis paniculata cDNA plasmid as a template. The primers were CPS2-CDS-LP and CPS2-CDS-RP. The PCR reaction system and procedure were the same as in (1) and (2). After purification, the product was... EcoR I and Kpn The linearized P1-HMGR-pCambia 1300 vector was ligated by double enzyme digestion. The ligation product was transformed, positive clones were identified, and sequencing was performed to verify that the correct recombinant vector was named CPS2-P1-HMGR.
[0059] 8. Construction of the 35S1-CPS2-35S2-HMGR vector: Primer design: 35Spro-p1300-LP1: 5'-CCATGATTACgaattcTGAGACTTTTCAACAAAGGGTAATTTCGGG-3', SEQ ID NO. 12; 35Spro-p1300-RP1: 5'-GATCCCCGGGTACCgagctcTGTCCTCTCCAAATGAAATGACTTCCT-3', SEQ ID NO. 13; 35Spro-p1300-LP2: 5'-CCTCTAGAGTCGACctgcagTGAGACTTTTCAACAAAGGGTAATTTCGGGA-3', SEQ ID NO. 14; 35Spro-p1300-RP2: 5'-CCAAGCTTGCATGCctgcagTGTCCTCTCCAAATGAAATGACTTCCTTATATAGAGG-3', SEQ ID NO. 15; HMGR-p1300-LP: 5'-GCAGGCATGCaagcttATGAAATCCATGGACGTTACCGATAAAGAG-3', SEQ ID NO. 16; HMGR-p1300-RP: 5'-GGCCAGTGCCaagcttCTAGGAGGAGCAAATATTCGCCACA-3', SEQ IDNO.17; CPS2-p1300-LP: 5'-AGAGGGACAGAGCTCggtaccATGAAGCTTTGGGAACAGATTGTGG-3', SEQ ID NO.18; CPS2-p1300-RP: 5'-CTAGAGGATCCCGggtaccTCACAGCACTTTTTCGAACAGTACCT-3', SEQ ID NO. 19.
[0060] (1) Using pGreenII 0800-Luc plasmid as a template, the target fragment was amplified using PrimeSTAR® Max DNA Polymerase (TaKaRa, R047A). The PCR reaction system (50 µL) contained: 25 µL PrimeSTAR MaxVer.2 Premix (2X), 2 µL 35Spro-p1300-LP1 forward primer, 2 µL 35Spro-p1300-RP1 reverse primer, 1 µL DNA template, and 20 µL ddH2O.
[0061] (2) The PCR program was as follows: 98℃ pre-denaturation for 30s; 98℃ denaturation for 10s, 60℃ annealing for 15s, 72℃ extension for 15s; a total of 35 cycles were performed, and finally 72℃ extension for 10min.
[0062] (3) After the PCR products were verified by gel electrophoresis, they were purified using an agarose gel DNA recovery kit (Daling Biotechnology, DLN801).
[0063] (4) Combine the purified fragment with the... EcoR I and Sac I (New England Biolabs, R3101S, R3156S) double-digested linearized pCambia1300 vector ligation. Digestion system (50µL): 2µg vector, 5µL 10× rCutSmartBuffer, 1µL EcoR I, 1µL Sac Add I and ddH2O to make up the volume. React at 37℃ for 3 hours, then purify.
[0064] (5) The ligation reaction was performed according to the Clone ExpressII® One Step Cloning Kit (Vazyme, C112), and incubated at 37 ℃ for 30 min. The ligation product was transformed into Escherichia coli DH5α competent cells. Positive clones were screened by kanamycin and identified by colony PCR, and sent to Shanghai Sangon Biotech Co., Ltd. for Sanger sequencing. The recombinant vector with correct sequencing was named 35S1-pCambia 1300.
[0065] (6) Using pGreenII 0800-Luc plasmid as a template, and employing the same PCR reaction system and procedure as described above, the primers were replaced with 35Spro-p1300-LP2 forward primer and 35Spro-p1300-RP2 reverse primer for PCR amplification. The recovered product was then compared with... Pst The 35S1-pCambia1300 vector, digested with enzyme I, was ligated using the same reaction system as described above. After ligation, the ligation product was transformed, positive clones were identified, and sequencing was performed for verification. After correct sequencing, the recombinant plasmid was named 35S1-35S2-pCambia 1300.
