Application of ZmHSCF1 protein and its encoding gene in regulating callus proliferation and plant regeneration

By using ZmHSCF1 protein and related biological materials, the genotype dependence problem in Agrobacterium-mediated transformation was solved, the efficiency of plant genetic transformation was improved, and the efficient transformation of maize breeding parents and the creation of new breeding materials were promoted.

CN122104798APending Publication Date: 2026-05-29CHINA AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610257929.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2025-03-11
Filing Date
2026-03-04
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Agrobacterium-mediated plant transformation is genotype-dependent, resulting in low breeding efficiency, difficulty in achieving the transfer of a single target gene, and potential alteration of desirable traits in breeding parents, thus affecting breeding outcomes.

Method used

By utilizing ZmHSCF1 protein and related biological materials, Agrobacterium-mediated transformation can be used to promote the formation and proliferation of plant explant callus and improve genetic transformation efficiency. This includes using recombinant vectors and recombinant microorganisms containing ZmHSCF1 protein or its encoding gene, expression cassettes, promoters, etc., to achieve genotype-independent genetic transformation.

Benefits of technology

It significantly improved the callus emergence rate, callus area, and regeneration efficiency of plant explants, broke through the genotype-dependent bottleneck, and achieved efficient genetic transformation of maize breeding parents that are difficult to transform, thus promoting the genetic transformation of commercial variety parents and the rapid and precise creation of new breeding materials.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application discloses ZmHSCF1 protein and application of an encoding gene thereof in regulation of callus proliferation and plant regeneration. ZmHSCF1 It is found through agrobacterium infection of maize young embryos by using a vector containing an expressible ZmHSCF1 The overexpression of the gene can promote callus formation and proliferation, and can significantly improve the callus formation rate, the proportion of resistant callus, the regeneration efficiency and the transformation efficiency, and especially, the obtaining of transgenic positive genetic materials of a maize breeding parent, a difficult-to-transform inbred line, is realized. The application has important significance for improving the transformation efficiency and the number of high-quality transformants of plants, especially important maize breeding parents and other stubborn maize inbred lines, and for realizing more accurate, rapid and low-cost creation of breeding new materials by using agrobacterium-mediated transgenic or gene editing dominant molecular design breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering and transgenic technology, specifically relating to the application of ZmHSCF1 protein and its encoding gene in regulating callus proliferation and plant regeneration. Background Technology

[0002] With the advent of the Molecular Breeding 4.0 era, the use of biotechnologies, including transgenics, gene editing, and diffraction techniques, for targeted, precise, and rapid design, improvement, and creation of new crop lines has become a major approach to addressing the balance between population, resources, environment, and food security. From PEG-mediated transformation, gene gun methods, Agrobacterium-mediated transformation, pollen tube introduction, to nanomagnetic bead methods, plant transformation methods have continuously evolved. However, Agrobacterium-mediated transformation remains the most widely used transformation method in transgenics and gene editing due to its ease of operation, low cost, good genetic stability, and mature and relatively stable system.

[0003] However, the genotype dependence of Agrobacterium-mediated transformation recipients remains a bottleneck for the further application of this method in modern agricultural breeding based on molecular design breeding. Even with relatively stable and efficient genetic transformation systems, recipient genotypes still require multiple generations of backcrossing with superior parents due to issues such as poor agronomic traits. However, backcrossing efficiency is limited by the genetic distance between the target gene and the desirable traits, and the process is time-consuming and labor-intensive. More importantly, it is difficult to achieve the transfer of a single target gene, which may alter one or more desirable traits in the breeding parents, affecting breeding outcomes. Therefore, breaking down the genotype dependence barrier, avoiding backcrossing, and establishing a crop genetic transformation system using commercially available inbred lines as transformation recipients will greatly facilitate the better application of modern biotechnologies such as transgenics, gene editing and its derivatives, and synthetic biology in molecular design breeding, providing technical support for the efficient creation of new breeding materials. Summary of the Invention

[0004] The technical problem to be solved by this invention is how to promote the formation or proliferation of plant callus tissue and improve the efficiency of plant genetic transformation. The technical problem to be solved is not limited to the described technical subject matter; other technical subject matter not mentioned herein will be clearly understood by those skilled in the art through the following description.

[0005] To address the aforementioned technical problems, this invention first provides a novel use for the ZmHSCF1 protein.

[0006] This invention provides the use of the ZmHSCF1 protein in any of the following (A1)-A14):

[0007] A1) Promotes the formation of callus tissue in plant explants; A2) Prepare products that promote the formation of callus in plant explants; A3) Promotes the proliferation of callus tissue in plant explants; A4) Prepare products that promote the proliferation of callus tissue in plant explants; A5) Increase the proportion of positive callus for the target gene in plant explants; A6) Prepare products that increase the proportion of positive callus for the target gene in plant explants; A7) Improve plant regeneration ability; A8) Prepare products that enhance plant regeneration capabilities; A9) Improve the efficiency of plant genetic transformation; A10) Prepare products that improve the efficiency of plant genetic transformation; A11) Plant genetic transformation; A12) Preparation of plant genetic transformation products; A13) Plant breeding; A14) Preparation of plant breeding products; The ZmHSCF1 protein is a1), a2), a3), or a4). a1) The amino acid sequence of the protein is shown in sequence 4; a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in sequence 4; a3) Proteins obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 4, which are related to the efficiency of plant callus formation or regeneration or genetic transformation. a4) Proteins that have 90% or more identity with the amino acid sequence shown in Sequence 4, are derived from maize, and are associated with plant callus formation or regeneration or genetic transformation efficiency.

[0008] Sequence 4 consists of 485 amino acid residues.

[0009] In the protein described in a2) above, the tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The tag includes, but is not limited to: GST (glutathione thiotransferase) tag protein, His6 tag protein (His-tag), MBP (maltose-binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tag protein.

[0010] In some embodiments, the fusion protein is formed by fusing DsRed fluorescent protein and ZmHSCF1 protein.

