Use of reagent for detecting expression level of circAMY2B in preparation of esophageal cancer diagnosis and / or prognosis evaluation product

The reagent for detecting circAMY2B expression levels has solved the problems of target lack and insufficient prognostic markers in esophageal cancer treatment, providing a highly specific and stable diagnostic and prognostic assessment product. It has confirmed the function and application of circAMY2B in esophageal cancer and realized a new means of personalized diagnosis and treatment.

CN122104922APending Publication Date: 2026-05-29KUNMING MEDICAL UNIVERSITY

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
KUNMING MEDICAL UNIVERSITY
Filing Date
2026-04-29
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Currently, there is a lack of highly targeted treatments and specific prognostic biomarkers in the treatment of esophageal cancer. The function and application of circAMY2B in esophageal cancer have not been reported, and existing biomarkers have insufficient specificity and sensitivity.

Method used

We provide reagents for detecting circAMY2B expression levels, including specific primers and RT-qPCR reaction reagents, for the preparation of products for esophageal cancer diagnosis and prognostic assessment, including kits and gene chips. By validating the circular properties and biological functions of circAMY2B, we can confirm its potential role in esophageal cancer.

Benefits of technology

It improves the specificity and accuracy of esophageal cancer diagnosis and prognostic assessment, provides new targets and biomarkers, expands the scope of applications, and circAMY2B has high stability, making it easy to detect and prepare products.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104922A_ABST
    Figure CN122104922A_ABST
Patent Text Reader

Abstract

The present application belongs to the technical field of molecular biology, and particularly relates to application of a reagent for detecting expression level of circAMY2B in preparation of an esophageal cancer diagnosis and / or prognosis evaluation product. The present application first discovers and confirms the expression characteristics and biological functions of circAMY2B in esophageal cancer, opens up a new use of circAMY2B, and provides a new target and biomarker for prevention and treatment of esophageal cancer. The present application has the following remarkable advantages: 1) high specificity: circAMY2B is specifically lowly expressed in esophageal cancer tissues and cells, and has a stable ring structure. A diagnosis and prognosis evaluation product prepared by taking circAMY2B as a target can significantly improve the specificity and accuracy of esophageal cancer diagnosis and prognosis evaluation, and make up for the shortcomings of existing markers. 2) wide application range: circAMY2B can be simultaneously applied to preparation of diagnosis and prognosis evaluation products related to esophageal cancer.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to the application of reagents for detecting circAMY2B expression levels in the preparation of products for esophageal cancer diagnosis and / or prognostic assessment. Background Technology

[0002] Esophageal cancer is a common malignant tumor of the digestive tract, characterized by high malignancy, strong invasiveness, and poor prognosis. Currently, there is a lack of highly effective and specific targets and related products for the prevention and treatment of esophageal cancer in clinical practice. circRNAs are a class of non-coding RNAs with a closed circular structure, lacking a 5' cap and a 3' poly(A) tail. They are resistant to RNase R and have significantly higher stability than linear RNAs, making them a research hotspot in the field of oncology. Numerous studies have shown that circRNAs participate in the biological processes of tumor occurrence, development, proliferation, and migration through various molecular mechanisms, and can serve as potential biomarkers and therapeutic targets for tumor diagnosis, treatment, and prognosis.

[0003] In esophageal cancer research, researchers use techniques such as circRNA-seq to screen differentially expressed circRNAs in an attempt to discover candidate molecules for the prevention and treatment of esophageal cancer. Existing studies have reported that some circRNAs, such as hsa_circ_0001944, play a regulatory role in esophageal cancer and other tumors, but the functions and mechanisms of many circRNAs remain unclear. hsa_circ_0000099 (named circAMY2B) originates from the AMY2B gene located in subband 1 of region 2 of chromosome 1, formed by the reverse splicing and circularization of exons 2-9 of the AMY2B gene. Currently, there are no reports in the literature regarding the expression characteristics, biological function, and application value of this circRNA in esophageal cancer.

