Method for creating solid cavity and few-seed melon material and application
Editing the CmSLM gene in melon using the CRISPR/Cas9 gene editing system has solved the problem of breeding melons with no or few seeds, achieving placental non-liquefaction and reducing the number of seeds, and providing a rapid method for creating new melon varieties.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
- Filing Date
- 2026-03-02
- Publication Date
- 2026-05-29
AI Technical Summary
Existing technologies make it difficult to commercially breed seedless or low-seeded melons through genetic engineering, and conventional methods may result in seed coat formation, so there are no seedless melon varieties on the market.
The CmSLM gene in melon materials was edited using the CRISPR/Cas9 genome editing system to render it non-functional, thereby regulating the placenta non-liquefaction and seed number in melons. By inhibiting, silencing, or knocking out the CmSLM gene, melon materials with solid cavities and few seeds were obtained.
This method achieves non-liquefaction of the placenta and a significant reduction in the number of seeds in melons, enabling the rapid and effective creation of solid-cavity and low-seed melon materials, and providing an economical and fast approach for the breeding of new melon varieties.
Smart Images

Figure CN122104777A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant genetic engineering technology, specifically to a method and application for creating solid-cavity and low-seeded melon materials. The method particularly relates to a gene that regulates melon placenta and seed development. CmSLM Its encoded protein and applications. Biomaterials associated with this gene or its encoded protein can be used to create melons with solid cavities and few seeds. Background Technology
[0002] Seeds, as the primary reproductive organs of most flowering plants, not only store genetic material but also provide nutrition for early seedling growth, playing a crucial role in the plant life cycle (He et al., 2025). However, reducing seed count is a major breeding goal for many fruit crops, such as watermelons, grapes, and citrus fruits. Seedlessness significantly improves the edible and processing quality of fruit due to the increased proportion of edible seeds and the absence of hard, unpalatable seeds, making it one of the most valuable agricultural traits (Moniruzzaman et al., 2023). Furthermore, since fruit formation and development can occur without relying on pollination and fertilization, seedlessness significantly reduces production costs and yield losses caused by harsh conditions during pollination. Therefore, seedlessness is increasingly favored by producers and consumers.
[0003] melon( Cucumis melo Watermelon (L.) is an important horticultural crop belonging to the Cucurbitaceae family, similar to watermelon, but their edible parts are not entirely the same. The edible part of a watermelon is mainly the fleshy placenta, while in a muskmelon, the placenta liquefies upon ripening, resulting in the developed mesocarp and endocarp as the edible portion. Especially in thick-skinned muskmelons, the placenta has low sugar content and is rich in seeds, which consumers generally discard. Seedless watermelons are widely loved by consumers for their excellent quality and ease of consumption. In production, for watermelons, seedless varieties can be produced by conventional breeding to cultivate triploid plants or by treating them with hormone analogs such as chlorpyrifos (CPPU). For cucumbers, due to parthenocarpy, the ovary can develop directly into fruit without pollination and fertilization. Parthenocarpy resources in muskmelons are limited and have not yet been used for commercial breeding. Even with chlorpyrifos treatment, seed coats are still produced, and there are currently no seedless muskmelon varieties on the market like seedless watermelons. With the development of genetic engineering technology, seedless fruit production can now be achieved through genome editing technology, such as editing the genome of watermelons. SPOROCYTELESS Genes can produce seedless watermelons (Jiang et al., 2024). Therefore, breeding seedless or low-seeded melon varieties to meet market demand has become an urgent task.
[0004] In view of this, the present invention is hereby proposed.
[0005] References: He K, Wang W, You C, Qi X, Chen X, Wang 2025, doi: 10.1007 / s11427-025-3157-8. Jiang J, Feng Q, Zhao Z, Liu Q, Liu M, Wang J, Luan F, Zhang X, TianS, Liu S, Yuan L. Establishing a highly efficient diploid seedless watermelon production system through manipulation of the SPOROCYTELESS gene. New Phytol.2024, 244(4):1128-1136. Moniruzzaman M, Darwish AG, Ismail A, El-Kereamy A, Tsolova V, El-Sharkawy I. Seedlessness Trait and Genome Editing-A Review. Int J Mol Sci.2023, 24(6):5660. Summary of the Invention
[0006] To address the problems existing in the prior art, the purpose of this invention is to provide a method and application for creating solid-cavity and low-seeded melon materials, and more specifically, it involves a gene that regulates melon placenta and seed development. CmSLM Its encoded proteins and applications.