[0011] In the protein described in a3) above, the substitution and / or deletion and / or addition of one or more amino acid residues is no more than 10 or 9 or 8 or 7 or 6 or 5 or 4 or 3 or 2 or 1 amino acid residues.

[0012] In the protein described in a4) above, the identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambdaratio to 11, 1, and 0.85 (default values) respectively, and performing an identity calculation for a pair of amino acid sequences, the identity value (%) can then be obtained. The identity includes amino acid sequences having 90% or higher, or 91% or higher, or 92% or higher, or 93% or higher, or 94% or higher, or 95% or higher, or 96% or higher, or 97% or higher, or 98% or higher, or 99% or higher identity with the amino acid sequence shown in Sequence 4 of this invention.

[0013] The proteins described in a1), a2), a3), or a4) above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0014] To address the aforementioned technical problems, this invention provides new applications for biomaterials related to the ZmHSCF1 protein.

[0015] This invention provides the use of biomaterials related to the ZmHSCF1 protein in any of the following A1)-A14): A1) Promotes the formation of callus tissue in plant explants; A2) Prepare products that promote the formation of callus in plant explants; A3) Promotes the proliferation of callus tissue in plant explants; A4) Prepare products that promote the proliferation of callus tissue in plant explants; A5) Increase the proportion of positive callus for the target gene in plant explants; A6) Prepare products that increase the proportion of positive callus for the target gene in plant explants; A7) Improve plant regeneration ability; A8) Prepare products that enhance plant regeneration capabilities; A9) Improve the efficiency of plant genetic transformation; A10) Prepare products that improve the efficiency of plant genetic transformation; A11) Plant genetic transformation; A12) Preparation of plant genetic transformation products; A13) Plant breeding; A14) Preparation of plant breeding products; The biomaterial is a nucleic acid molecule encoding the ZmHSCF1 protein or an expression cassette, recombinant vector, or recombinant microorganism containing the nucleic acid molecule.

[0016] The nucleic acid molecule is a gene as shown in B1) or B2) below: B1) The DNA molecule shown in sequence 2 or sequence 3; B2) has 75% or more identity with the nucleotide sequence defined in B1) and is a DNA molecule encoding the ZmHSCF1 protein described above.

[0017] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0018] Those skilled in the art can readily mutate the nucleotide sequence encoding the ZmHSCF1 protein of the present invention using known methods, such as directed evolution and point mutation. Artificially modified nucleotides that possess 75% or higher identity to the nucleotide sequence encoding the ZmHSCF1 protein, as long as they encode the ZmHSCF1 protein and have the same function, are derived from and equivalent to the nucleotide sequence of the present invention.

[0019] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence of a protein constituting the amino acid sequence shown in Sequence 4 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0020] The aforementioned 75% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.

[0021] In the above applications, the expression cassette refers to DNA capable of expressing the ZmHSCF1 protein in host cells, and this DNA may include not only the promoter but also... ZmHSCF1 The promoter of transcription may also include a terminator. ZmHSCF1 Transcription terminators. Further, the expression cassette may also include enhancer sequences. Promoters that can be used in this invention include, but are not limited to: constitutive promoters; tissue-, organ-, and development-specific promoters; and inducible promoters. Suitable transcription terminators include, but are not limited to: Agrobacterium carmine synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and carmine and octopine synthase terminator.

[0022] In the above applications, the vector can be a plasmid, granule, bacteriophage, or viral vector. The recombinant vector can be constructed using existing plant expression vectors containing... ZmHSCF1 Vectors for gene expression cassettes. These plant expression vectors include binary Agrobacterium vectors and vectors suitable for plant microbombardment, such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, or pCAMBIA1391-Xb. The plant expression vectors may also contain the 3' untranslated region of a foreign gene, i.e., a polyadenylated signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylated signal can guide the addition of polyadenylated acid to the 3' end of the mRNA precursor, such as Agrobacterium crown gall tumor inducing (Ti) plasmid genes (e.g., carmine synthase genes). Nos The untranslated regions transcribed at the 3' end of plant genes (such as soybean storage protein genes) have similar functions. When constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes encoding enzymes or luminescent compounds that can be expressed in plants (e.g., those encoding enzymes that produce color changes). GUS Genes, luciferase genes, etc.), antibiotic marker genes (such as those conferring resistance to kanamycin and related antibiotics). nptII Genes that confer resistance to the herbicide phosphinic acid bar Genes that confer resistance to the antibiotic hygromycin hphGenes, and the genes that confer resistance to methotrexate dhfr Genes such as EPSPS genes (which confer resistance to glyphosate) or chemical reagent resistance marker genes (such as herbicide resistance genes), and mannose-6-phosphate isomerase genes that provide the ability to metabolize mannose, can be used. From a safety perspective, transgenic plants can be directly selected by stress screening without adding any selective marker genes.

[0023] In some implementations, the recombinant vector may be pCAMBAIA3300-ZmHSCF1 Overexpression vector. pCAMBAIA3300-ZmHSCF1 Overexpression vector is the overexpression vector pCAMBAIA3300 The DNA fragment replacement sequence between the two XcmI restriction sites in the DNA molecule is shown in 3. ZmHSCF1 (genes), and maintain overexpression vectors pCAMBAIA3300 The vector obtained by keeping the other sequences unchanged.

[0024] In some implementations, the recombinant vector may be pCAMBAIA3300-DsRed-ZmHSCF1 Overexpression vector. pCAMBAIA3300-DsRed-ZmHSCF1 Overexpression vector is an overexpression vector pCAMBAIA3300 The DNA fragment between the AvrII and SpeI restriction sites in the expression vector was replaced with the DNA molecule shown in sequence 5, while maintaining the overexpression vector. pCAMBAIA3300 The vector obtained by keeping the other sequences unchanged.