[0004] Clinical treatments for esophageal cancer primarily include surgery, chemotherapy, and radiotherapy. However, these methods suffer from poor targeting, significant side effects, and a high risk of drug resistance. Furthermore, the lack of specific biomarkers to effectively assess the prognosis of esophageal cancer patients hinders personalized diagnosis, treatment, and prognostic evaluation. Therefore, identifying regulatory circRNAs in esophageal cancer, clarifying their functions, and developing related prevention and treatment products are crucial for improving the current state of esophageal cancer diagnosis and treatment.

[0005] In summary, although circRNA has become an important direction in esophageal cancer research, and some circRNAs have been found to participate in the regulation of esophageal cancer, there are currently no reports on the expression and function of circAMY2B in esophageal cancer, nor has it been applied to the preparation of related products for the diagnosis, treatment, and prognosis of esophageal cancer.

[0006] Meanwhile, existing treatments for esophageal cancer have shortcomings such as insufficient targeting and significant side effects. Clinically, there is a lack of esophageal cancer treatment products targeting circAMY2B. In terms of prognosis, the specificity and sensitivity of existing biomarkers need to be improved, and there are no applications of circAMY2B as a prognostic biomarker for esophageal cancer. Summary of the Invention

[0007] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a new use for circAMY2B as a biomarker, addressing the problems of target lack, poor targeting of therapeutic products, and insufficient prognostic biomarkers in the prevention and treatment of esophageal cancer. Specifically, this invention provides the application of reagents for detecting circAMY2B expression levels in the preparation of products for esophageal cancer diagnosis and / or prognostic assessment.

[0008] The technical solution of this invention to solve the technical problem is as follows: This invention provides the application of a reagent for detecting circAMY2B expression levels in the preparation of products for esophageal cancer diagnosis and / or prognostic assessment. The nucleotide sequence of circAMY2B is shown in SEQ ID NO: 15. The circAMY2B database identifier is hsa_circ_0000099.

[0009] Furthermore, the reagent contains specific primers for RT-qPCR detection of circAMY2B.

[0010] Furthermore, the specific primers include an upstream primer with the sequence shown in SEQ ID NO: 1 and a downstream primer with the sequence shown in SEQ ID NO: 2.

[0011] Furthermore, the reagents also include RT-qPCR reaction reagents.

[0012] Furthermore, the diagnostic and / or prognostic assessment product is a kit or a gene chip.

[0013] The present invention also provides a kit for the diagnosis and / or prognostic assessment of esophageal cancer, comprising the above-described reagents for detecting circAMY2B expression levels.

[0014] In this invention, the inventors clarified the expression characteristics, circular properties, and biological functions of circAMY2B in esophageal cancer through experimental research, confirming that it can serve as a potential target and biomarker for the prevention and treatment of esophageal cancer. Furthermore, it was applied to the preparation of products related to esophageal cancer diagnosis and prognosis, as detailed below: 1. Verification of circAMY2B characteristics circAMY2B is formed by the reverse splicing and circularization of exons 2-9 of the AMY2B gene, possessing the basic circular characteristics of circRNA. Specific convergent and divergent primers can be designed; the divergent primers can amplify a specific band of circAMY2B in cDNA but not in gDNA. After inhibition of intracellular RNA synthesis by actinomycin D, the half-life of circAMY2B is significantly longer than that of linear AMY2B. It is resistant to RNase R and does not degrade after RNase R treatment, while its linear AMY2B mRNA is degraded. Furthermore, circAMY2B is characterized by low expression in esophageal cancer tissues and esophageal cancer cell lines.

[0015] 2. Validation of the biological function of circAMY2B Assay for inhibiting esophageal cancer cell proliferation: KYSE150 and TE-1 cells with low circAMY2B expression were selected to construct circAMY2B overexpression cell lines, while KYSE180 and TE-12 cells with high circAMY2B expression were selected to construct circAMY2B knockdown cell lines. CCK8 assay, BrdU assay, and plate colony assay confirmed that overexpression of circAMY2B significantly inhibited the growth and proliferation of esophageal cancer cells, while knockdown of circAMY2B promoted esophageal cancer cell proliferation.

