A fusion gene resistant to glufosinate-ammonium and 2,4-d type herbicides, an expression vector and application thereof
By functionally fusing the aryloxyalkyl ester dioxygenase gene and the glufosinate acetyltransferase gene, a fusion gene was constructed and introduced into the plant genome. This solved the problems of single function and growth inhibition caused by high expression of existing herbicide-resistant genes, achieving dual resistance to glufosinate and 2,4-D herbicides, and improving crop resistance and safety.
Patent Information
- Application Number
- CN202610398670.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-30
- Publication Date
- 2026-05-29
AI Technical Summary
Existing herbicide-resistant genes have single functions, insufficient resistance levels, or high expression that inhibits plant growth, making it difficult to effectively resist both glufosinate and 2,4-D herbicides simultaneously. Furthermore, multi-gene transformation faces problems such as inconsistent expression efficiency and poor genetic stability.
The aryloxyalkyl ester dioxygenase gene and the glufosinate acetyltransferase gene were functionally fused to construct a fusion gene, which was then inserted into the pCambia1300 vector. The gene was then introduced into the plant genome through Agrobacterium-mediated genetic transformation to achieve dual resistance.
It significantly improved resistance levels to glufosinate and 2,4-D herbicides, reduced the inhibition rate of plant growth caused by high expression, broadened the range of herbicides to be selected in the field, and improved crop safety and profitability.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
(I) Technical Field
[0001] This invention relates to a fusion gene, expression vector, and application of a herbicide that is simultaneously resistant to glufosinate and 2,4-D class herbicides. (II) Background Technology
[0002] With the continued growth in global agricultural demand for weed control, herbicide-tolerant genetically modified crops have become one of the core technologies for ensuring food security and improving production efficiency. Glufosinate and 2,4-D herbicides are currently the two most widely used classes of herbicides, achieving broad-spectrum weed control by inhibiting glutamine synthase and mimicking auxin signaling, respectively. However, long-term single-use has led to the rapid evolution of weed resistance, urgently requiring the development of new genetic resources with multiple resistances and superior safety.
[0003] The sdpA2 gene encodes 2,4-dichlorophenoxyacetic acid monooxygenase, which can degrade 2,4-D herbicides through hydroxylation and is a key gene for breeding 2,4-D-resistant crops (Lee et al., 2020, Plant Biotechnology Journal). However, heterologous high expression of this gene in plants is often accompanied by abnormal growth and development, such as reduced plant height and leaf wrinkling. The mechanism may be related to the overexpression of the protein interfering with the metabolism of endogenous auxin in plants (Zhang et al., 2019, Journal of Experimental Botany).
[0004] The pat gene, derived from Streptomyces viridochromogenes, encodes a glufosinate acetyltransferase that can inactivate glufosinate through acetylation modification, making it a core component of commercially available glufosinate-tolerant crops (Thompson et al., 1987, EMBO Journal). However, the resistance level of a single pat gene is easily affected by environmental stress and cannot cope with outbreaks of 2,4-D-resistant weeds, limiting its application in complex field scenarios.
[0005] In recent years, the creation of multifunctional proteins through gene fusion technology has become a research hotspot in agricultural biotechnology. However, the functional performance of fused genes is highly unpredictable. After fusion, the coding regions of different genes may experience problems such as protein folding errors, steric hindrance of domains, or loss of catalytic activity. Their resistance profile and expression stability cannot be directly predicted through theoretical derivation and must be verified through systematic molecular biology and field trials (Chen et al., 2021, Nature Communications). Existing research has not reported any functional fusion of the sdpA2 and pat genes, and there is a lack of systematic evaluation of the synergistic effects of this fused gene on crop resistance and growth safety.
[0006] Although previous studies have attempted to express different resistance genes in a fusion manner, multi-gene transformation often faces problems such as inconsistent expression efficiency and poor genetic stability (Gao et al., 2022, Plant Cell Reports). Therefore, developing a fusion gene that can achieve dual high-efficiency resistance through a single transformation with less impact on plant growth has become a key scientific problem that urgently needs to be solved in the field of herbicide-tolerant crop breeding. (III) Summary of the Invention
[0007] The purpose of this invention is to provide a fusion gene, expression vector, and application that simultaneously tolerates glufosinate and 2,4-D herbicides, thereby overcoming the technical shortcomings of existing herbicide-resistant genes that have single functions, insufficient resistance levels, or high expression that inhibits plant growth, thus providing crops with a more flexible and safe weed control solution.
[0008] The technical solution adopted in this invention is:
[0009] In a first aspect, the present invention provides a fusion gene that is simultaneously resistant to glufosinate and 2,4-D class herbicides, the fusion gene comprising an aryloxyalkyl ester dioxygenase gene and a glufosinate acetyltransferase gene.
[0010] Furthermore, the fusion gene is composed of an aryloxyalkyl ester dioxygenase gene, a linker peptide, and a glufosinate acetyltransferase gene, which are functionally linked from the 5' end to the 3' end.