[0025] In the above applications, the microorganisms can be bacteria, fungi, actinomycetes, protozoa, algae, or viruses. Among them, the bacteria can be from the genus *Escherichia* (…). Escherichia sp. Erwinia ( ) Erwinia sp. ), Agrobacterium ( Agrobacterium sp. Flavobacterium ( Flavobacterium sp. ), Alcaligenes ( Alcaligenes sp. ), Pseudomonas spp. Pseudomonas sp. ), Bacillus spp. ( Bacillus sp. Examples of bacteria include, but are not limited to, Escherichia coli (E. coli). Escherichia coli Bacillus subtilis ( Bacillus subtilis ) or Bacillus pumilus ( Bacillus pumilus The fungus may be a yeast, and the yeast may be from the genus *Saccharomyces* (such as *Saccharomyces cerevisiae*). Saccharomyces cerevisiae Kluyveromyces (such as Kluyveromyces lactis) Kluyveromyces lactis Pichia genus (such as Pichia pastoris) Pichia pastoris ), genus *Schizosaccharomyces* (such as *Schizosaccharomyces cerevisiae*) Schizosaccharomyces pombe ), Hansenula genus (such as polymorphic Hansenula) Hansenula polymorpha And, but not limited to, these. The fungi may also originate from the genus *Fusarium* (…). Fusarium sp. ), Rhizoctonia spp. ( Rhizoctonia sp.Verticillium ( Verticillium sp. ), Penicillium ( Penicillium sp. Aspergillus ( ) Aspergillus sp. ), Cephalosporium ( Cephalosporium sp. Actinomycetes may be derived from Streptomyces (…), but are not limited to these. Streptomyces sp. Nocardia ( ) Nocardia sp. Micromonospora ( Micromonospora sp. ), genus *Neurospora* Streptosporangium sp. ), genus Actinomycetes ( Actinoplanes sp. ), thermophilic actinomycetes ( Thermoactinomyces sp. (e.g., but not limited to these). The algae mentioned may come from the genus *Fucus* (…). Fucus sp. ), genus *Cyclocarya* ( Achnanthes sp. ), genus *Codonopsis* ( Amphiprora sp. ), genus Dipterocarpa ( Amphora sp. ), Fiber Algae ( Ankistrodesmus sp. ), genus *Stellaria* ( Asteromonas sp. ), Golden-colored algae ( Boekelovia sp. The viruses mentioned may include, but are not limited to, rotavirus, herpesvirus, influenza virus, adenovirus, etc.

[0026] The recombinant microorganisms refer to those obtained by manipulating and modifying the genes of a target microorganism, resulting in a functional change. For example, recombinant microorganisms obtained after introducing the aforementioned recombinant vector into the target microorganism. The term "recombinant microorganism" can be understood not only to a specific recombinant microorganism but also to the offspring of such cells. Due to natural, accidental, or intentional mutations and / or alterations, the offspring may not necessarily be completely identical to the original parent cell, but are still included within the scope of recombinant microorganisms.

[0027] In some embodiments, the recombinant microorganism contains the above-mentioned... pCAMBAIA3300-ZmHSCF1 Agrobacterium EHA105 overexpression vector.

[0028] In some embodiments, the recombinant microorganism contains the above-mentioned... pCAMBAIA3300-DsRed-ZmHSCF1 Agrobacterium EHA105 overexpression vector.

[0029] The genetic transformation described above is Agrobacterium-mediated genetic transformation.

[0030] To address the aforementioned technical problems, this invention also provides an Agrobacterium-mediated plant genetic transformation method.

[0031] The Agrobacterium-mediated plant genetic transformation method provided by the present invention includes the following steps: infecting plant explants with Agrobacterium containing a target vector to obtain infected explants; the target vector expresses the above-mentioned ZmHSCF1 protein.

[0032] In the above method, the target vector can also express the target protein. The number of target proteins can be one, two, or more. The target protein can be an endogenous plant protein or an exogenous protein (such as DsRed protein).

[0033] The number of target vectors can be one, two, or more. The target protein and the ZmHSCF1 protein can be expressed using one target vector or using multiple different target vectors respectively.

[0034] In some embodiments, the target protein is a protein that can increase plant yield, stress tolerance, or disease resistance.

[0035] In some implementations, the target protein is DeRed fluorescent protein.

[0036] In some implementations, the target carrier is as described above. pCAMBAIA3300-ZmHSCF1 Overexpression vector or the above pCAMBAIA3300-DsRed-ZmHSCF1 Overexpression vector.

[0037] In some embodiments, the Agrobacterium containing the target vector is an organism containing the above-mentioned... pCAMBAIA3300- ZmHSCF1 Overexpression vector or the above pCAMBAIA3300-DsRed-ZmHSCF1 Agrobacterium EHA105 overexpression vector.

[0038] The above method also includes the step of culturing the infected explants to obtain regenerated plants. The culturing method can refer to the method in the literature "Liu S, Qiao J, Zhang S, Lu M, Yang Y, Lai J, Guo Y, Shi Y. Application of uniconazole in improving the high-throughput genetic transformation efficiency in maize. Plant Sci. 2024 Dec;349:112270. doi:10.1016 / j.plantsci.2024.112270. Epub 2024 Sep 28. PMID: 39349145."

[0039] In some implementations, the cultivation method may include the following steps: 1) The infected explants were cultured in a co-culture medium to obtain co-cultured explants; 2) The co-cultured explants were cultured in a resistance selection medium to obtain resistant callus; 3) The resistant callus was cultured in a predifferentiation medium to obtain callus blocks with regenerated buds; 4) The callus tissue blocks with regenerated buds are cultured in a differentiation medium to obtain differentiated seedlings or tissue blocks with leaves. 5) The differentiated seedlings or tissue blocks with leaves are cultured in a differentiation subculture medium to obtain resistant regenerated plants; 6) The resistant regenerated plants are cultured in a rooting medium to obtain regenerated plants.

[0040] In some implementations, the explant is a maize embryo.

[0041] To address the aforementioned technical problems, the present invention also provides new applications for the above-mentioned methods.