[0007] In a specific example of this invention, the CRISPR / Cas9 genome editing system was used to edit genes in the genome of melon materials. CmSLMEditing, thereby making the stated CmSLM Loss of gene function resulted in melon material with non-liquefied placenta and a significantly reduced number of seeds. This proves the gene's... CmSLM Mutations can produce new varieties of melons with solid cavities and few seeds.
[0008] In this invention, "solid cavity" refers to the placenta of a successful melon that does not liquefy, and "sparsely seeded melon material" refers to melon material with a significantly reduced number of mature melon seeds or seed pods compared to the original melon material to be modified.
[0009] To achieve the above objectives, the present invention adopts the following technical solution: The first aspect of the present invention provides a gene CmSLM Application in regulating placental liquefaction and / or seed development in melon, whereby regulation refers to suppressing, silencing, or knocking out the Cm gene in the melon genome. SLM The gene prevents the placenta of mature melons from liquefying and / or increases placental firmness and / or reduces seed number; CmSLM The encoded amino acid sequence is as follows (1) or (2): (1) As shown in sequence 2 of the sequence list; (2) The amino acid sequence shown in sequence 2 in the sequence listing is derived by adding, substituting or deleting one or more amino acids, and the derived amino acid sequence has the function of regulating melon placenta and seed development.
[0010] The protein CmSLM, shown in Sequence 2 of the sequence listing, consists of 230 amino acids. The protein formed by the derived amino acid sequence should have the same function as the protein shown in Sequence 2 of the sequence listing, namely, the function of regulating placental liquefaction and / or seed number and / or placental rigidity.
[0011] The gene CmSLM The coding sequence is the coding sequence of the amino acid sequence described in (1) or (2) above, preferably, the gene CmSLM The encoded sequence is as follows (a) or (b): (a) A DNA molecule as shown in positions 108 to 800 of sequence 1 in the sequence listing; (b) A DNA molecule that hybridizes with the DNA molecule described in (a) under strict conditions and encodes proteins that control placental and seed development functions.
[0012] Sequence 1 in the sequence listing is a gene. CmSLM The cDNA sequence includes the 5'UTR region located at positions 1 to 107, the CDS region located at positions 108 to 800, and the 3'UTR region located at positions 801 to 1109.
[0013] The stringent conditions refer to hybridization and membrane washing at 65°C using a solution of 0.1xSSPE (or 0.1xSSC) and 0.1% SDS.
[0014] The function of controlling placenta and seed development refers to the function of controlling whether the placenta liquefies after the melon matures, and whether the number of seeds or the seed coat is normal.
[0015] The second aspect of this invention provides a regulatory gene Cm SLM Application of expressed biological materials in the creation of solid-cavity and / or low-seeded melon materials, wherein the regulatory gene Cm SLM The expressed biological materials include the repressed, silenced, or knocked-out gene Cm. SLM Biological materials, the genes CmSLM The encoded amino acid sequence is as described in the first aspect. The solid-cavity melon material is a melon material in which the placenta does not liquefy after maturity and the placenta hardness increases significantly; the seedless melon material is a melon material in which the number of seeds decreases significantly after maturity.
[0016] The gene CmSLM The encoded sequence is as described in the first aspect.
[0017] In this invention, the gene Cm is suppressed, silenced, or knocked out. SLM The biomaterials can be those that inhibit the synthesis of proteins encoded by the gene through RNA interference technology, those that inhibit the synthesis of proteins encoded by the gene through gene silencing technology by degrading related mRNA or methylating DNA, or those that knock out genes through gene editing. CmSLM Biological materials whose genes are rendered ineffective through gene editing; preferably, from the perspective of new variety breeding, the biological material is one whose genes have been knocked out through gene editing. CmSLM Biological materials used to disable genes, such as the CRISPR / Cas9 genome editing system, are used for gene editing. A gRNA expression cassette is an essential component of this system, capable of transcribing or expressing gRNA targeting specific sites on the target gene. Then, Cas9 cleavage is used to achieve the deletion, deletion, insertion, or substitution of single or multiple nucleotides in the gene. The biological materials used for gene editing contain a gRNA expression cassette that can target the target gene. The targeting sequence or the nucleotide sequence encoding the gRNA can be designed as one or two. To improve targeting or editing efficiency, it is preferred that the targeting sequence or the nucleotide sequence encoding the gRNA be designed as two. Specifically, the biological material is any one of the following (A) to (C): (A) gRNA combinatorial expression cassette, which targets the gene Cm. SLM Two gRNAs; (B) A recombinant vector containing the gRNA combination expression cassette described in (A); (C) Host cells and host bacteria containing the gRNA combination expression cassette of (A) or the recombinant vector of (B).