[0011] Furthermore, the amino acid sequence of the aryloxyalkyl ester dioxygenase gene is shown in SEQ ID NO.1 or SEQ ID NO.2, the amino acid sequence of the glufosinate acetyltransferase gene is shown in SEQ ID NO.3 or SEQ ID NO.4, and the nucleotide sequence of the linker peptide is shown in SEQ ID NO.8.
[0012] Furthermore, the nucleotide sequence of the fusion gene is shown in SEQ ID NO.5.
[0013] Secondly, the present invention provides a fusion protein encoded by the fusion gene, wherein the fusion protein is functionally linked by an aryloxyalkylene dioxygenase, a linker peptide, and a glufosinate acetyltransferase. The amino acid sequence of the linker peptide is shown in SEQ ID NO.7.
[0014] Furthermore, the amino acid sequence of the fusion protein is shown in SEQ ID NO.6.
[0015] Thirdly, the present invention provides an expression vector for the fusion gene, wherein the expression vector is constructed by inserting the fusion gene expression frame into the pCambia1300 vector, wherein the fusion gene expression frame is functionally linked from the 5' end to the 3' end by a pCmYLCV promoter derived from the yellow leaf curl virus of *Cymbidium faberi*, an aryloxyalkylene dioxygenase gene, a linker peptide, a glufosinate acetyltransferase gene, and a T35S terminator; the nucleotide sequence of the pCmYLCV promoter is shown in SEQ ID NO. 9; the nucleotide sequence of the T35S terminator is shown in 2449-2633 bp in pCambia1300 (NCBI sequence number: GI:7638066).
[0016] Fourthly, the present invention provides the application of the fusion gene in the cultivation of transgenic plants that are simultaneously tolerant to glufosinate and 2,4-D herbicides.
[0017] Furthermore, the application involves transferring the expression vector constructed from the fusion gene into the plant genome via Agrobacterium-mediated genetic transformation to obtain transgenic plants that are simultaneously tolerant to glufosinate and 2,4-D herbicides.
[0018] Furthermore, the plant includes soybeans or rapeseed.
[0019] Fifthly, the present invention provides a method for breeding transgenic plants that are simultaneously tolerant to glufosinate and 2,4-D herbicides, the method comprising the following steps:
[0020] (1) The expression vector of the fusion gene was introduced into the target plant to obtain transgenic plants that are tolerant to both glufosinate and 2,4-D herbicides;
[0021] (2) Screening transgenic plants from the transgenic plants of step (1) that are simultaneously tolerant to glufosinate and 2,4-D herbicides.
[0022] Compared with existing technologies, the beneficial effects of this invention are mainly reflected in the following aspects: The core innovation of this invention lies in the first functional fusion of the aryloxyalkylanoate dioxygenase gene and the glufosinate acetyltransferase gene to construct a novel herbicide-resistant fusion gene. This gene can not only simultaneously confer dual resistance to glufosinate and 2,4-D herbicides on plants, but also increase the resistance level by 8%-10% compared with single gene expression, and reduce the inhibition rate of plant growth by about 15% under high expression conditions, significantly broadening the range of herbicides to be selected in the field and improving the safety and profitability of crop planting. (iv) Description of the attached drawings
[0023] Figure 1Schematic diagram of T-DNA vector structure; PLG, GLP, and GP are expression vectors for the pat and EGFP genes; PLG is a 5'pat-linker-EGFP' vector, GLP is a 5' EGFP-linker-pat' vector, and GP is an EGFP expression cassette + pat expression cassette vector. PLD, DLP, and DP are expression vectors for the pat and sdpA genes; PLD is a 5'pat-linker-sdpA3' vector, DLP is a 5'sdpA-linker-pat' vector, and DP is an sdpA expression cassette + pat expression cassette vector. RB is the right boundary of the T-DNA, and LB is the left boundary of the T-DNA. pCmYLCV is the promoter, and P35S is the promoter. Tnos and T35S are terminators.
[0024] Figure 2 Photos of soybeans after herbicide application; CK is the non-transgenic control, DLP is the fusion gene overexpression transformant, and DP is the independently expressed transformant.
[0025] Figure 3 Photos of soybean agronomic traits survey; DLP is a transformation transgenic gene overexpression, and DP is a transformation transgenic gene expressing the gene independently. (V) Detailed Implementation Methods
[0026] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:
[0027] The molecular biology and biochemical methods used in the following embodiments of the present invention are all known techniques. They are described in detail in references such as *Current Protocols in Molecular Biology*, written by Ausubel and published by John Wiley and Sons, and *Molecular Cloning: A Labortory Manual*, 3rd ed., written by J. Sambrook et al., published by Cold Spring Harbor Laboratory Press (2001).
[0028] In the embodiments of this invention, the method of homologous recombination is Uniclone One Step SeamlessCloning Kit, SC612, Jinsha Biotechnology.
[0029] Example 1: Construction of the transformation vector
[0030] Glufosinate-tolerant genes are crucial screening markers and functional targets. To broaden their applications and functions, we aim to fuse glufosinate-tolerant genes with green fluorescent protein (GFP), resulting in a fusion gene that simultaneously possesses glufosinate tolerance and color-coding capabilities. Furthermore, we hope to fuse glufosinate-tolerant genes with genes resistant to 2,4-D herbicides, enabling the fusion gene to tolerate both glufosinate and 2,4-D herbicides. (Reference) Figure 1 Construct various transformation carriers.