[0042] This invention provides the application of the above method in any of the following B1)-B6): B1) Promotes the formation of callus tissue in plant explants; B2) Promotes the proliferation of callus tissue in plant explants; B3) Increase the proportion of positive callus for the target gene in plant explants; B4) Improve plant regeneration ability; B5) Improve the efficiency of plant genetic transformation; B6) Plant breeding.

[0043] The promotion of callus formation in plant explants as described above is manifested in increasing the callus emergence rate of plant explants.

[0044] The above-mentioned promotion of plant explant callus proliferation is manifested in increasing the area of ​​callus formed by plant explants.

[0045] The aforementioned increase in the proportion of positive callus for the target gene in plant explants is reflected in the increase in the proportion of resistant callus in plant explants.

[0046] The improvement of plant regeneration capacity described above is reflected in the improvement of plant regeneration efficiency.

[0047] The calculation methods for the above-mentioned callus formation rate, the above-mentioned resistant callus ratio, the above-mentioned regeneration efficiency, and the above-mentioned transformation efficiency can all refer to the literature "Liu S, Shi Y, Liu F, Guo Y, Lu M. LaCl3 treatment improves..." AgrobacteriumMethods in -mediated immature embryo genetic transformation frequency of maize. Plant Cell Rep. 2022 Jun;41(6):1439-1448. doi: 10.1007 / s00299-022-02867-w. Epub 2022 Apr 4. PMID: 35376997."

[0048] The above-described plant genetic transformations are genotype-independent plant genetic transformations.

[0049] The plants mentioned above can be dicotyledonous or monocotyledonous.

[0050] Furthermore, the monocotyledonous plant may be maize.

[0051] Furthermore, the maize includes maize breeding parent backbone inbred lines that are difficult to convert.

[0052] In some implementations, the maize is a maize inbred line LH244, PH4CV, or Zheng58.

[0053] This invention utilizes expressible ZmHSCF1 Agrobacterium vectors infecting immature maize embryos revealed differences in expression compared to those without. ZmHSCF1 Compared to the control vector, overexpression of the gene ZmHSCF1 The explant callus emergence rate of the gene was significantly increased, the callus area was significantly larger, the proportion of resistant callus was significantly increased, and the regeneration and transformation efficiency were significantly improved. In particular, it enabled the acquisition of transgenic positive genetic material from maize breeding parents, a backbone inbred line that is difficult to transform. This invention is the first to discover overexpression... ZmHSCF1 Genes can promote the formation of callus in explants, especially positive callus, thereby enabling the regeneration of recipient genotypes that are difficult to transform, thus overcoming the genotype-dependent bottleneck mediated by Agrobacterium. This invention not only facilitates the genetic transformation of commercially available parental inbred lines currently promoted in agricultural production, but also effectively avoids the long-term backcrossing barrier after transformation with non-breeding parental recipients. It is of great significance for improving the transformation efficiency and the number of high-quality transformants in plants, especially resilient maize inbred lines that are difficult to transform, as well as for creating new breeding materials more accurately, rapidly, and at low cost through Agrobacterium-mediated transgenic or gene-editing-led molecular design breeding. Attached Figure Description

[0054] Figure 1 This is a schematic diagram of the vector structure. A represents overexpression. DsRedSchematic diagram of the control vector structure for the gene. B represents overexpression. ZmHSCF1 Schematic diagram of gene vector structure. C represents simultaneous overexpression. DsRed Genes and ZmHSCF1 A schematic diagram of the vector structure of a gene. D represents... ZmHSCF1 A schematic diagram of the gene-editing vector for gene knockout.

[0055] Figure 2 Phenotypic and statistical analysis results of ZmHSCF1 regulation of callus formation and proliferation. A shows the callus phenotypes after 1 day of co-culture and 20 days of screening culture. B shows the statistical results of callus emergence rate. C shows the statistical results of callus area.

[0056] Figure 3 The results of phenotypic and statistical analysis of the proportion of resistant callus regulated by ZmHSCF1 are shown. A shows the observation results of RFP-positive callus after 14 days of screening culture under a microscope. B shows the statistical results of the proportion of RFP-positive callus.

[0057] Figure 4 Phenotypic and statistical analysis results of ZmHSCF1-regulated regeneration capacity. A shows the callus phenotype after 20 days of differentiation culture. B shows the statistical results of regeneration efficiency.

[0058] Figure 5 This study demonstrates how ZmHSCF1 achieves genotype-independent genetic transformation by regulating the formation of resistant callus in maize backbone inbred lines. A shows the callus phenotype and microscopic observation results after 20 days of screening culture (PH4CV). B shows the callus phenotype and microscopic observation results after 20 days of screening culture (Zheng 58). C shows the callus emergence rate. D shows the proportion of resistant callus. E shows PH4CV regenerated plants and T0 generation bar-positive seedlings. F shows Zheng 58 regenerated plants and T0 generation bar-positive seedlings. G shows the transformation efficiency. Detailed Implementation

[0059] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0060] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0061] The maize inbred line LH244 in the following examples is described in the literature “Yue Yang, Jianxin Shi, Limei Chen, Wenhan Xiao, Jingjuan Yu, ZmEREB46, a maize ortholog of Arabidopsis WAXINDUCER1 / SHINE1, is involved in the biosynthesis of leaf epicuticular very-long-chain waxes and drought tolerance, Plant Science, Volume 321, 2022, 111256, ISSN 0168-9452.”

[0062] The maize inbred line PH4CV in the following examples is described in the literature “Xiaoping Gong, Xiaoyang Liu, Qingchun Pan, Guohua Mi, Fanjun Chen and Lixing Yuan, Combined physiological, transcriptome, and genetic analysis reveals a molecular network of nitrogen remobilization in maize, Journal of Experimental Botany, Volume 71, May 2020, Pages 5061–5073”.

[0063] The maize inbred line Zheng58 in the following examples is described in the literature “Yang Z, Li X, Zhang N, ZhangYN, Jiang HW, Gao J, Kuai BK, Ding YL, Huang XQ. Detection of quantitative trait loci for kernel oil and protein concentration in a B73 and Zheng58maize cross. Genet Mol Res. 2016 Sep 30;15(3). doi: 10.4238 / gmr.15038951.PMID: 27706793.”.