[0018] The target genes of the two gRNAs are the genes encoding the protein CmSLM in melon. The two gRNAs include gRNA1 and gRNA2, wherein the target sequence of gRNA1 is the nucleotide sequence shown in Sequence 3 of the sequence listing or the reverse complementary sequence of the sequence shown in Sequence 3 of the sequence listing; and the target sequence of gRNA2 is the nucleotide sequence shown in Sequence 4 of the sequence listing or the reverse complementary sequence of the sequence shown in Sequence 4 of the sequence listing.
[0019] The recombinant vector includes a Cas9 expression cassette and the gRNA combined expression cassette, wherein the Cas9 expression cassette expresses Cas9. The backbone of the recombinant vector can be any commercially available gene-editing vector suitable for plant transformation; specifically, the recombinant vector is pBSE401::CmSLM provided in the examples.
[0020] The biological material can also be a transgenic cell line containing the above-mentioned recombinant vector, a host bacterium containing the above-mentioned recombinant vector, or other products that can be used for gene editing. Furthermore, primers used to amplify any fragment of the CmSLM gene, used to screen for materials exhibiting the expected gene mutation from melon materials obtained after transformation by the gene editing system, are also within the scope of protection of this invention.
[0021] In a specific embodiment of the present invention, the host bacterium containing the above-mentioned recombinant expression vector is Agrobacterium EHA105 containing the recombinant expression vector pBSE401::CmSLM.
[0022] A third aspect of the present invention provides a method for creating solid-cavity and / or low-seeded melon materials, the method comprising: utilizing the biomaterials described in the second aspect of the present invention to modify the Cm in the genome of the melon material to be modified. SLM Genes are edited to make the... CmSLM Functional loss results in melon material with a solid cavity and / or few seeds (significantly reduced seed number).
[0023] Preferably, the method includes using the above-mentioned melon CRISPR / Cas9 genome editing system to modify genes in the genome of melon material whose placenta state and seed number are to be altered. CmSLM Editing, thereby making the stated CmSLM The function was lost, resulting in melon material with non-liquefied placentas and a significantly reduced number of seeds.
[0024] In a preferred embodiment of the method in the third aspect of the present invention, the method specifically includes: S1: The above-mentioned melon CRISPR / Cas9 genome editing system or recombinant vector is introduced into the melon material to be modified, and successfully transformed plants are obtained through screening. S2: Obtaining genes from the successfully transformed plants by identification. CmSLM Mutant strains; The identification process involved using the genome of successfully transformed plants as a template for gene sequencing. CmSLM Fragment PCR amplification, followed by detection by gel electrophoresis or sequencing to obtain the gene. CmSLM Mutant strains; When the obtained genes CmSLM When the mutant line is a heterozygous mutant, the gene is selected from the offspring of the heterozygous mutant through self-pollination. CmSLM Homozygous mutants were used as materials for the solid-cavity and / or low-seeded melons; when the obtained genes CmSLM When the mutant strain is a homozygous mutant, the resulting homozygous mutant is the solid-cavity and / or seedless melon material.
[0025] Furthermore, the primer pairs used for the PCR amplification are shown in sequences 5 and 6 of the sequence listing.
[0026] In a third aspect of the invention, the melon material to be modified contains genes in its genome. CmSLM The materials for the melons include IVF105, Yangjiaomi, Yiwohou, Jingyu Lvbao, Jingyu Jingfei, Jingyu No.1, Jingyu No.2, Jingyu Taiyang, Yumi, Jingyu Gu No.1, Jingyu 268, Jingyu 2008, Jingyu No.4, Jingyu No.5 and Jingyu Huangliuxing, etc.