[0031] To construct the test vector, a fusion gene expression cassette pCmYLCV-sdpA-pat, composed of the synthetically produced (Kangwei Century Company) 2,4-D herbicide resistance gene sdpA, a linker peptide, and the glufosinate resistance acetyltransferase gene pat, was used. This cassette includes a 5' pCmYLCV promoter (nucleotide sequence shown in SEQ ID NO. 9) derived from the yellow leaf curl virus of *Cymbidium faberi*, used to mediate the expression of the fusion gene. The nucleotide sequence of the fusion gene is shown in SEQ ID NO: 5 (1-876 bp represents sdpA, 877-888 represents the linker, and 889-1434 bp represents pat), and the amino acid sequence is shown in SEQ ID NO: 6. An artificially synthesized EGFP gene expression cassette contains the P35S promoter that mediates EGFP gene expression, the EGFP gene, and the TNOS terminator. The nucleotide sequence is shown in SEQ ID NO:10 (1-880 bp represents the P35S promoter, 881-1621 bp represents EGFP, and 1625-1893 bp represents the TNOS terminator).
[0032] 1. Construction of PLG carrier
[0033] To construct a binary vector for plant genetic transformation, a pCmYLCV-sdpA-pat fragment of approximately 1.0 kb was amplified by PCR using primers PLGF1 (5' GTAAAACGACGGCCAGTGCCAAGCTTTTACTGGCAGACAAAGTGGC) and PLGR1 (5' CACGGCAGCGGCTGCGATCTGGGTCACCGGGCGCAC) as a template. Using a plasmid containing a synthetic EGFP gene expression frame as a template, primers PLGF2 (5' CAGATC...) were also used... GCAGCCGCTGCCGTGAGCAAGGGCGAGGAGC (underlined to represent the linker peptide) and PLGR2 (5'CACACATTATTATGGAGAAATTATCACTTGTACAGCTCGTCCATGCCG) were amplified by PCR to obtain an EGFP gene fragment of approximately 0.8 kb containing the linker peptide. The two PCR products and the pCambia1300 vector digested with restriction endonucleases HindIII and XhoI were ligated using homologous recombination to obtain the vector 1300-PAT-EGFP-T35S, abbreviated as PLG, containing the fusion protein PAT-EGFP.
[0034] 2. Construction of GLP vectors
[0035] Using the synthetic pCmYLCV-sdpA-pat plasmid DNA as a template, primers GLPF1 (5' GTAAAACGACGGCCAGTGCCAAGCTTTTACTGGCAGACAAAGTGGCAG) and GLPR1 (5' GCTCCTCGCCCTTGCTCACCATTGTTGGTTCCACCTGTTTTC) were used to amplify the pCmYLCV promoter fragment of approximately 0.5 kb by PCR. Using the synthetic EGFP gene expression frame plasmid DNA as a template, primers GLPF2 (5' GGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCC) and GLPR2 (5' CGGGCTGGCAGCGGCTGCCTTGTACAGCTCGTCCATGCC) were used to amplify the EGFP gene fragment of approximately 0.75 kb by PCR. Using the synthetic pCmYLCV-sdpA-pat plasmid DNA as a template, primers GLPF3 (5' GTAAAACGACGGCCAGTGCCAAGCTTTTACTGGCAGACAAAGTGGCAG) and GLPR2 (5' CGGGCTGGCAGCGGCTGCCTTGTACAGCTCGTCCATGCC) were used to amplify the EGFP gene fragment of approximately 0.75 kb by PCR. CATGGACGAGCTGTACAAG GCAGCCGCTGCCThe EGFP gene fragment containing the linker peptide (AGCCCGGAG, underlined to represent the linker) and GLPR3 (5' CACACATTATTATGGAGAAATTATCAGATCTGGGTCACCGGGCGCACC) were amplified by PCR to obtain a pat gene fragment of approximately 0.6 kb. Using the EGFP and pat gene fragments obtained by PCR as templates, PCR was performed using primers GLPF2 and GLPR3 to amplify the EGFP-pat fragment, approximately 1.3 kb in size. The EGFP-pat fragment obtained by PCR, the pCmYLCV promoter fragment, and the pCambia1300 digestion vector recovered from XhoI were ligated using homologous recombination to obtain the vector 1300-EGFP-PAT-T35S, abbreviated as GLP, containing the fusion protein EGFP-PAT.
[0036] 3. Construction of GP vector
[0037] Using the synthetically produced pCmYLCV-sdpA-pat plasmid DNA as a template, a PAT fragment of approximately 0.6 kb was amplified by PCR using primers PATF (5' TCTACAAATCTATCTCTCTCGAGTCTACCATGAGCCCGGAGCGCCGC) and PATR (5' ATTATTATGGAGAAACTCGAGTCAGATCTGGGTCACCGGGCGCACC), and then recovered by restriction enzyme digestion. The PAT fragment was then ligated to a vector digested with the restriction endonuclease XhoI on pCambia1300 using homologous recombination to obtain the transition vector 1300-P35S-PAT.