[0064] Escherichia coli in the following examples ( Escherichia coliThe DH5α(DE3) competent strain is a product of TransGen Biotech Ltd.

[0065] The Agrobacterium tumefaciens strain EHA105 in the following examples is described in the literature “Chen, S.; Songkumarn, P.; Liu, J.; Wang, G.-L. A Versatile Zero Background T-Vector System for GeneCloning and Functional Genomics. Plant Physiol. 2009, 150, 1111–1121.”

[0066] The overexpression vector pCAMBAIA3300 used in the following examples is described in the literature “Boxin Liu and others, Manipulating ZmEXPA4 expression ameliorates the drought-induced prolonged anthesis and silking interval in maize, The Plant Cell, Volume 33, Issue 6, June 2021, Pages 2058–2071, https: / / doi.org / 10.1093 / plcell / koab083.”

[0067] The carrier pBUE411 and intermediate carrier pCBC-MT1T2 in the following embodiments are both described in the literature "Xing, HL". # , Dong, L. # , Wang, ZP, Zhang, HY, Han, CY, Liu, B., Wang, XC, andChen, QJ (2014). A CRISPR / Cas9 toolkit for multiplex genome editing inplants. BMC Plant Biol 14, 327."

[0068] The culture medium, its components, and culture conditions involved in the Agrobacterium-mediated genetic transformation method for maize immature embryos in the following examples are all described in the literature "Liu S, Qiao J, Zhang S, Lu M, Yang Y, Lai J, Guo Y, Shi Y. Application of uniconazole in improving the high-throughput genetic transformation efficiency in maize. Plant Sci. 2024 Dec;349:112270. doi:10.1016 / j.plantsci.2024.112270. Epub 2024 Sep 28. PMID: 39349145."

[0069] The calculation methods and formulas for callus rate, RFP-positive callus ratio, regeneration efficiency, and transformation efficiency involved in the Agrobacterium-mediated genetic transformation of maize immature embryos in the following examples are all described in the literature "Liu S, Shi Y, Liu F, Guo Y, Lu M. LaCl3 treatment improves..." Agrobacterium -mediated immature embryogenetic transformation frequency of maize. Plant Cell Rep. 2022 Jun;41(6):1439-1448. doi: 10.1007 / s00299-022-02867-w. Epub 2022 Apr 4. PMID: 35376997."

[0070] Example 1, Control vector, ZmHSCF1 overexpression vectors and ZmHSCF1 Preparation of CRISPR / Cas9 vectors for target genes one, ZmHSCF1 Gene-related sequences The present invention relates to ZmHSCF1 The gene is derived from corn ( Zea may L.), whose sequence in the maize genome is shown in Sequence 2, which consists of 3086 nucleotides; ZmHSCF1 The CDS sequence of the gene is shown in Sequence 3, which consists of 1458 nucleotides; both Sequence 2 and Sequence 3 encode the ZmHSCF1 protein shown in Sequence 4, which consists of 485 amino acid residues.

[0071] II. Comparison with carriers ZmHSCF1 overexpression vectors andZmHSCF1 Preparation of CRISPR / Cas9 vectors for target genes 1. pCAMBAIA3300-DsRed Preparation of control vector overexpression vector pCAMBAIA3300 The DNA fragment between the two XcmI restriction sites in the sequence is replaced with the DNA molecule shown in Sequence 1 (red fluorescent gene). DsRed (as a reporter gene), and maintain overexpression vector pCAMBAIA3300 With the other sequences unchanged, we obtain pCAMBAIA3300-DsRed The vector serves as a control vector in genetic transformation experiments.

[0072] 2. pCAMBAIA3300-ZmHSCF1 Preparation of overexpression vectors overexpression vector pCAMBAIA3300 The DNA fragment replacement sequence between the two XcmI restriction sites in the DNA molecule is shown in 3. ZmHSCF1 (genes), and maintain overexpression vectors pCAMBAIA3300 With the other sequences unchanged, we obtain pCAMBAIA3300-ZmHSCF1 Overexpression vector.

[0073] 3. pCAMBAIA3300-DsRed-ZmHSCF1 Preparation of overexpression vectors overexpression vector pCAMBAIA3300 The DNA fragment between the AvrII and SpeI restriction sites in the expression vector was replaced with the DNA molecule shown in sequence 5, while maintaining the overexpression vector. pCAMBAIA3300 With the other sequences unchanged, we obtain pCAMBAIA3300- DsRed-ZmHSCF1 Overexpression vector. The DNA molecule shown in sequence 5 consists of a red fluorescent gene. DsRed Ubi promoter and ZmHSCF1 Genome composition.

[0074] 4. ZmHSCF1 CRISPR / Cas9 gene editing vectors targeting genes pBUE411-pCBC-MT1T2 Preparation ZmHSCF1 CRISPR / Cas9 gene editing vectors targeting genes pBUE411-pCBC-MTaTb The preparation method refers to the literature "Xing, HL". # , Dong, L. # , Wang, ZP, Zhang, HY, Han, CY, Liu, B., Wang, XC, and Chen, QJ (2014). A CRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol 14, 327. The specific steps are as follows: 1) According to ZmHSCF1 Gene sequences were used to design sgRNA target sequences, and two sgRNA targets were ultimately designed, denoted as Ta target and Tb target, respectively.

[0075] The target sequence for Ta is as follows: 5'-AGAAGGCTTCGAGTAGGCCA-3'.

[0076] The Tb target sequence is as follows: 5'-AGGCCCCCAGTACTTGAGCG-3'.