[0027] The fourth aspect of this invention provides a protein CmSLM that controls placenta and seed development in melons, having the amino acid sequence described in (1) or (2) below: (1) The amino acid sequence as shown in sequence 2 of the sequence listing; (2) The amino acid sequence shown in sequence 2 in the sequence listing is derived by adding, substituting or deleting one or more amino acids, and the derived amino acid sequence has the function of regulating melon placenta and seed development.
[0028] The fifth aspect of this invention provides genes controlling placentation and seed development in melons. CmSLM The nucleotide sequence of its coding region is as follows (a) or (b): (a) A DNA molecule as shown in positions 108 to 800 of sequence 1 in the sequence listing; (b) A DNA molecule that hybridizes with the DNA molecule described in (a) under strict conditions and encodes proteins that control placental and seed development functions.
[0029] By employing the above technical solution, the present invention has at least the following significant beneficial effects: (1) The present invention provides a melon gene (the open reading frame nucleotide sequence is preferably shown as position 108 to 800 of sequence 1) and the protein it encodes (the amino acid sequence is preferably shown as shown in sequence 2). Gene editing technology has determined that this gene can control or regulate the liquefaction state of the melon placenta and the number of seeds. Mutations in this gene will result in the placenta not liquefying after the melon matures to form solid melon material and a significant reduction in the number of seeds.
[0030] (2) Using gene editing technology, by modifying the melon... CmSLM Editing this gene can lead to non-liquefaction of the placenta and changes in the number of seeds in melons. Therefore, this gene plays a role in controlling the development of the placenta and seeds in melons. Based on the function of this gene, gene editing technology can be used to directly modify the gene in the corresponding melon variety. CmSLM Mutations occur, and homozygous mutants are selected from the offspring to obtain melons with solid cavities and few seeds. Alternatively, mutations can be caused by selecting homozygous mutants from the offspring. CmSLM Genetically mutant plants were subjected to conventional hybridization, and superior varieties of melons with solid cavities and few seeds were obtained through marker-assisted selection. CmSLM Genes can be used to improve the placenta and seed number of melons, which has important theoretical and applied value.
[0031] In summary, the gene editing method of this invention can quickly and effectively transform mature fruit placenta liquefaction and multi-seeded melon materials into solid-cavity, low-seeded melon materials, providing an economical, fast, and effective way to create solid-cavity, low-seeded melon materials. It has important application value and market prospects in the breeding of new melon varieties. Attached Figure Description
[0032] Figure 1 The pBSE401 vector spectrum.
[0033] Figure 2 for CmSLM A schematic diagram of the gene structure and the locations of the two designed target sites.
[0034] Figure 3 PCR detection of T1 generation transgenic plants.
[0035] Figure 4 for #cr3 Actual editing results of gene-edited plants (a) and sequencing peak diagram (b).
[0036] Figure 5 Wild type (WT) and #cr3 Longitudinal (a) and transverse (b) diagrams of mature fruits from gene-edited plants, with a scale bar of 5 cm.
[0037] Figure 6 Wild type (WT) and #cr3 Statistical data on pericarp hardness (a) and placental hardness (b) of gene-edited plants.
[0038] Figure 7 Wild type (WT) and #cr3 Phenotypic diagram of seed number in a single melon of gene-edited plant (a) and statistical analysis of the number of normal seeds (b) and undeveloped seeds (seed coat) in a single fruit (c), with a scale bar of 5 cm.
[0039] Figure 8 Wild type (WT) and #cr3 Statistical analysis data of seed appearance phenotype (a) and thousand-seed weight (b) of gene-edited plants, scale bar is 1 mm. Detailed Implementation
[0040] To enable those skilled in the art to better understand the present invention, the present invention will be further described below with reference to specific embodiments. It should be noted that the following descriptions are exemplary and not limited to the present invention. Unless otherwise specified, the experimental methods used in the embodiments are conventional methods in the art, and can be found in books or manuals such as *Molecular Cloning: A Laboratory Manual* (Second Edition, by J. Sambrook et al., translated by Huang Peitang et al., Science Press, 2002), *CRISPR-Cas9 Gene Editing: A Laboratory Manual*, or *Genome Editing: Principles and Applications*. The reagents used are commercially available, and the instructions for use should be followed according to the manufacturer's recommendations.