[0038] Using plasmid DNA containing a synthetically produced EGFP gene expression cassette as a template, an EGFP fragment of approximately 2.0 kb was amplified by PCR using primers GFPF (5' GTAAAACGACGGCCAGTGCCATGCCTGCAGGTCCCCAGATTAGCC) and GFPR (5' AACAGCTATGACATGATTACGAATTCGATCTAGTAACATAGATGACACCG). This EGFP fragment was then ligated to a vector digested with the restriction endonucleases HindIII and EcoRI (1300-P35S-PAT), and homologous recombination was employed to obtain the transition vector 1300-PAT-EGFP, abbreviated as GP, containing both the PAT and EGFP expression cassettes.
[0039] 4. Construction of DLP carrier
[0040] Using the synthetically produced pCmYLCV-sdpA-pat plasmid DNA as a template, a fragment of approximately 2.1 kb containing a linker peptide, sdpA-pat (nucleotide sequence as shown in SEQ ID NO. 5, encoded protein as shown in SEQ ID NO. 6), was amplified by PCR using primers DLPF (5' GTAAAACGACGGCCAGTGCCAAGCTTTTACTGGCAGACAAAGTGGC) and DLPR (5' CACACATTATTATGGAGAAATTATCAGATCTGGGTCACCGGGCGCAC). The fragment was then recovered by electrophoresis. The PCR product was ligated with a vector digested with restriction endonucleases HindIII and XhoI using homologous recombination to obtain the vector 1300-SDPA-PAT-T35S, abbreviated as DLP, containing the fusion protein (sdpA, linker peptide, and pat).
[0041] SEQ ID NO.5:
[0042]
[0043] 5. Construction of PLD carrier
[0044] Using the synthetic pCmYLCV-sdpA-pat plasmid DNA as a template, a pCmYLCV promoter fragment of approximately 0.5 kb was amplified by PCR using primers PYLCVF (5' GTAAAACGACGGCCAGTGCCAAGCTTTTACTGGCAGACAAAGTGGCAG) and PYLCVR (5' CTCCGGGCTCATTGTTGGTTCCACCTGTTTTCGTCGTCTTGGC). Using the synthetic pCmYLCV-sdpA-pat plasmid DNA as a template, a pat gene fragment of approximately 0.57 kb was amplified by PCR using primers PLDF1 (5' GAACCAACAATGAGCCCGGAGCGCCGCCCGGTG) and PLDR1 (5' CTGGGCAGCGGCTGCGATCTGGGTCACCGGGCGCAC). A pat gene fragment of approximately 0.57 kb was amplified by PCR using primer PLDF2 (5' GTGACCCAGATC). GCAGCCGCTGCC CAGACCACTCTCCAGATCAC (underlined to represent the linker peptide) and PLDR2 (5' CACACATTATTATGGAGAAATTATCACACCAAGGCAGCGCCCTCTGTCTC) were amplified by PCR to obtain an sdpA gene fragment of approximately 0.9 kb. Using the pat and sdpA gene fragments obtained by PCR as templates, PCR was performed using primers PLDF1 and PLDR2 to amplify the pat-sdpA fragment, approximately 1.5 kb in size. The pat-sdpA fragment obtained by PCR, the pCmYLCV promoter fragment, and the vector recovered from pCambia1300 digestion with restriction endonucleases HindIII and XhoI were ligated using homologous recombination to obtain the vector 1300-PAT-SDPA-T35S, abbreviated as PLD, containing the fusion proteins pat and sdpA.
[0045] 6. Construction of DP carrier
[0046] The 1300-P35S-PAT was double-digested with restriction endonucleases HindIII and EcoRI, and the digested vector was recovered. Using the synthetic pCmYLCV-sdpA-pat plasmid DNA as a template, a pCmYLCV-sdpA fragment of approximately 1.4 kb was amplified by PCR using primers SDPAF1 (5' GTAAAACGACGGCCAGTGCCAAGCTTTTACTGGCAGACAAAGTGGC) and SDPAR1 (5' GAACGATCGGGGAAATTCGAGCTCTCACACCAAGGCAGCGCCCTC). A Tnos terminator fragment of approximately 0.3 kb was amplified by PCR using primers SDPAF2 (5' GCTCGAATTTCCCCGATCGTTCAAACATTTGGCAATAAAG) and SDPAR2 (5' AACAGCTATGACATGATTACGAATTCGATCTAGTAACATAGATGACACC). The two fragments and the recovered vector were ligated using homologous recombination to obtain the vector 1300-PAT-SDPA, abbreviated as DP, containing the PAT expression cassette and the SDPA expression cassette.
[0047] Example 2: Agrobacterium-mediated transformation
[0048] LB liquid medium consists of 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L sodium chloride, in deionized water, at pH 7.0. LB solid medium is LB liquid medium with 15 g / L agar added.
[0049] MS liquid medium: MS basal medium (Phytotech, catalog number M519) 4.4 g / L, pH 5.8, dissolved in deionized water and then sterilized.