[0077] 2) Using restriction endonucleases BsaI The pBUE411 vector was digested with enzymes to obtain the digested vector. Four-primer amplification was performed using two pairs of primers with pCBC-MT1T2 as a template. The F0 and R0 primers were diluted tenfold from their working concentrations and subjected to PCR amplification. The ligation fragment was then recovered from the gel. The ligation fragment and the digested vector were then ligated using T4 ligase to obtain the recombinant plasmid. The recombinant plasmid was sent for sequencing, and the correctly sequenced recombinant plasmid was named... pBUE411-pCBC- MTaTb Recombinant plasmid pBUE411-pCBC-MTaTb Capable of expressing Cas9 protein and 2 target proteins ZmHSCF1 sgRNA of the gene, 2 targets ZmHSCF1 The target sites of the gene's sgRNA are Ta and Tb, respectively.

[0078] The two primer pairs are as follows: BsF:5'-ATATATGGTCTCTGGC AGAAGGCTTCGAGTAGGCCA GTT-3'.

[0079] F0: 5'-T AGAAGGCTTCGAGTAGGCCA GTTTTAGAGCTAGAAATAGC-3'.

[0080] Among them, the bolded bases are BsaI The identification site is marked with an underlined base as the Ta sequence (the reverse complementary sequence of the sequence shown at positions 72-91 of sequence 3).

[0081] R0: 5'-AAC AGGCCCCCAGTACTTGAGCG GCTTCTTGGTGCC-3'.

[0082] BsR:5'-ATTATTGGTCTCTAAAC AGGCCCCCAGTACTTGAGCG -3'.

[0083] Among them, the bolded bases are BsaI The identification site is marked with an underlined base as the Tb sequence (the reverse complementary sequence of the sequence shown at positions 569-588 in sequence 3).

[0084] Example 2: Application of ZmHSCF1 protein in regulating callus formation and proliferation I. Effects and Analysis of ZmHSCF1 Overexpression on Callus Formation and Proliferation The Agrobacterium-mediated genetic transformation of maize immature embryos was performed using the method described in the literature “Liu S, Qiao J, Zhang S, Lu M, Yang Y, Lai J, Guo Y, Shi Y. Application of uniconazole in improving the high-throughput genetic transformation efficiency in maize. Plant Sci. 2024 Dec;349:112270. doi: 10.1016 / j.plantsci.2024.112270. Epub 2024 Sep 28.PMID: 39349145.”. The recombinant vector prepared in Example 1 was then used to transform the maize immature embryos. pCAMBAIA3300-DsRed , pCAMBAIA3300-ZmHSCF1 and pBUE411-pCBC-MTaTb Transformation of maize inbred line LH244. Specifically, the steps include: [The text abruptly shifts to a different topic] ...the recombinant vector prepared in Example 1... pCAMBAIA3300-DsRed , pCAMBAIA3300-ZmHSCF1 and pBUE411- pCBC-MTaTb The bacteria were transferred into Agrobacterium tumefaciens strain EHA105, and after identification, recombinant Agrobacterium tumefaciens were obtained. pCAMBAIA3300- DsRed / EHA105、 pCAMBAIA3300-ZmHSCF1 / EHA105 and pBUE411-pCBC-MTaTb / EHA105. Using recombinant Agrobacterium... pCAMBAIA3300-DsRed / EHA105、 pCAMBAIA3300-ZmHSCF1 / EHA105 and pBUE411- pCBC-MTaTb / EHA105 infection was performed on maize embryos (approximately 1.5 mm in size) 12 days after pollination. After Agrobacterium infection, the embryos were placed on a co-culture medium with the scutellum facing upwards, 30 embryos per dish. After culturing for 1 day, ... Figure 2 As shown, the cells were transferred to a selection medium containing bar resistance and cultured for 14 days to observe the transformation. pCAMBAIA3300-DsRed , pCAMBAIA3300-ZmHSCF1 and pBUE411-pCBC-MTaTbThe callus tissue was analyzed, and the callus rate and callus area were calculated. The transformation... pCAMBAIA3300-DsRed The callus tissue of the carrier is denoted as DsRed OE , transformation pCAMBAIA3300-ZmHSCF1 The callus tissue of the carrier is denoted as ZmHSCF1 OE , transformation pBUE411-pCBC-MTaTb The callus tissue of the carrier is denoted as zmhscf1 CRSIPR .

[0085] The results are as follows Figure 2 As shown in A and 2B, the results indicate that: [The text abruptly ends here, likely due to an incomplete pCAMBAIA3300-DsRed The vector served as a control, and the transformation was performed. pCAMBAIA3300-ZmHSCF1 The cure rate after carrier treatment significantly increased from 91.7% to 97.8%, while the transformation rate... pBUE411-pCBC- MTaTb The healing rate after carrier treatment significantly decreased to 91.9%. Furthermore, the statistical results of the callus area are as follows: Figure 2 As shown in C, the results indicate that: [The text abruptly ends here, likely due to an incomplete sentence or a format pCAMBAIA3300-DsRed The vector served as a control, and the transformation was performed. pCAMBAIA3300-ZmHSCF1 The callus area after carrier treatment increased from 1.20 cm². 2 Significantly increased by 1.60cm 2 , and transformation pBUE411-pCBC-MTaTb The callus area after carrier treatment was significantly reduced to 1.10 cm. 2 This indicates that overexpression of ZmHSCF1 can promote callus formation.