[0041] Regarding the melon experimental material IVF105 used in the following examples (described in: Xin T, Tian H, Ma Y, Wang S, Yang L, Li X, Zhang M, Chen C, Wang H, Li H, Xu J, Huang S, Yang X. Targeted creating new mutants with compact plant architecture using CRISPR / Cas9 genome editing by an optimized genetic transformation procedure incucurbit plants. Horticulture Research. 2022, 9:uhab086.), the applicant declares that the public can obtain this biological material from the applicant, and that this biological material is only used to repeat the relevant experiments of the present invention and may not be used for other purposes.
[0042] The CRISPR / Cas9 vector is pBSE401, derived from the literature “Han J, Guo B, Guo Y, Zhang B, Wang X, Qiu LJ. Creation of Early Flowering Germplasm of Soybean by CRISPR / Cas9 Technology. Frontiers in Plant Science. 2019, 10:1446.” The applicant declares that the public can obtain it from the applicant. The vector's image is shown below. Figure 1 As shown.
[0043] Example 1: Melon CmSLM Obtaining gene sequences Based on the Harukei-3 (V1.4.1) reference genome database (http: / / cucurbitgenomics.org / v2 / search / genome / 25), CmSLM The annotation results in the middle are obtained CmSLM Analysis of the gene's genome and coding region sequence revealed that the transcript is 1109 bp long, containing 9 exons and 8 introns, with a coding region of 693 bp encoding a 230-amino acid protein. Figure 2 The nucleotide sequence of the coding region of this gene is shown from position 108 to 800 of sequence 1 in the sequence listing. It encodes the CmSLM protein, and its amino acid sequence is shown in sequence 2 in the sequence listing.
[0044] Example 2 CmSLM gene editing vectors pBSE401::CmSLM Construction one, CmSLM Obtaining the CRIPSR / Cas9 gene editing target sequence The sequence shown in sequence 1 of the sequence list CmSLM The gene coding region sequence was submitted to the online target analysis database CRISPR-P 2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ), the PAM sequence was set to NGG, and the species data was set to Melon ( Cucumis melo CRIPSR / Cas9 target design was performed using v3.5. Ultimately, two sgRNA targets were selected on exons 3 and 4. Figure 2 The specific target sequence is as follows: gRNA1: 5'-AATTCAGTGACAGAGCTAG-3' (Sequence 3); gRNA2: 5'-AATGCTTCAGAATTCCAAC-3' (sequence 4); two, CmSLM Construction of gene editing vectors (1) Design of sgRNA amplification primers Based on the target sequence, sgRNA amplification primers were designed and constructed as follows: gRNA-F (Sequence 7): 5'-TCGAAGTAGTGATTG AATTCAGTGACAGAGCTAG GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTTGCAAAATTTTCCAGATCGATTTCTTCTTCCTCTGTTCTTCGGCGTTCAATTTCT GGGGTTTTCTCTTCGTTTTCTGTAACTGAAACCTAAAATTTGACCTAAAAAAAATCTCAAATAATATGATTCAGTGGTTTTGTACTTTTCAGTTAGTTGAGTTTTGCAGTTCCGATGAGATAAACCAATATTAATCCAA ACTACTGCAGCCTGACAGACAAATGAGGATGCAAACAATTTTAAAGTTTATCTAACGCTAGCTGTTTTGTTTCTTCTCTCTGGTGCACCAACGACGGCGTTTTCTCAATCATAAAGAGGCTTGTTTTACTTAAGGCCA ATAATGTTGATGGATCGAAAGAAGAGGGCTTTTAATAAACGAGCCCGTTTAAGCTGTAAACGATGTCAAAAACATCCCACATCGTTCAGTTGAAAATAGAAGCTCTGTTTATATATTGGTAGAGTCGACTAAGAGATTG AATGCTTCAGAATTCCAAC GTTTTAGAGCTAGAA-3', where the underlined part represents two target sequences.
