Application of new tetraploid rice fertility gene ntfr2
By cloning and knocking out the novel tetraploid rice fertility-regulating gene NTFR2, and using CRISPR/Cas9 technology to regulate rice fertility, the problem of low seed setting rate in homologous tetraploid rice was solved, the biological function of NTFR2 was revealed, and a new means of fertility regulation was provided for tetraploid rice breeding.
Patent Information
- Application Number
- CN202610313779.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-16
- Publication Date
- 2026-05-29
AI Technical Summary
In existing technologies, autotetraploid rice has key defects such as fewer effective panicles, reduced number of grains per panicle, and low seed setting rate, which affect its direct application in rice breeding and industrialization. Furthermore, there is a lack of functional research on the fertility-regulating genes of novel tetraploid rice.
By cloning the novel tetraploid rice fertility-regulating gene NTFR2 (LOC_Os02g21310) and using CRISPR/Cas9 gene editing technology to knock out or reduce the function of this gene, the fertility of the rice embryo sac is reduced, which in turn affects the seed setting rate. This provides a method for regulating the fertility of a novel tetraploid rice.
The biological function of the NTFR2 gene in a novel tetraploid rice was clarified, resulting in a 33.94% decrease in seed setting rate and a 31.35% decrease in embryo sac fertility. This provides a new fertility gene resource for tetraploid rice breeding and has promising application prospects.
Smart Images

Figure CN122104781A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of genetic engineering and plant genetics and breeding technology, specifically involving the application of the novel tetraploid rice fertility gene NTFR2. Background Technology
[0002] Rice (Oryza sativa L.) is one of the major food crops, and increasing rice yield has always been a core research direction in crop breeding. In recent years, frequent extreme weather events worldwide have posed increasingly severe challenges to food security, further highlighting the urgency of developing high-yield rice varieties. Against this backdrop, some breeders have proposed using polyploid rice to increase rice yield (Cai Detian, 2001, "Theory and Technology of Polyploid Rice Breeding"). Autotetraploid rice is a new polyploid germplasm obtained by inducing chromosome doubling in diploid rice through colchicine. Compared to diploid parents, autotetraploid rice has significant biological advantages, specifically manifested in higher biomass, stronger environmental adaptability, fuller and larger grains, outstanding stress resistance, lush foliage, and increased nutrient content in the grains. However, autotetraploid rice has key defects such as fewer effective panicles, fewer grains per panicle, and low seed setting rate. These shortcomings severely restrict its direct application in rice breeding and its industrialization (Song Wenchang & Zhang Yuhua, 1992, "An Overview of Research on Rice Polyploid Breeding"; Dai Ximei, 2006, "Research Strategies for Rice Autopolyploids").
[0003] Our research group previously conducted extensive hybridization of various types of autotetraploid rice, and after more than 20 years of selection, obtained a batch of new tetraploid rice germplasm with normal seed setting rate. The seed setting rate of their F1 hybrids can reach more than 80%. These materials are called "new tetraploid rice" (Guo et al., 2017, Transcriptome analysis of neo-tetraploid rice reveals specific differential gene expressions associated with fertility and heterosis). New tetraploid rice has the advantages of high fertility, strong heterosis, and genetic stability, and has great application potential in rice production (Guo et al., 2017, Transcriptome analysis of neo-tetraploid rice reveals specific differential gene expressions associated with fertility and heterosis; Liu Xiangdong et al., 2022, "Innovation and Application of Polyploid Rice Breeding Technology"). Therefore, discovering new genes regulating fertility in new tetraploid rice and elucidating their regulatory mechanisms will help to elucidate the molecular mechanism of high fertility regulation in new tetraploid rice.
[0004] To date, functional studies on novel tetraploid rice fertility-regulating genes are limited, and research on the molecular mechanisms of their high fertility has mainly focused on genome and transcriptome sequencing. Therefore, developing novel tetraploid rice fertility-regulating genes is of significant theoretical and practical importance for in-depth research in this field. Summary of the Invention
[0005] To overcome the shortcomings of the prior art, this invention provides a novel tetraploid rice fertility regulation gene NTFR2 (LOC_Os02g21310). After its function is lost in the novel tetraploid rice, it has little impact on the relevant agronomic traits and is expected to be used in subsequent tetraploid rice breeding systems.
[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: The first aspect of this invention provides the application of the gene NTFR2 (LOC_Os02g21310) in regulating the fertility of a novel tetraploid rice, namely, after the NTFR2 gene function is lost, the seed setting rate and embryo sac fertility of the novel tetraploid rice decrease.