[0050] The vectors (PLG, GLP, and GP; PLD, DLP, and DP) constructed in Example 1 were transformed into Agrobacterium EHA105 using a heat shock transformation method. The transformed cells were then streaked onto LB solid medium plates containing 50 μg / mL rifampicin and 50 μg / mL kanamycin, and incubated upside down at 28°C for 2-3 days to obtain positive single colonies. These positive single colonies were selected and inoculated into 5 mL of LB liquid medium containing 50 μg / mL rifampicin and 50 μg / mL kanamycin, and cultured at 28°C with shaking at 220 rpm for 16-18 h. The cultured cells were then transferred at a volume ratio of 1:50 to fresh LB liquid medium containing 50 μg / mL rifampicin and 50 μg / mL kanamycin, and cultured until OD500. 600=0.5-0.6, centrifuge at 4℃, 5000g for 10 min to collect bacterial cells, resuspend in antibiotic-free MS liquid medium containing 100μM acetylsuccinone, and adjust OD. 600 =0.3-0.4, let stand at room temperature for 30 minutes to obtain Agrobacterium tumefaciens bacterial solution.
[0051] Example 3: Transient expression analysis of tobacco
[0052] Agrobacterium tumefaciens culture carrying the target gene plasmids (PLG, GLP, and GP) prepared in Example 2 was streaked onto LB solid medium plates containing 50 μg / mL rifampicin and 50 μg / mL kanamycin. The plates were incubated upside down at 28°C for 2-3 days to obtain positive single colonies. A single colony was picked and inoculated into 5 mL of LB liquid medium containing 50 μg / mL rifampicin and 50 μg / mL kanamycin. After incubation at 28°C and 220 rpm with shaking for 16-18 hours, the culture was transferred to 100 mL of LB liquid medium containing 50 μg / mL rifampicin and 50 μg / mL kanamycin at a volume ratio of 1:50, and cultured until OD (Organic Dysplasia). 600 The OD value reached 0.6-0.8; then, the cells were collected by centrifugation at 4℃ and 5000g for 10 minutes, resuspended in osmosis buffer (10mM MES buffer pH 5.6, 10mM MgCl2, 200μM acetylsylcholine) and the OD was adjusted. 600 The concentration was lowered to 0.8, and the mixture was left to stand at room temperature for 3 hours to induce Vir gene expression. Then, using a 1mL sterile syringe (without the needle), the bacterial solution was slowly injected into the underside of 3-4 week old *Nicotiana benthamiana* leaves (avoiding the veins). Two to three infection areas were marked on each leaf. The inoculated plants were then kept at 22-24℃, 80% relative humidity, and low light (20-50 μmol / L). m - ² s - ¹) Under the same conditions, the cells were co-cultured for 24 hours, followed by 16 hours of light / 8 hours of darkness with a light intensity of 100-150 μmol. m - ² s - ¹ Under normal conditions, continue culturing at 22-25℃ for 2 days.
[0053] Fluorescent protein GFP was detected in tobacco leaves transiently expressing PLG, GLP, and GP, respectively (Leica M165FC), and the results are shown in Table 1. The results indicate that GFP fluorescence expression was not observed regardless of whether the GFP gene was fused to the pat gene at the 5' end or the 3' end. Therefore, it is impossible to obtain a fusion gene simultaneously possessing glufosinate resistance and GFP fluorescence markers by functionally linking the pat gene and the GFP gene.
[0054] Table 1 GFP fluorescence results
[0055]
[0056] Example 4: Soybean genetic transformation
[0057] To investigate the effects of fusion of the sdpA and pat genes, soybean tests were conducted.
[0058] The genetically modified soybeans used here are derived from optimized versions of existing technologies. The specific process is as follows: Figure 1 As shown (Deng et al., 1998, Plant Physiology Communications 34: 381-387; Ma et al., 2008, Scientia AgriculturaSinica 41: 661-668; Zhou et al., 2001, Journal of Northeast Agricultural University 32: 313-319).
[0059] (1) Sterilization: Select healthy, plump and mature "William 82" and "Tianlong No. 1" soybeans and place them in a desiccator filled with chlorine gas (generated by the reaction of 50mL 30% NaClO and 2mL concentrated HCl) for 16 hours for sterilization.
[0060] (2) Germination: After sterilization, soybeans were sown into germination medium in a clean bench and cultured at 25°C for 1 day. The bean sprouts with the hypocotyl removed were cut in half lengthwise, so that both explants had cotyledons and epicotyls. The explants were cut at the nodes of the cotyledons and epicotyls in about 3-5 places, which could then be used as the target tissue for infection. The final concentration of the germination medium was: B5 basal medium (PhytoTech, catalog number G398) 3.21 g / L, sucrose 30 g / L, plant gel (Gelzan) 3.2 g / L, solvent: deionized water, pH 5.8.