[0066] (7) Using Andrographis paniculata cDNA as a template, HMGR-p1300-LP forward primers and HMGR-p1300-RP reverse primers were used. HMGR The target fragment was amplified using the same PCR system and procedure as described above. After product recovery, it was combined with... HindI The 35S1-pCambia1300 vector, digested with enzyme II, was ligated using the same ligation reaction system as above. After ligation, the ligation product was transformed, positive clones were identified, and sequencing was performed for verification. After correct sequencing, the recombinant plasmid was named 35S1-35S2-HMGR-pCambia 1300.
[0067] (8) Using Andrographis paniculata cDNA as a template, and employing the CPS2-p1300-LP forward primer and the CPS2-p1300-RP reverse primer, the following steps were performed: CPS2 The target fragment was amplified by PCR, using the same PCR reaction system and procedure as described above. After product recovery, it was combined with... Kpn The 35S1-35S2-HMGR-pCambia 1300 vector, digested with a single enzyme, was ligated using the same reaction system as above. After ligation, the ligation product was transformed, positive clones were identified, and sequencing was performed for verification. After correct sequencing, the recombinant plasmid was named 35S1-CPS2-35S2-HMGR.
[0068] 9. Andrographis paniculata transforms instantly (1) The above-constructed 35S1-CPS2-35S2-HMGR and CPS2-P1-HMGR were transformed into GV3101 (pSoup) Agrobacterium competent cells, respectively.
[0069] (2) The Agrobacterium bacterial culture containing the promoter fragment and the empty vector were adjusted to OD using resuspension buffer (10 mM MES, 10 mM MgCl2, 200 μM acetylsylgenone). 600 = 0.5 and pour into a beaker. Place the beaker in a vacuum pump and put the whole Andrographis paniculata seedlings of appropriate age into the resuspension solution. 0.6 kPa, 3 min.
[0070] (3) Afterwards, the infected Andrographis paniculata seedlings were rinsed with clean water and then transferred to moist soil. They were cultured under light for ten days, during which time the soil was kept moist. Then the whole plant material was collected to prepare for measuring the Andrographolide content.
[0071] 10. High Performance Liquid Chromatography (HPLC) Preparation of reference solution: Take an appropriate amount of andrographolide reference standard, accurately weigh it, and add 50% methanol to prepare a solution containing 1 mg per mL.
[0072] Preparation of test solution: The *Andrographis paniculata* sample was dried in a 60°C oven, ground into powder, and 0.04 g of the sample was dissolved in 1.5 mL of 50% methanol. The solution was sonicated (250 W, 40 kHz) for 40 min, then centrifuged at 5000 rpm for 8 min. The supernatant was collected. All sample solutions were filtered through a 0.22 μm nylon membrane and then injected into the HPLC system.
[0073] HPLC chromatographic conditions: Agilent Zorbax SB-C18 column (4.6 × 150 mm; 5 μm); mobile phase: acetonitrile (A) - water (B) gradient elution (0–8 min, 21%–25% A; 8–14 min, 25%–27% A; 14–20 min, 27%–55% A; 20–25 min, 55%–85% A; 25–30 min, 85% A); flow rate: 1 mL·min⁻¹; column temperature: 25 ℃; detection wavelength: 205 nm; injection volume: 5 μL.
[0074] 11. Results This invention integrates RNA-seq and ATAC-seq technologies to systematically validate the function of the P1 region located between the CXN00003640 and CXN00003639 genes in the Andrographis paniculata genome. RNA-seq results show ( Figure 1Under experimental conditions, the coding regions of both CXN00003640 and CXN00003639 showed clear and reproducible transcription peaks, indicating that both genes were in an active transcriptional state. ATAC-seq results further confirmed the presence of significantly enriched open chromatin signals in the P1 region between the two genes, with signal intensity significantly higher than the ATAC-Input control, indicating high chromatin accessibility in this region. The open chromatin signal peaks in the P1 region precisely coincided with the transcription start sites of CXN00003640 and CXN00003639, and the active transcriptional state of the genes on both sides was also supported by RNA-seq data. In summary, the P1 region was identified as a biologically functional endogenous bidirectional promoter capable of simultaneously driving the co-expression of its adjacent, oppositely distributed genes.