[0007] It should be understood that, considering the degeneracy of codons, modifications to the nucleotide sequence of the aforementioned encoding gene without altering the amino acid sequence also fall within the scope of protection of this invention. Furthermore, based on gene coding principles, this invention also covers the protein encoded by the NTFR2 gene, and its derivative proteins with equivalent functions obtained by substituting, deleting, or adding one or more amino acids.
[0008] Previous research by our group revealed that NTFR2 (LOC_Os02g21310) is involved in the regulation of fertility in a novel tetraploid rice variety, but this gene had not been cloned. Therefore, this invention cloned this gene and found that loss of function of this gene leads to a decrease in seed setting rate of approximately 33.94% in the novel tetraploid rice, with a significant fertility phenotype. Cytological studies showed a decrease in embryo sac fertility of approximately 31.35%, and abnormal embryo sac development is the main reason for the decreased seed setting rate in the ntfr2 mutant. Furthermore, it was found that loss of function of the NTFR2 gene in the novel tetraploid rice has little impact on its related agronomic traits, demonstrating strong application value and potential for use in subsequent tetraploid rice breeding systems.
[0009] Preferably, the novel tetraploid rice includes the novel tetraploid rice variety Huaduo No. 1.
[0010] The second aspect of this invention also provides a method for regulating the fertility of a novel tetraploid rice, namely, using genetic engineering techniques to knock out or reduce the NTFR2 gene (LOC_Os02g21310) in rice, thereby causing the gene to lose its function and thus achieving a targeted reduction in the fertility of the rice embryo sac.
[0011] Preferably, the method for regulating the fertility of novel tetraploid rice is as follows: using the gene NTFR2 (LOC_Os02g21310) as a target, designing a CRISPR / Cas9-based sgRNA sequence, ligating a DNA fragment containing the encoding the sgRNA sequence into a vector carrying CRISPR / Cas9, and then transforming rice to induce the loss of NTFR2 gene function, resulting in a decrease in rice embryo sac fertility, thereby obtaining transgenic rice material with decreased embryo sac fertility due to the loss of gene function.
[0012] More preferably, the site of action of the sgRNA sequence is shown in SEQ ID No. 1.
[0013] More preferably, the DNA fragment containing the sgRNA sequence is shown in SEQ ID No. 2.
[0014] More preferably, the vector carrying CRISPR / Cas9 includes the pYLCRISPR / Cas9 Pubi-H binary vector system.
[0015] The third aspect of the present invention also provides the application of transgenic rice materials cultivated using the method described in the second aspect in rice breeding.
[0016] Preferably, the rice breeding method includes transgenic, hybridization, backcrossing, self-pollination, or asexual reproduction.
[0017] Compared with the prior art, the beneficial effects of the present invention are: This invention utilizes gene knockout technology to clarify the function of the fertility-regulating gene NTFR2 in a novel tetraploid rice. By constructing a CRISPR / Cas9 gene knockout vector for NTFR2 and transforming it into the novel tetraploid rice variety Huaduo 1, it was found that NTFR2 affects the fertility of Huaduo 1. When the NTFR2 gene function is lost, the mutant exhibits a reduced seed setting rate and abnormal development of the female gamete embryo sac. This discovery of NTFR2 in a novel tetraploid rice reveals the biological function of the rice gene NTFR2 for the first time and also provides a new fertility gene resource for tetraploid rice breeding.
[0018] This invention reveals that the loss of function of the rice NTFR2 gene leads to a significant decrease in the fertility of a novel tetraploid rice, but has little impact on male gametes and other agronomic traits. This indicates that it is a novel gene that mainly affects the fertility of tetraploid rice and has important application prospects in the fields of creating new female-sterile lines and promoting the utilization of heterosis in tetraploid rice. Attached Figure Description
[0019] Figure 1 The predicted pattern diagram and gene expression pattern analysis of the NTFR2 gene on the eplant website; (A). Expression of the NTFR2 gene in the eplant database, where the stages of spike and seed development are distinguished by spike length and post-fertilization days (dap), respectively. The specific criteria are as follows: 0-3cm, floral meristem transformation and floral organ development (P1); 3-10cm, meiosis stage (P2 and P3); 10-15cm, microspore stage (P4); 15-22cm, vacuolated pollen stage (P5); 22-30cm, mature pollen stage; 0-2dap, early globular embryo (S1); 3-4dap, mid-to-late globular embryo (S2); 5-10dap, embryo morphogenesis (S3); 11-20dap, embryo maturity (S4); 21-29dap, dormancy and dehydration tolerance stage (S5). The period division mainly refers to the method of Itoh et al. (2005) (Itoh, Jun-Ichi, et al. "Rice plant development:from zygote to spikelet." Plant and cell physiology 46.1 (2005): 23-47.). (B). RT-qPCR analysis results of NTFR2 in the anther tissue of Huaduo No. 1; where A-PMC is anther in interphase of meiosis; A-PMA is anther in prophase of meiosis; A-MAI is anther in meiosis I; A-MAII is anther in meiosis II; and A-SCP is anther in the early stage of mononuclear microspores.