[0061] (3) Infection: The prepared explants were immersed in Agrobacterium bacterial suspension (OD600 of 0.6) containing the target gene (such as PLD, DLP and DP) and co-cultured at 28°C for 10-30 minutes; then, the excess bacterial suspension on the explants was absorbed with absorbent paper and then transferred to CCM medium and incubated in the dark at 22°C for 3-5 days; the final concentration of CCM medium was: B5 basal medium (PhytoTech, catalog number G398) 3.21 g / L, 2-morpholine ethanesulfonic acid (MES) 2.5 g / L, sucrose 20 g / L, glucose 10 g / L, B5 vitamin (PhytoTech, catalog number G219) 1 mL / L, acetylsuccinone (AS) 80 mg / L, dithiothreitol (DTT) 300 mg / L, the solvent was deionized water, and the pH was 5.4; AS and DTT were added in the form of 40 mg / mL and 150 mg / mL aqueous solutions, respectively.
[0062] (4) Recovery: The explants cultured in step (3) were transferred to the recovery medium and cultured at 26℃ for 7 days, with 16h of light and 8h of darkness per day; the final concentration of the recovery medium was as follows: B5 basal medium (PhytoTech, G398) 3.21 g / L, MES 1.0 g / L, sucrose 30 g / L, iron salt solution (2.6 g EDTA-FeNa dissolved in deionized water and brought to 200 mL) 4 mL / L, L-glutamine (L-Gln) 125 mg / L, L-aspartic acid (L-Asp) 125 mg / L, B5 vitamin (PhytoTech, catalog number G219) 1 mL / L, agar 6.8 g / L, zeatin riboside (ZR) 2 mg / L, termethin 400 mg / L, with deionized water as the solvent and pH 5.6; ZR and termethin were added before pouring the plates.
[0063] (5) Screening: After co-culture in step (4), the explants were transferred to a screening medium containing 20 mg / L glufosinate (Sigma) and cultured at 26°C for 21 weeks under light, with 16 h of light and 8 h of darkness per day. The medium was changed every two weeks during this period. The final concentration of the screening medium was as follows: B5 basal medium (PhytoTech, catalog number G398) 3.21 g / L, MES 1.0 g / L, sucrose 30 g / L, iron salt solution (2.6 g EDTA-FeNa dissolved in deionized water and brought to a final volume of 200 mL) 4 mL / L, L-Gln 125 mg / L, L-Asp 125 mg / L, B5 vitamin (PhytoTech, catalog number G219) 1 mL / L, agar 6.8 g / L, 6-benzyladenine (6-BA) 1 mg / L, termethin 400 mg / L, glufosinate 5 mg / L, with deionized water as the solvent and pH 5.6.
[0064] (6) Elongation: The embryonic tissues selected in step (5) are then transferred to the bud elongation medium and cultured at 26°C until they grow into seedlings. The final concentration of the shoot elongation medium consisted of: MS basal salt mixture (PhytoTech, catalog number M524) 4.33 g / L, MES 1.0 g / L, sucrose 30 g / L, iron salt solution 3.5 mL / L (2.6 g EDTA-FeNa dissolved in deionized water, brought to a final volume of 200 mL), L-Gln 75 mg / L, L-Asp 75 mg / L, vitamin B5 (PhytoTech, catalog number G219) 1 mL / L, zeatin riboside (ZR) 1 mg / L, timentin 400 mg / L, gibberellin (GA3) 0.2 mg / L, indoleacetic acid (IAA) 0.1 mg / L, and screening agent glufosinate 5 mg / L, in 7.5 g / L agar, with deionized water as the solvent and a pH of 5.6. ZR, timentin, GA3, IAA, and glufosinate were added after sterilization.
[0065] (7) Transplanting: Subsequently, the plants were directly transplanted into sterile nutrient soil and kept moist. After being cultured for one month at a temperature of 26℃, a humidity of 80%, and a light-to-dark ratio of 16 h / 8 h per day, the small plants were cleaned to remove the agar and then planted in a greenhouse.
[0066] The culture media G398, G219, MES, and AS were all purchased from PhytoTechnology Laboratories. Plant hormones such as GA3, IAA, ZR, and 6-BA were all purchased from Sigma-Aldrich, with a stock solution concentration of 1 mg / ml.
[0067] Example 5: Identification of herbicide resistance in genetically modified soybeans
[0068] Transgenic soybean transformants containing PLD, DLP, and DP were obtained using the method described in Example 4. T1 generation transgenic soybean seedlings 15 days after sowing were tested for herbicide application (glufosinate and 2,4-D herbicide MCPA). Lines showing no significant difference in plant height and vigor compared to the control (sterilized water) 10 days after herbicide application were considered resistance transformation events. Glufosinate aqueous solution (Basta, Bayer Crop Science (China)) was diluted 1:200 and applied at a rate of 30 L / mu; MCPA (56% MCPA sodium soluble powder, Greenba) was prepared at a ratio of 2 g / L and applied at a rate of 30 L / mu. The number of positive transformants and the number of plants simultaneously tolerant to both herbicides were counted; the results are shown in Table 2.