[0045] gRNA-R (Sequence 8): 5'-TTCTAGCTCTAAAAC GTTGGAATTCTGAAGCATTCAATCTCTTAGTCGACTCTACCAATATATAAACAGAGCTTCTATTTTCAACTGAACGATGTGGGATGTTTTTGACATCGTTTACAGCTTAAACGGGCTCGTTTATTAAAAGCCCTCTTCTTTCGATCCATCAACATTA TTGGCCTTAAGTAAAACAAGCCTCTTTATGATTGAGAAAACGCCGTCGTTGGTGCACCAGAGAGAAGAAACAAAACAGCTAGCGTTAGATAAACTTTAAAATTGTTTGCATCCTCATTTGTCTGTCAGGCTGCAGTAGT TTGGATTAATATTGGTTTATCTCATCGGAACTGCAAAACTCAACTAACTGAAAAGTACAAAACCACTGAATCATATTATTTGAGATTTTTTTTAGGTCAAATTTTAGGTTTCAGTTACAGAAAACGAAGAGAAAACCC CAGAAATTGAACGCCGAAGAACAGAGGAAGAAGAAATCGATCTGGAAAATTTTGCAAAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC CTAGCTCTGTCACTGAATT CAATCACTACTTCGA-3', the underlined part is the target sequence.
[0046] gRNA-R is the reverse complementary sequence of gRNA-F.
[0047] The above-mentioned single-stranded DNA nucleotide sequences were synthesized and prepared into 10 μmol / L working solutions. In a 200 μL sterile PCR tube, 10 μL of gRNA-F and 10 μL of gRNA-R primer working solutions were added and mixed thoroughly. The tube was then placed on a PCR instrument for DNA double-strand synthesis. The program was set as follows: denaturation at 98℃ for 30 s, followed by stepwise annealing to 4℃ at a rate of 0.1℃ / s.
[0048] Take the CRISPR / Cas9 vector, i.e., the pBSE401 vector, and use restriction endonucleases. Bsa I was subjected to enzyme digestion. The 25 μL digestion system was as follows: 15 μL pBSE401 vector (100 ng / μL), 2 μL 10×FastDigest enzyme. ® green buffer, 1 μL BsaDigestion was performed with 1 μL of ddH2O at 37°C for 4 h. The digestion products were subjected to 1% agarose gel electrophoresis, and the linearized plasmid fragments were recovered using an agarose gel recovery kit.
[0049] The double-stranded DNA product obtained in step (1) and the vector digestion product obtained in step (2) were ligated using recombinase. The ligation system was as follows: 2 μL of double-stranded DNA product (step (1)), 3 μL of pBSE401 digested vector (step (2)), and 5 μL of 2×Seamless Cloning Mix (Beijing Bomei Gene Technology Co., Ltd.). The reaction system was placed in a 50 ℃ water bath for 15 minutes for ligation. After ligation, it was stored in a -20 ℃ refrigerator for later use.
[0050] The ligation product was transformed into E. coli Top10, and clones were selected and sent to Beijing Bomeide Gene Technology Co., Ltd. for sequencing to obtain correctly recombinant clones. The plasmid of the positive clone was extracted to obtain the recombinant plasmid pBSE401::CmSLM.
[0051] Example 3: Obtaining and Phenotyping of Gene-Edited Plants Recombinant plasmid pBSE401::CmSLM transformed Agrobacterium Take 100 μL of EHA105 Agrobacterium competent cells (BC303-01, Beijing Bomaide Gene Technology Co., Ltd.) thawed on ice, add 100 ng of the gene editing vector pBSE401::CmSLM prepared in Example 2, and transform the plasmid into Agrobacterium cells according to the instructions. Spread the plasmid on LB agar plates containing 50 μg / mL kanamycin and 25 μg / mL rifampin, and incubate in the dark at 28 °C for 2-3 days. Then, pick a single colony and place it in LB liquid medium containing 50 μg / mL kanamycin and 25 μg / mL rifampin, and incubate overnight at 28 °C with shaking to obtain transformants. These transformants are positive recombinant bacteria, named pBSE401::CmSLM / EHA105, and the strain is then frozen at -80 °C for later use.
[0052] Obtaining and identifying positive edited plants of melon (1) Obtaining T0 generation positive transgenic melon plants Using Agrobacterium-mediated genetic transformation (reference: Xin T, Tian H, Ma Y, Wang S, Yang L, Li X, Zhang M, Chen C, Wang H, Li H, Xu J, Huang S, Yang X. Targeted creating new mutants with compact plant architecture using CRISPR / Cas9 genomeediting by an optimized genetic transformation procedure in cucurbit plants. Horticulture Research. 2022, 9:uhab086), the recombinant strain pBSE401::CmSLM / EHA105 was transformed into the recipient thin-skinned melon material IVF105 (WT), ultimately obtaining 5 T0 generation regenerated plants. The T0 generation plants were planted and self-pollinated to obtain T1 generation plants.