[0020] Figure 2 To compare the structure of the NTFR2 gene and the phenotypic differences between loss-of-function mutants and wild-type NTFR2 in a novel tetraploid rice. (A) Structure diagram of the NTFR2 gene; (B) Plant typology diagram of wild-type material Huaduo 1; (C) Plant typology diagram of ntfr2-1 mutant; (D) Plant typology diagram of ntfr2-2 mutant; (E) Panicle typology diagram of wild-type material Huaduo 1; (F) Panicle typology diagram of ntfr2-1 mutant; (G) Panicle typology diagram of ntfr2-2 mutant; (H) Differences in seed setting rate between two NTFR2 loss-of-function mutant lines and wild type; (I) Differences in main panicle length between two NTFR2 loss-of-function mutant lines and wild type; (J) Differences in effective panicles between two NTFR2 loss-of-function mutant lines and wild type; where WT is the wild-type material, Huaduo 1; ntfr2-1 and ntfr2-2 are loss-of-function mutant lines of NTFR2 in a novel tetraploid rice.
[0021] Figure 3Comparison of the differences in mature anthers, pollen grains, and pollen fertility between the loss-of-function mutant of NTFR2 in a novel tetraploid rice and the wild-type Huaduo 1; (A) Mature anthers of wild-type material Huaduo 1; (B) Mature anthers of the ntfr2-1 mutant; (C) Mature anthers of the ntfr2-2 mutant; (D) Mature pollen grains of wild-type material Huaduo 1; (E) Mature pollen grains of the ntfr2-1 mutant; (F) Mature pollen grains of the ntfr2-2 mutant; (G) Pollen fertility of wild-type material Huaduo 1; (H) Pollen fertility of the ntfr2-1 mutant; (I) Pollen fertility of the ntfr2-2 mutant; where WT is the wild-type material Huaduo 1; ntfr2-1 and ntfr2-2 are loss-of-function mutant lines of NTFR2 in novel tetraploid rice.
[0022] Figure 4 Statistics on the abortion types and normal rate of mature embryo sacs in NTFR2 loss-of-function mutants; (A) Normal embryo sac of WT (wild-type Huaduo 1); (B) Normal embryo sac of ntfr2; (C, D) Abnormal embryo sac at the polar nucleus position of the ntfr2 mutant; (E) Abnormal embryo sac with a single polar nucleus of the ntfr2 mutant; (F) Double embryo sac of the ntfr2 mutant; (G, H) Small-cavity embryo sac of the ntfr2 mutant, objective lens 10×; scale bar = 40μm; (I) Statistics of normal embryo sacs of wild-type Huaduo 1 and ntfr2 mutant. WT is the wild-type material, Huaduo 1; ntfr2 is a loss-of-function mutant of NTFR2 in a novel tetraploid rice. Detailed Implementation
[0023] The specific embodiments of the present invention will be further described below. It should be noted that these descriptions are for the purpose of aiding understanding the present invention, but do not constitute a limitation thereof. Furthermore, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.
[0024] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the experimental materials used in the following embodiments are all available through conventional commercial channels.
[0025] Example 1: Screening of NTFR2 gene and analysis of gene expression patterns Our research team selected the LOC_Os02g21310 gene for functional studies. Using the National Rice Database (https: / / www.ricedata.cn / ), we annotated LOC_Os02g21310 and found it to be an expressed protein.