[0069] The results showed that transgenic soybean transformants containing the three vectors exhibited good herbicide resistance. However, 76% of the DLP transformants were simultaneously tolerant to glufosinate and MCPA, a proportion comparable to the 72% proportion of the DP vectors using strong promoters to mediate the expression of the pat and sdpA genes, respectively. In contrast, only 16% of the PLD vector-transgenic plants showed simultaneous tolerance to glufosinate and MCPA, significantly lower than the DLP vector (Table 2). Therefore, the DLP vector fusion method is superior to the PLD vector.
[0070] Table 2 Herbicide tolerance of the transformants
[0071]
[0072] Two transformants from DLP and DP with comparable target gene expression levels were selected for herbicide application tests at different concentrations (0, 0.5, 1, 2, and 4 times). The 1-fold dosages were: glufosinate-ammonium aqueous solution (Basta, Bayer Crop Science (China)) diluted 1:200, with a spraying rate of 30 L / mu; and 2,4-D herbicide MCPA (56% MCPA sodium soluble powder, Greenba) prepared at a ratio of 2 g / L, with a spraying rate of 30 L / mu. Using sterilized water as a control, the test results showed that after spraying with glufosinate-ammonium and MCPA at 1, 2, and 4 times the recommended dosages, DLP exhibited significantly better plant height and growth vigor than DP. Figure 2 The above results indicate that the fusion gene formed by the functional fusion of the sdpA gene and the pat gene in soybean exhibits better resistance to the target herbicides glufosinate and MCPA than the gene expressing pat and sdpA separately.
[0073] Example 6: Identification of agronomic traits in transgenic soybeans
[0074] Soybean transformants expressing high levels of DLP and DP were screened and sown. Agronomic traits such as growth vigor and plant height were observed. Results showed that, compared to the control DP, DLP plants were generally taller and had stronger growth vigor. Figure 3 Therefore, the fusion gene expressing the pat and sdpA genes, which confers resistance to glufosinate and 2,4-D herbicides in plants, may have fewer negative effects on plant growth and agronomic traits than the simultaneous high expression of pat and sdpA alone in soybeans, and is more suitable for developing new transgenic soybean varieties tolerant to compound herbicides.
[0075] Example 7: Rapeseed genetic transformation
[0076] The cotyledon node transformation method was used to perform genetic transformation of rapeseed using the Shuang 11 variety as the recipient material and Agrobacterium tumefaciens EHA105 as the mediator. The specific procedure is as follows:
[0077] (1) First, disinfect the plump Zhongshuang 11 seeds with 75% ethanol for 30s, then disinfect with 10% sodium hypochlorite (with 1 drop of Tween-80) for 15min by shaking, rinse with sterile water 5-6 times, and then inoculate them into seed germination medium (MS basal medium + 30g / L sucrose + 7g / L agar powder, pH 5.8-6.0), and culture at 25℃, 16h light / 8h dark, and 2000lx light intensity for 7-8 days to obtain sterile seedlings;
[0078] (2) Take a sterile seedling cotyledon node (retain 1 / 2 cotyledon and 1-2 mm hypocotyl), make 2-3 incisions with a sterile scalpel, and inoculate it into a pre-culture medium (MS basal medium + 2.0 mg / L 6-BA + 0.1 mg / L NAA + 30 g / L sucrose + 7 g / L agar powder, pH 5.8-6.0), and incubate in the dark at 25℃ for 2 days;
[0079] (3) Simultaneously, select single positive Agrobacterium EHA105 colonies containing the target gene vector (DLP and DP constructed by the method in Example 1), inoculate them into LB liquid medium containing 50 μg / mL rifampicin and 50 μg / mL kanamycin, and culture at 28℃ and 220 rpm for 16-18 h with shaking. Then, transfer them to fresh LB liquid medium containing 50 μg / mL rifampicin and 50 μg / mL kanamycin at a volume ratio of 1:50, and culture until OD. 600 =0.5-0.6, centrifuge at 5000g for 10 min at 4℃, collect bacterial cells, resuspend in antibiotic-free MS liquid medium containing 100μM acetylsuccinone, and adjust OD. 600 =0.3-0.4, and the infected bacterial solution was prepared by standing at room temperature for 30 minutes;
[0080] (4) Place the cotyledonary explants pre-cultured in step (2) into the bacterial solution in step (3) and gently shake to infect for 10-15 min. Wipe the surface bacterial solution dry with sterile filter paper and inoculate into co-culture medium (MS basal medium + 2.0 mg / L 6-BA + 0.1 mg / L NAA + 100 μM acetylsyl syringone + 30 g / L sucrose + 7 g / L agar powder, pH 5.8-6.0) and incubate in the dark at 25℃ for 3 days.
[0081] (5) The explants were then washed three times with sterile water containing 500 mg / L cephalosporin for 5 min each time. After drying, they were inoculated into the selection differentiation medium (MS basal medium + 2.0 mg / L 6-BA + 0.1 mg / L NAA + 30 mg / L glufosinate + 500 mg / L cephalosporin + 30 g / L sucrose + 7 g / L agar powder, pH 5.8-6.0), and cultured at 25℃ for 16 h under light. Fresh selection medium was replaced every 15 days, and cultured for 30-40 days until 2-3 cm high resistant adventitious shoots differentiated.