[0086] II. Effects and Analysis of ZmHSCF1 Overexpression on Positive Callus Formation The Agrobacterium-mediated genetic transformation of maize immature embryos was performed using the method described in the literature “Liu S, Qiao J, Zhang S, Lu M, Yang Y, Lai J, Guo Y, Shi Y. Application of uniconazole in improving the high-throughput genetic transformation efficiency in maize. Plant Sci. 2024 Dec;349:112270. doi: 10.1016 / j.plantsci.2024.112270. Epub 2024 Sep 28.PMID: 39349145.”. The recombinant vector prepared in Example 1 was then used to transform the maize immature embryos. pCAMBAIA3300-DsRed and pCAMBAIA3300-DsRed-ZmHSCF1 Transformation of maize inbred line LH244. Specifically, the steps include: [The text abruptly shifts to a different topic] ...the recombinant vector prepared in Example 1... pCAMBAIA3300-DsRed and pCAMBAIA3300-DsRed-ZmHSCF1The bacteria were transferred into Agrobacterium tumefaciens strain EHA105, and after identification, recombinant Agrobacterium tumefaciens were obtained. pCAMBAIA3300-DsRed / EHA105 and pCAMBAIA3300- DsRed-ZmHSCF1 / EHA105. Using recombinant Agrobacterium... pCAMBAIA3300-DsRed / EHA105 and pCAMBAIA3300-DsRed-ZmHSCF1 / EHA105 infection was performed on maize embryos (approximately 1.5 mm in size) 12 days after pollination. After Agrobacterium infection, the embryos were placed on a co-culture medium with the scutellum facing upwards, 30 embryos per dish. After culturing for 1 day, ... Figure 2 The transformed recombinant vector was transferred to a selection medium containing bar resistance as shown in the diagram, and cultured for 14 days. The vector was then observed using a fluorescence microscope. pCAMBAIA3300-DsRed and pCAMBAIA3300-DsRed-ZmHSCF1 The transient expression of RFP in callus tissue was analyzed, and the proportion of RFP-positive callus was statistically analyzed. The transformation... pCAMBAIA3300-DsRed The callus tissue of the carrier is denoted as DsRed OE , transformation pCAMBAIA3300-DsRed-ZmHSCF The callus tissue of the carrier is denoted as ZmHSCF1 OE .

[0087] The results are as follows Figure 3 As shown, the results indicate that: [The text abruptly ends here, likely due to an incomplete translation or a formatting error pCAMBAIA3300-DsRed The vector served as a control, and the transformation was performed. pCAMBAIA3300-DsRed-ZmHSCF1 Transient expression of RFP in callus was significantly enhanced after vector administration, and the proportion of RFP-positive callus increased significantly from 30.3% to 51.5%. This indicates that overexpression of ZmHSCF1 can promote the formation of positive callus tissue.

[0088] III. Effects and Analysis of ZmHSCF1 Overexpression on Callus Differentiation Capacity The callus tissue formed after 14 days of culture in the selection medium containing bar resistance in step one was transferred to the pre-differentiation medium containing bar resistance. After 12 days of culture, the callus tissue was transferred to the differentiation medium containing bar resistance. After 20 days of culture, the transformation recombinant vector was observed. pCAMBAIA3300-DsRed , pCAMBAIA3300-ZmHSCF1 and pBUE411-pCBC-MTaTb The differentiation of callus tissue was analyzed and the regeneration efficiency was statistically determined.

[0089] The results are as follows Figure 4 As shown, the results indicate that: [The text abruptly ends here, likely due to an incomplete translation or a formatting error pCAMBAIA3300-DsRed The vector served as a control, and the transformation was performed. pCAMBAIA3300-ZmHSCF1 The regeneration efficiency of callus tissue was significantly enhanced after carrier administration, increasing from 10.9% to 14.8%; while the transformation... pBUE411-pCBC-MTaTbAfter vector administration, the callus differentiation capacity decreased, and the regeneration efficiency significantly decreased to 7.1%. This indicates that overexpression of ZmHSCF1 can improve the callus differentiation capacity and regeneration efficiency by promoting the formation and proliferation of positive callus tissue.

[0090] IV. Effects and Analysis of ZmHSCF1 Overexpression on Transformation Efficiency of Difficult-to-Transform Maize Breeding Parent Backbone Inbred Lines The Agrobacterium-mediated genetic transformation of maize immature embryos was performed using the method described in the literature “Liu S, Qiao J, Zhang S, Lu M, Yang Y, Lai J, Guo Y, Shi Y. Application of uniconazole in improving the high-throughput genetic transformation efficiency in maize. Plant Sci. 2024 Dec;349:112270. doi: 10.1016 / j.plantsci.2024.112270. Epub 2024 Sep 28.PMID: 39349145.”. The recombinant vector prepared in Example 1 was then used to transform the maize immature embryos. pCAMBAIA3300-DsRed and pCAMBAIA3300-DsRed-ZmHSCF1 The recombinant vectors prepared in Example 1 were transformed into the maize inbred line PH4CV (male parent of Xianyu 335) and the maternal inbred line Zheng58 (female parent of Zhengdan 958). The specific steps included: ... pCAMBAIA3300-DsRed and pCAMBAIA3300-DsRed-ZmHSCF1 The bacteria were transferred into Agrobacterium tumefaciens strain EHA105, and after identification, recombinant Agrobacterium tumefaciens were obtained. pCAMBAIA3300-DsRed / EHA105 and pCAMBAIA3300-DsRed-ZmHSCF1 / EHA105. Using recombinant Agrobacterium... pCAMBAIA3300-DsRed / EHA105 and pCAMBAIA3300-DsRed-ZmHSCF1 / EHA105 infection was performed on maize embryos (approximately 1.5 mm in size) 12 days after pollination. After Agrobacterium infection, the embryos were placed on a co-culture medium with the scutellum facing upwards, 30 embryos per dish. After culturing for 1 day, ... Figure 2 The transformed recombinant vector was transferred to a selection medium containing bar resistance as shown in the diagram, and after 20 days of culture, it was observed using a fluorescence microscope. pCAMBAIA3300-DsRed and pCAMBAIA3300- DsRed-ZmHSCF1The transient expression of RFP in callus tissue was analyzed, and the callus rate and the proportion of RFP-positive callus were calculated. Callus tissue cultured for 20 days in a selection medium containing bar resistance underwent pre-differentiation culture, differentiation culture, subculture, and rooting culture to obtain T0 generation regenerated plants. Bar positivity was identified using bar test strips (Shanghai Youlong Biotechnology Co., Ltd., catalog number AA1032-LS), and the transformation efficiency was calculated. Transformation... pCAMBAIA3300-DsRed The callus tissue of the carrier is denoted as DsRed. OE , transformation pCAMBAIA3300-DsRed-ZmHSCF1 The callus tissue of the carrier is designated ZmHSCF1 OE .