[0026] Therefore, the gene LOC_Os02g21310 was named NTFR2. In this example, NTFR2 (LOC_Os02g21310) was used as the target gene. Sequence amplification revealed that this gene contains only one exon. The specific CDS sequence is as follows:
[0027] The gene expression pattern of NTFR2 was predicted using the bioinformatics website eplant (https: / / bar.utoronto.ca / eplant / ), and it was found that NTFR2 was most highly expressed in young spikelet tissue. Figure 1 A). Therefore, the gene expression regulation pattern of the NTFR2 gene in tetraploid rice was first verified. Figure 1 B). Secondly, using the anthers of the wild-type material Huaduo No. 1 at various stages of reproductive development as templates, RT-qPCR was used to detect the gene expression of NTFR2 at each stage of anther development. The specific primers used for the NTFR2 gene were: NTFR2-QPCR-F: 5'-AGCTGAGACTGCAGGAACATCAG-3' (SEQ ID No. 4); NTFR2-QPCR-R: 5'-AGAATACCGAACCAACCTGCAC-3' (SEQ ID No. 5); The RT-qPCR reaction was prepared in a 20 μL system, containing 10 μL SYBR Mix, 0.4 μL NTFR2-QPCR-F (10 μM), 0.4 μL NTFR2-QPCR-R (10 μM), 2 μL cDNA template, and 7.2 μL RNase / DNase-free water. The PCR reaction program was set as follows: 95℃ pre-denaturation for 30 s, followed by 40 cycles of amplification (95℃ denaturation for 10 s, 58℃ extension for 20 s). After the cycles, melting curve analysis was performed at 65℃ to 95℃. To ensure the reliability and reproducibility of the experimental results, a negative control was set up for each RT-qPCR, and three technical replicates and three biological replicates were set up for each target gene.
[0028] The results showed that NTFR2 was expressed in the anthers of the novel tetraploid rice during interphase of meiosis, meiosis I during prophase II, meiosis II, and the microspore stage. These results were largely consistent with the predicted pattern. Figure 1 (B) The above research results indicate that the expression level of the NTFR2 gene in reproductive organs is at a high level, further verifying the function of the target gene.
[0029] Example 2: Verification of NTFR2 function using gene knockout To clarify the function of NTFR2 in a novel tetraploid rice, this study used the novel tetraploid rice variety Huaduo 1 as the research material and knocked out the NTFR2 gene using gene editing technology. Specifically, for the NTFR2 gene, one site was selected as the target, and a CRISPR / Cas9-based sgRNA sequence was designed [target site: 5'-CATGATGACCGCTCTGTCCC-3' (SEQ ID No. 1)]. The sgRNA sequence containing the target site was then used to knock out the target site. (TTCAGAGGTCTCTNNNNNNNTGGAATCGGGCAGCAAAGGATTTTTTCCTGTAGTTTTCCCACAACCATTTTTTACCATCCGAATGATAGGATAGGAAAAATATCCAAGTGAACAGTATTCCTATAAAATTCCCGTAAAAAGCCTGCAATCCGAATGAGCCCTGAAGTCTGAACTAGCCGGTCACCTGTACAGGCTATCGAGATGCCATACAAGAGACGGTAGTAGGAACTAGGAAGACGATGG TTGATTCGTCAGGCGAAATCGTCGTCCTGCAGTCGCATCTATGGGCCTGGACGGAATAGGGGAAAAAGTTGGCCGGATAGGAGGGAAAGGCCCAGGTGCTTACGTGCGAGGTAGGCCTGGGCTCTCAGCACTTCGATTCGTTGGCACCGGGGTAGGATGCAATAGAGAGCAACGTTTAGTACCACCTCGCTTAGCTAGAGCAAACTGGACTGCCTTATATGCGCGGGTGCTGGCTTGGCTGCCG CATGATGACCGCTCTGTCCCA DNA fragment (SEQ ID No. 2; where the underlined portion is the sgRNA sequence) was ligated into a vector carrying CRISPR / Cas9 (the pYLCRISPR / Cas9 Pubi-H binary vector system provided by Academician Liu Yaoguang's laboratory at the College of Agriculture, South China Agricultural University, available from Addgene). The novel tetraploid rice variety Huaduo 1 was then transformed using Agrobacterium-mediated transformation. Sanger sequencing was used to identify positive transgenic plants starting from generation T0. By generation T2, two independent transgenic knockout positive plants were obtained, with mutation types of homozygous mutations of base insertion and large fragment deletion, named ntfr2-1 and ntfr2-2, respectively. The mutant ntfr2-1 has a 25-base insertion at the target site, located 323 bp after the start codon ATG in the CDS region (the specific insertion sequence is: 5'-TCAACCTCTGCACGGGCGAGCGCCC-3'; SEQ ID No. 6). The mutant ntfr2-2 has a 134-base deletion near the target site, located 234-367 bp after the start codon ATG in the CDS region (the specific deletion sequence is: 5'-GCCGGACAACGCCCGCGGCGCGCGCTTCTGCGGCGCCCACCTTGAAGGTTGGGTCGCCGCCGCCGAGATTCCGCATGATGACCGCTCTGTCCCGGGGAATCGTGCCCCCGCTCTGCTCAACCTCTGCACCGGCG-3'; SEQ ID No. 7). Both mutations lead to premature termination of NTFR2 protein translation.