[0016] Inhibition of esophageal cancer cell migration: Scratch assay and Trans-well migration assay confirmed that overexpression of circAMY2B significantly reduced the migration ability of esophageal cancer cells, while knockdown of circAMY2B enhanced the migration ability of esophageal cancer cells.

[0017] Experiment on tumorigenesis inhibition in nude mice: A subcutaneous xenograft model was constructed in nude mice, and KYSE150 esophageal cancer cells stably overexpressing circAMY2B were implanted subcutaneously in nude mice. The results showed that, compared with the control group, the xenografts in the nude mice overexpressing circAMY2B group were smaller and lighter, confirming that circAMY2B can inhibit the malignant progression of esophageal cancer in vivo.

[0018] A study on the prognosis of esophageal cancer patients: The expression level of circAMY2B in the cancer tissue of 51 esophageal cancer patients was detected. The patients were divided into low expression group and high expression group with the median value as the cutoff point. Kaplan-Meier survival analysis showed that the overall survival (OS) of patients in the low expression group of circAMY2B was significantly shorter than that in the high expression group, which confirmed that circAMY2B can be used as a potential biomarker for prognostic assessment of esophageal cancer patients.

[0019] 3. Application solutions of circAMY2B Applications in the preparation of esophageal cancer diagnostic products: Using circAMY2B as the detection target, an esophageal cancer diagnostic kit can be prepared. By detecting the expression level of circAMY2B in samples such as esophageal tissue or peripheral blood, it can be determined whether the subject has esophageal cancer. If the sample shows low expression of circAMY2B, it indicates that the subject is at high risk for esophageal cancer or has already been diagnosed with esophageal cancer. The diagnostic kit may contain reagents such as circAMY2B specific primers, probes, and RT-qPCR reaction solution. Detection methods may include RT-qPCR, in situ hybridization, etc.

[0020] It can also be applied in the preparation of products for predicting the prognosis of esophageal cancer: using circAMY2B as a detection index, an esophageal cancer prognosis kit can be prepared. By detecting the expression level of circAMY2B in the cancerous tissue of esophageal cancer patients, the prognosis of the patients can be determined. If the expression of circAMY2B in the cancerous tissue of patients is low, it indicates that the overall survival of patients is shorter and the prognosis is poor; if the expression is high, it indicates that the prognosis of patients is better. Detection methods can include in situ hybridization, RT-qPCR, etc.

[0021] The inventors of this invention have for the first time discovered and proposed that circAMY2B has the following expression characteristics and biological functions: (1) It was found that circAMY2B was specifically lowly expressed in cancer tissues and esophageal cancer cell lines of esophageal cancer patients; (2) It was found that circAMY2B has the basic circular characteristics of circRNA and is highly stable, and can be used as a potential target for esophageal cancer detection; (3) It was found that circAMY2B can significantly inhibit the proliferation and migration of esophageal cancer cells, arrest the cell cycle in the G2 / M phase, and inhibit the growth of esophageal cancer xenografts in nude mice in vivo. (4) It was found that the expression level of circAMY2B was related to the overall survival of esophageal cancer patients, and low expression indicated a poor prognosis; (5) It was found that circAMY2B can be applied to the preparation of products related to esophageal cancer diagnosis and prognosis.

[0022] The present invention has the following technical effects: This invention, by first discovering and confirming the expression characteristics and biological function of circAMY2B in esophageal cancer, opens up new applications for circAMY2B, providing new targets and biomarkers for the diagnosis of esophageal cancer, and has the following significant advantages: 1) High specificity: circAMY2B is expressed at low specificity in esophageal cancer tissues and cells and has a stable ring structure. Diagnostic and prognostic products prepared using it as a target can significantly improve the specificity and accuracy of esophageal cancer diagnosis and prognostic assessment, making up for the shortcomings of existing biomarkers.