[0075] To verify the correctness of the P1 promoter cloning, this invention performed PCR amplification and electrophoresis detection on the P1 promoter fragment. Using plant genomic DNA as a template, specific primers were used to perform bidirectional PCR amplification of the P1 promoter, obtaining both forward and reverse amplification products, which were then separated and identified by 1% agarose gel electrophoresis. The electrophoresis results showed ( Figure 2 Both the forward and reverse amplification products of P1 exhibited clear, single target bands, with sizes consistent with the expected length of the P1 promoter fragment, and no obvious extraneous bands or nonspecific amplification. These results demonstrate that the P1 promoter fragment has been successfully cloned in this invention, and the specificity and integrity of the amplification products meet the requirements for subsequent experiments, making them suitable for subsequent vector construction and functional verification.
[0076] This invention utilizes a dual-luciferase reporter system combined with a transient expression system in tobacco leaves to functionally validate the bidirectional transcriptional activity of the P1 promoter. An empty vector control and two effector vectors were constructed: the empty vector Luc reporter gene lacked the target promoter element. The effector vectors, with the forward fragments of the P1 promoter (P1-F) and (P1-R) inserted before the Luc reporter gene, were constructed as expression detection vectors. The expression of the Renilla luciferase gene (Rluc) driven by the 35S promoter served as an internal control. The empty vector, along with the P1-F and P1-R effector vectors, were transformed into tobacco leaves. Fluorescence imaging results showed (…). Figure 3 Significant firefly fluorescence signals were observed in tobacco leaf regions transfected with both the P1-F and P1-R effector vectors. These results confirm that the P1 promoter fragments (including both forward and reverse) possess independent transcriptional initiation activity and can drive the expression of downstream reporter genes in plants.
[0077] This invention demonstrates the effect of promoters on andrographolide biosynthesis by constructing two different plant expression vectors. The control vector (35S1-CPS2-35S2-HMGR) is driven by a dual 35S promoter (35S1 and 35S2). CPS2 and HMGR Gene expression. The test vector (CPS2-P1-HMGR) uses the P1 bidirectional promoter to simultaneously drive gene expression. CPS2 and HMGR Gene expression. After transforming the two plasmids into Andrographis paniculata, the andrographolide (AD) content was detected. The results showed ( Figure 4 Compared with the control vector, the AD content in plants transformed with the CPS2-P1-HMGR vector was significantly increased. These results indicate that endogenous bidirectional promoters in plants can more effectively regulate AD synergistically. CPS2 and HMGR The expression of this promoter significantly improves the biosynthetic efficiency of andrographolide in plants. This promoter and expression strategy possess significant technical advantages and promising application prospects in increasing the content of active ingredients in medicinal plants.
[0078] The present invention has been illustrated with the above embodiments to explain the detailed method of the present invention. However, the present invention is not limited to the detailed method described above, that is, it does not mean that the present invention must rely on the detailed method described above to be implemented. Those skilled in the art should understand that any improvements to the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.
Claims
1. A bidirectional promoter for Andrographis paniculata, characterized in that, The nucleotide sequence of the promoter is shown in SEQ ID NO.
1.
2. An expression cassette containing the Andrographis paniculata bidirectional promoter as described in claim 1.
3. A recombinant vector containing the Andrographis paniculata bidirectional promoter as described in claim 1.
4. The recombinant vector according to claim 3, characterized in that, The recombinant vector contains the Andrographis paniculata bidirectional promoter and the target genes respectively connected to both sides of the promoter.
5. A transgenic cell line containing the Andrographis paniculata bidirectional promoter as described in claim 1.
6. Recombinant bacteria containing the Andrographis paniculata bidirectional promoter as described in claim 1.
7. The use of the Andrographis paniculata bidirectional promoter of claim 1, the expression cassette of claim 2, the recombinant vector of claim 3, the transgenic cell line of claim 5, or the recombinant bacteria of claim 6 in driving the target gene in any of the following (1) to (3): (1) Expression or modification of plant traits within the plant; (2) Cultivating transgenic plants; (3) Application in the cultivation of new plant varieties.
8. The application according to claim 7, characterized in that: The plant in question is either Andrographis paniculata or tobacco.
9. A method for multi-gene synergistic expression, characterized in that, The expression of two target genes can be simultaneously driven using the Andrographis paniculata bidirectional promoter as described in claim 1.
10. The method according to claim 9, characterized in that, The two target genes include the cobazin pyrophosphate synthase gene. CPS2 and 3-hydroxy-3-methylglutaryl-CoA reductase gene HMGR .