[0091] The results are as follows Figure 5 As shown, the results indicate that: [The text abruptly ends here, likely due to an incomplete translation or a formatting error pCAMBAIA3300-DsRed The vector served as a control, and the transformation was performed. pCAMBAIA3300-DsRed-ZmHSCF1 The transient expression of RFP in calluses formed by PH4CV and Zheng58 vectors was significantly enhanced, and the callus rates increased significantly from 14.5% and 21.5% to 45.5% and 48.2%, respectively. Furthermore, the proportion of RFP-positive calluses increased significantly from 12.9% and 5.4% to 38.5% and 32.5%, respectively. Figure 5 A, B, C, and D). Regarding conversion efficiency, in terms of conversion... pCAMBAIA3300-DsRed The vector served as a control, and the transformation was performed. pCAMBAIA3300-DsRed-ZmHSCF1 The transformation efficiency of the PH4CV maize inbred line with the vector was significantly improved from 0.9% to 9.6%. pCAMBAIA3300-DsRed-ZmHSCF1 The conversion efficiency of the Zheng 58 maize inbred line using the vector significantly increased from 0 to 7.2%. Figure 5 E, F, and G). This demonstrates that overexpression of ZmHSCF1 can significantly improve transformation efficiency by promoting the formation and proliferation of positive callus in inbred lines of difficult-to-transform maize breeding parents.

[0092] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. Application of ZmHSCF1 protein in any of the following (A1)-A14): A1) Promotes the formation of callus tissue in plant explants; A2) Prepare products that promote the formation of callus in plant explants; A3) Promotes the proliferation of callus tissue in plant explants; A4) Prepare products that promote the proliferation of callus tissue in plant explants; A5) Increase the proportion of positive callus for the target gene in plant explants; A6) Prepare products that increase the proportion of positive callus for the target gene in plant explants; A7) Improve plant regeneration ability; A8) Prepare products that enhance plant regeneration capabilities; A9) Improve the efficiency of plant genetic transformation; A10) Prepare products that improve the efficiency of plant genetic transformation; A11) Plant genetic transformation; A12) Preparation of plant genetic transformation products; A13) Plant breeding; A14) Preparation of plant breeding products; The ZmHSCF1 protein is a1), a2), a3), or a4). a1) The amino acid sequence of the protein is shown in sequence 4; a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in sequence 4; a3) Proteins obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 4, which are related to the efficiency of plant callus formation or regeneration or genetic transformation. a4) Proteins that have 90% or more identity with the amino acid sequence shown in Sequence 4, are derived from maize, and are associated with plant callus formation or regeneration or genetic transformation efficiency.

2. Application of biomaterials related to ZmHSCF1 protein in any of the following A1)-A14): A1) Promotes the formation of callus tissue in plant explants; A2) Prepare products that promote the formation of callus in plant explants; A3) Promotes the proliferation of callus tissue in plant explants; A4) Prepare products that promote the proliferation of callus tissue in plant explants; A5) Increase the proportion of positive callus for the target gene in plant explants; A6) Prepare products that increase the proportion of positive callus for the target gene in plant explants; A7) Improve plant regeneration ability; A8) Prepare products that enhance plant regeneration capabilities; A9) Improve the efficiency of plant genetic transformation; A10) Prepare products that improve the efficiency of plant genetic transformation; A11) Plant genetic transformation; A12) Preparation of plant genetic transformation products; A13) Plant breeding; A14) Preparation of plant breeding products; The biological material is a nucleic acid molecule encoding the ZmHSCF1 protein or an expression cassette, recombinant vector, or recombinant microorganism containing the nucleic acid molecule; The ZmHSCF1 protein is a1), a2), a3), or a4). a1) The amino acid sequence of the protein is shown in sequence 4; a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in sequence 4; a3) Proteins obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 4, which are related to the efficiency of plant callus formation or regeneration or genetic transformation. a4) Proteins that have 90% or more identity with the amino acid sequence shown in Sequence 4, are derived from maize, and are associated with plant callus formation or regeneration or genetic transformation efficiency.

3. The application according to claim 2, characterized in that: The nucleic acid molecule is a gene as shown in B1) or B2) below: B1) The DNA molecule shown in sequence 2 or sequence 3; B2) has 75% or more identity with the nucleotide sequence defined in B1) and is a DNA molecule encoding the ZmHSCF1 protein.

4. The application according to any one of claims 1-3, characterized in that: The genetic transformation is Agrobacterium-mediated genetic transformation.

5. An Agrobacterium-mediated plant genetic transformation method, comprising the following steps: infecting plant explants with Agrobacterium containing a target vector to obtain infected explants; wherein the target vector expresses ZmHSCF1 protein; The ZmHSCF1 protein is a1), a2), a3), or a4). a1) The amino acid sequence of the protein is shown in sequence 4; a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in sequence 4; a3) Proteins obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 4, which are related to the efficiency of plant callus formation or regeneration or genetic transformation. a4) Proteins that have 90% or more identity with the amino acid sequence shown in Sequence 4, are derived from maize, and are associated with plant callus formation or regeneration or genetic transformation efficiency.

6. The method according to claim 5, characterized in that: The method further includes the step of culturing the infected explants to obtain regenerated plants.

7. The application of the method of claim 5 or 6 in any of the following B1)-B6): B1) Promotes the formation of callus tissue in plant explants; B2) Promotes the proliferation of callus tissue in plant explants; B3) Increase the proportion of positive callus for the target gene in plant explants; B4) Improve plant regeneration ability; B5) Improve the efficiency of plant genetic transformation; B6) Plant breeding.

8. The application according to any one of claims 1-4, or the method according to claim 5 or 6, or the application according to claim 7, characterized in that: The plant is a dicotyledonous plant or a monocotyledonous plant.

9. The application or method according to claim 8, characterized in that: The monocotyledonous plant mentioned is maize.

10. The application or method according to claim 9, characterized in that: The maize includes maize inbred lines LH244, PH4CV, and Zheng58.