[0030] Phenotypic analysis of the NTFR2 gene knockout homozygous mutant and the wild-type Huaduo 1 revealed that, compared with the wild type, the main spike length and effective spike number of the NTFR2 gene knockout mutants ntfr2-1 and ntfr2-2 did not show significant changes. Figure 2 BG, Figure 2 IJ). However, its fruit setting rate showed a significant decline (IJ). Figure 2 BG, Figure 2 Compared with the wild-type Huaduo 1, the seed setting rates of the gene knockout mutants ntfr2-1 and ntfr2-2 decreased by 35.63% and 32.24%, respectively.
[0031] The above results indicate that the rice NTFR2 gene regulates the fertility of a novel tetraploid rice, and its loss of function leads to a decrease in the seed setting rate of the novel tetraploid rice.
[0032] Example 3: Observation and analysis of the fertility of rice pollen and embryo sac due to the knockout mutant ntfr2 To verify the fertility differences between the mutant ntfr2 and the wild-type Huaduo 1, pollen fertility, mature anthers, pollen grains, and embryo sacs of the mutant ntfr2 and the wild-type were observed using KI-I2 and WE-CLSM (global eosin B staining transparent laser scanning confocal microscope) techniques (specific observation methods refer to "Fan, Hao, et al. "Cytological observation and transcriptome analysis reveal that NTFR1 is a new tetraploidrice fertility gene using the tetraploid fertility-directed lines." PlantScience 355 (2025): 112437."). The pollen fertility and mature embryo sac abortion were summarized. Figure 3 and Figure 4 ).
[0033] The results showed that, compared with the wild-type Huaduo No. 1, ntfr2 had no significant differences in pollen fertility, mature anthers, and pollen grains. Figure 3 AI). The fertility of the embryo sacs of mutant ntfr2 and wild-type ntfr2 was observed using WE-CLSM technology. The results showed that the abnormal frequency of mature embryo sacs in mutant ntfr2 was as high as 57.5%, while the abnormal frequency in Huaduo 1 was 26.15%. Compared with wild-type Huaduo 1, the fertility of mature embryo sacs in mutant ntfr2 decreased by an average of 31.35%, with the main abnormal embryo sacs being small coelent sacs and developmental degeneration. Figure 4 AI).
[0034] The above research results indicate that NTFR2 does indeed participate in the regulation of fertility in novel tetraploid rice, and it mainly affects the fertility of novel tetraploid rice by participating in the regulation of embryo sac development.
[0035] The embodiments of the present invention have been described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention, and these variations still fall within the protection scope of the present invention.
Claims
1. The application of gene NTFR2 (LOC_Os02g21310) in regulating the fertility of a novel tetraploid rice, characterized in that, After the NTFR2 gene is lost, the seed setting rate and embryo sac fertility of the new tetraploid rice decrease.
2. The application according to claim 1, characterized in that, The novel tetraploid rice includes the novel tetraploid rice variety Huaduo No.
1.
3. A method for regulating the fertility of a novel tetraploid rice variety, characterized in that, By using genetic engineering techniques, the NTFR2 gene (LOC_Os02g21310) in rice was knocked out or reduced, resulting in the loss of gene function and thus achieving a targeted reduction in rice embryo sac fertility.
4. The method for regulating the fertility of a novel tetraploid rice according to claim 3, characterized in that, Using the NTFR2 gene (LOC_Os02g21310) as the target, a CRISPR / Cas9-based sgRNA sequence was designed. A DNA fragment containing the sgRNA sequence was ligated into a vector carrying CRISPR / Cas9, and then transformed into rice to induce the loss of NTFR2 gene function, resulting in a decrease in rice embryo sac fertility, thereby obtaining transgenic rice material with the loss of NTFR2 gene function.
5. The method for regulating the fertility of a novel tetraploid rice according to claim 3, characterized in that, The site of action of the sgRNA sequence is shown in SEQ ID No.
1.
6. The method for regulating the fertility of a novel tetraploid rice according to claim 3, characterized in that, The DNA fragment containing the sequence encoding the sgRNA is shown in SEQ ID No.
2.
7. The method for regulating the fertility of a novel tetraploid rice according to claim 3, characterized in that, Vectors carrying CRISPR / Cas9 include the pYLCRISPR / Cas9 Pubi-H binary vector system.
8. The application of transgenic rice materials cultivated using the method described in any one of claims 3-7 in rice breeding.
9. The application according to claim 8, characterized in that, The methods for rice breeding include transgenic, hybridization, backcrossing, self-pollination, or asexual reproduction.