[0053] Genotyping of T1 generation positive transgenic melon plants Designed using the online software Primer-BLAST (http: / / www.ncbi.nlm.nih.gov / ). CmSLM Target-specific detection primers for the gene were used (KZ-F: 5'-GTTATGCAAGGTAAGTGTTTGCT-3', sequence 5); KZ-R: 5'-TCCCCCATCAAGTGCCTAAC-3', sequence 6). Genomic DNA was extracted from T1 generation single plants of each family using the CTAB method. Subsequently, high-fidelity KOD FX enzyme (TOYOBO) was used with primers KZ-F and KZ-R to detect the target-specific DNA. CmSLM Gene targets were identified by PCR.
[0054] The PCR reaction system was as follows: 25 μL of 2× PCR Buffer for KOD FX, 10 μL of dNTPs (2 mmol / L each), 2 μL of primers (10 μmol / L, 1 μL each of KZ-F and KZ-R), 1 μL of KOD FX enzyme (1 U / μL, TOYOBO), 2 μL of genomic DNA template, and ddH2O added to a final volume of 50 μL. Amplification conditions: 94℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 59℃ annealing for 30 s, 68℃ extension for 1 min, 35 cycles; 68℃ extension for 5 min, and storage at 16℃. The results were confirmed by 1.5% agarose gel electrophoresis. Figure 3 As shown, the identification results revealed that the sample#cr3 Large fragment loss occurred ( Figure 3 Subsequently, the PCR amplification products were sent directly to Beijing Bomei Gene Technology Co., Ltd. for sequencing and identification.
[0055] Sequencing analysis revealed that the wild-type WT amplified fragment was 1051 bp in length, while the sample... #cr3 A 335 bp fragment was missing between target 1 and target 2, with a fragment size of 716 bp. Figure 4 ).
[0056] #cr3 The positive plants identified from the T1 generation CmSLM Plants that have undergone homozygous editing following a 335 bp deletion of a gene segment, i.e., plants with homozygous editing of two homologous chromosomes. CmSLM Plants obtained after the same mutation in the gene, while keeping the rest of the genome unchanged, can result in a frameshift, causing premature termination of the encoded protein and loss of function.
[0057] III. Phenotypic Identification of T3 Generation Positive Transgenic Plants Planting #cr3 The plants were continuously self-pollinated to obtain T3 generation families. Compared to the wild type (WT), homozygous gene-edited plants showed no significant differences in vegetative and reproductive growth stages. At fruit maturity, after cutting the fruit open, significant differences in the internal structure between wild-type and edited plants were observed. The placenta in the wild-type was completely liquefied, while the placenta in the edited plants remained liquefied, exhibiting a solid cavity state. Figure 5 Furthermore, the pericarp hardness and placental hardness of the edited plants increased by 1.15 times and 30.44 times, respectively. Figure 6 Additionally, a single wild-type melon fruit contains approximately 400 seeds; however... #cr3 The mutant's fruit contains only 0-3 normal seeds and a small number of undeveloped seeds. Figure 7 Compared to the wild type, the mutant has many longitudinal cracks on the seed coat surface and a significantly reduced thousand-seed weight. Figure 8 These results indicate that melons CmSLM Genes also have the function of regulating placental liquefaction and seed development.
[0058] The results above show that the gene editing method of this invention can be used to... CmSLM Gene editing can rapidly produce melons with solid cavities and few seeds, and this mutation is stably inherited. It can also be used for sexual hybridization to convert the mutated melons into hereditary varieties. CmSLM The direct application of genes to the creation and breeding of new melon germplasm has significant application value and breeding prospects.
[0059] The above embodiments are merely exemplary descriptions of the present invention, but the implementation of the present invention is not limited to the varieties or materials in the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall fall within the protection scope of the present invention.
Claims
1. Genes CmSLM Application in regulating placental liquefaction and / or seed development in melon, whereby regulation refers to suppressing, silencing, or knocking out the Cm gene in the melon genome. SLM The gene prevents the placenta of mature melons from liquefying and / or increases placental hardness and / or reduces seed number; CmSLM The encoded amino acid sequence is as follows (1) or (2): (1) As shown in sequence 2 of the sequence list; (2) The amino acid sequence shown in sequence 2 in the sequence listing is derived by adding, substituting or deleting one or more amino acids, and the derived amino acid sequence has the function of regulating melon placenta and seed development.