[0082] (6) Cut robust resistant adventitious buds and inoculate them into rooting medium (1 / 2 MS basal medium + 0.5 mg / L NAA + 15 mg / L glufosinate + 300 mg / L cephalosporin + 15 g / L sucrose + 7 g / L agar powder, pH 5.8-6.0), and culture at 25℃ with 16 h light for 10-15 days. After the adventitious buds have differentiated into white and robust roots and formed complete resistant seedlings, open the culture bottle stopper and harden the seedlings at room temperature for 3-5 days. Wash off the agar from the roots and transplant them into sterilized nutrient soil with a peat moss:vermiculite:perlite ratio of 3:1:1 (mass ratio). Place them in a greenhouse at 22-25℃, relative humidity of 60%-70%, and light intensity of 3000 lx, and water them once a week with 1 / 2 MS basal medium. MS liquid medium was used to spray glufosinate-ammonia solution after the plants survived (glufosinate-ammonia solution (Basta, Bayer Crop Science (China)) diluted 1:400, spraying amount was 30 L / mu) to obtain transgenic rapeseed transformants containing DLP and DP respectively.
[0083] All the above culture media were autoclaved at 121°C for 20 minutes. Antibiotics, plant hormones, and acetylsuccinone were added aseptically when the culture media were cooled to about 50°C.
[0084] Example 8: Identification of herbicide resistance in genetically modified rapeseed
[0085] The DLP and DP transgenic rapeseed transformants obtained in Example 7 were subjected to spraying tests of glufosinate and the 2,4-D herbicide MCPA. T1 generation transgenic rapeseed seedlings 15 days after sowing were also tested for herbicide application. Lines showing no significant difference in plant height and vigor compared to the control group (sterilized water) 10 days after herbicide application were considered resistance transformation events. Glufosinate aqueous solution (Basta, Bayer Crop Science (China)) was diluted 1:200 and sprayed at a rate of 30 L / mu; the 2,4-D herbicide MCPA (56% MCPA sodium soluble powder, Greenba) was prepared at a ratio of 2 g / L and sprayed at a rate of 30 L / mu.
[0086] The results showed that the transgenic rapeseed transformants containing the two vectors exhibited good herbicide resistance, and 65% of the DLP transformants were simultaneously tolerant to glufosinate and MCPA, a proportion comparable to the 57.5% proportion of the DP vectors mediated by strong promoters expressing the pat and sdpA genes, respectively (Table 3). However, 10 days after herbicide application, the plant height and growth vigor of DLP transgenic rapeseed were significantly better than those of DP transgenic rapeseed.
[0087] Table 3 Herbicide tolerance of different rapeseed transformants
[0088]
Claims
1. A fusion gene that is simultaneously resistant to glufosinate and 2,4-D herbicides, characterized in that, The fusion gene includes an aryloxyalkyl ester dioxygenase gene and a glufosinate acetyltransferase gene.
2. The fusion gene as described in claim 1, characterized in that, The fusion gene is composed of an aryloxyalkyl ester dioxygenase gene, a linker peptide, and a glufosinate acetyltransferase gene, which are functionally linked from the 5' end to the 3' end.
3. The fusion gene as described in claim 2, characterized in that, The nucleotide sequence of the fusion gene is shown in SEQ ID NO.
5.
4. A fusion protein encoded by the fusion gene according to claim 1, characterized in that, The fusion protein is composed of aryloxyalkyl ester dioxygenase, linker peptide, and glufosinate acetyltransferase linked together in sequence.
5. The fusion protein as described in claim 4, characterized in that, The amino acid sequence of the fusion protein is shown in SEQ ID NO.
6.
6. An expression vector for the fusion gene as described in claim 1, characterized in that, The expression vector was constructed by inserting the fusion gene expression cassette into the pCambia1300 vector. The fusion gene expression cassette consists of the pCmYLCV promoter derived from the yellow leaf curl virus of the yellow night-blooming jasmine, an aryloxyalkyl ester dioxygenase gene, a linker peptide, a glufosinate acetyltransferase gene, and a T35S terminator, which are functionally linked from the 5' end to the 3' end.
7. The use of the fusion gene of claim 1 in the breeding of transgenic plants that are simultaneously tolerant to glufosinate and 2,4-D herbicides.
8. The application as described in claim 7, characterized in that, The application involves transferring the expression vector constructed from the fusion gene into the plant genome via Agrobacterium-mediated genetic transformation to obtain transgenic plants that are simultaneously tolerant to glufosinate and 2,4-D herbicides.
9. The application as described in claim 7, characterized in that, The plants mentioned include soybeans or rapeseed.
10. A method for breeding transgenic plants that are simultaneously tolerant to glufosinate and 2,4-D herbicides, characterized in that, The method includes the following steps: (1) The expression vector of the fusion gene as described in claim 1 is introduced into the target plant to obtain a transgenic plant that is simultaneously tolerant to glufosinate and 2,4-D herbicides; (2) Screening transgenic plants from the transgenic plants of step (1) that are simultaneously tolerant to glufosinate and 2,4-D herbicides.