2. The application according to claim 1, characterized in that, The gene CmSLM The encoded sequence is as follows (a) or (b): (a) A DNA molecule as shown in positions 108 to 800 of sequence 1 in the sequence listing; (b) A DNA molecule that hybridizes with the DNA molecule described in (a) under strict conditions and encodes proteins that control placental and seed development functions.
3. Regulatory gene Cm SLM Application of expressed biological materials in the creation of solid-cavity and / or low-seed melon materials, wherein the regulatory gene Cm SLM The expressed biological materials include the repressed, silenced, or knocked-out gene Cm. SLM Biological materials, the genes CmSLM The encoded amino acid sequence is as follows (1) or (2): (1) As shown in sequence 2 of the sequence list; (2) The amino acid sequence derived from the amino acid sequence shown in sequence 2 in the sequence listing by adding, substituting or deleting one or more amino acids, and the derived amino acid sequence has the function of regulating melon placenta and seed development. The solid-cavity melon material is a melon material whose placenta does not liquefy and whose placenta hardness increases significantly after maturity; the seedless melon material is a melon material whose seed number decreases significantly after maturity.
4. The application according to claim 3, characterized in that, The gene CmSLM The encoded sequence is as follows (a) or (b): (a) A DNA molecule as shown in positions 108 to 800 of sequence 1 in the sequence listing; (b) A DNA molecule that hybridizes with the DNA molecule described in (a) under strict conditions and encodes proteins that control placental and seed development functions.
5. The application according to claim 3, characterized in that, The biological material is any one of the following (A) to (C): (A) gRNA combinatorial expression cassette, which expresses the gene Cm SLM Two gRNAs; (B) A recombinant vector containing the gRNA combination expression cassette described in (A); (C) Host cells and host bacteria containing the gRNA combination expression cassette of (A) or the recombinant vector of (B).
6. The application according to claim 5, characterized in that, The two gRNAs include gRNA1 and gRNA2, wherein the target sequence of gRNA1 is the nucleotide sequence shown in Sequence 3 of the sequence listing or the reverse complementary sequence of the sequence shown in Sequence 3 of the sequence listing; and the target sequence of gRNA2 is the nucleotide sequence shown in Sequence 4 of the sequence listing or the reverse complementary sequence of the sequence shown in Sequence 4 of the sequence listing.
7. The application according to claim 5, characterized in that, The recombinant vector includes a Cas9 expression cassette and the gRNA combination expression cassette of claim 5 or 6, wherein the Cas9 expression cassette expresses Cas9.
8. A method for creating solid-cavity and / or seedless melon materials, characterized in that, include: Using the biomaterial described in any one of claims 5 to 7, the Cm in the genome of the melon material to be modified SLM Gene editing to make gene Cm SLM Functional failure resulted in solid cavity and / or low-seeded melon materials, Cm SLM The amino acid sequence encoded by the gene is as follows (1) or (2): (1) As shown in sequence 2 of the sequence list; (2) The amino acid sequence shown in sequence 2 in the sequence listing is derived by adding, substituting or deleting one or more amino acids, and the derived amino acid sequence has the function of regulating melon placenta and seed development.
9. The method for creating solid-cavity and / or seedless melon material according to claim 8, characterized in that, S1: The recombinant vector described in claim 5 is introduced into the melon material to be modified, and successfully transformed plants are obtained by screening. S2: Obtain gene CmSLM mutant lines from the successfully transformed plants by identification; The identification process involves using the genome of successfully transformed plants as a template to perform PCR amplification of the CmSLM gene fragment, followed by detection by gel electrophoresis or sequencing to obtain the CmSLM gene mutant line. When the obtained genes CmSLM When the mutant line is a heterozygous mutant, the gene is selected from the offspring of the heterozygous mutant through self-pollination. CmSLM Homozygous mutants were used as materials for the solid-cavity and / or low-seeded melons; when the obtained genes CmSLM When the mutant strain is a homozygous mutant, the resulting homozygous mutant is the solid-cavity and / or seedless melon material.
10. The method according to claim 9, characterized in that, The primer pairs used for PCR amplification are shown in sequences 5 and 6 of the sequence listing.