[0023] 2) Wide range of applications: circAMY2B can be used simultaneously in the preparation of products related to the diagnosis and prognosis of esophageal cancer, providing new ideas and methods for individualized diagnosis and treatment of esophageal cancer.

[0024] 3) Good stability: circAMY2B is resistant to RNase R, has a long half-life, is not easily degraded in samples, is easy to detect and prepare related products, and is conducive to clinical application.

[0025] The research results of this invention confirm that circAMY2B, as a potential tumor suppressor, plays an important regulatory role in the occurrence and development of esophageal cancer. Its application in the preparation of esophageal cancer prevention and treatment products can effectively improve the current status of esophageal cancer diagnosis, treatment and prognosis, and has important clinical application value and market prospects. Attached Figure Description

[0026] Figure 1 Screening for circAMY2B expression in esophageal cancer. A: circRNA-seq results of 10 pairs of esophageal cancer adjacent and cancerous tissues showed 750 differentially expressed circRNAs (179 upregulated and 571 downregulated); B: Intersection of differentially expressed genes with GEO databases GSE157803 and GSE189830 identified 2 candidate circRNAs; C: RT-qPCR detection of circAMY2B expression levels in 17 unpaired esophageal cancer adjacent and cancerous tissues; D: circAMY2B expression levels in 17 paired esophageal cancer adjacent and cancerous tissues; E: RT-qPCR detection of circAMY2B expression levels in esophageal cancer cell lines.

[0027] Figure 2 To verify and locate the ring-shaped characteristics of circAMY2B. Among other things, A: Gene origin and circularization pattern of circAMY2B, formed by reverse splicing and circularization of exons 2-9 of the AMY2B gene. B: Sanger sequencing results of circAMY2B, showing a specific adapter sequence. C: Agarose gel electrophoresis results show that divergent primers can amplify a specific band of circAMY2B in cDNA, but not in gDNA. D: Half-life analysis of circAMY2B and AMY2B after actinomycin D treatment; circAMY2B has a longer half-life. E: Expression levels of circAMY2B and AMY2B mRNA after RNase R treatment; circAMY2B is resistant to RNase R. F: Nuclear-cytoplasmic localization of circAMY2B in esophageal cancer cells; mainly located in the cytoplasm.

[0028] Figure 3 The effect of overexpression of circAMY2B on the proliferation of esophageal cancer cells was investigated. Among other things, A: Validation results of circAMY2B overexpression in KYSE150 and TE-1 cells; B: CCK-8 assay results, showing that circAMY2B overexpression inhibits the proliferation of KYSE150 and TE-1 cells; C: BrdU assay results, showing that the proportion of BrdU-positive cells in KYSE150 and TE-1 cells decreased after circAMY2B overexpression; D: Plate colony assay results, showing that circAMY2B overexpression inhibits the cell colony formation ability of KYSE150 and TE-1 cells; E: Flow cytometry analysis results, showing that circAMY2B overexpression leads to cell cycle arrest in the G2 / M phase in KYSE150 cells; F: Flow cytometry analysis results, showing that circAMY2B overexpression leads to cell cycle arrest in the G2 / M phase in TE-1 cells.

[0029] Figure 4 The effect of circAMY2B knockdown on the proliferation of esophageal cancer cells was investigated. Among other things, A: RT-qPCR results verifying the knockdown efficiency of circAMY2B in KYSE180 cells; B: RT-qPCR results verifying the knockdown efficiency of circAMY2B in TE-12 cells; C: CCK-8 assay results, showing that circAMY2B knockdown promotes KYSE180 cell proliferation; D: CCK-8 assay results, showing that circAMY2B knockdown promotes TE-12 cell proliferation; E: BrdU assay results in KYSE180 cells, showing that the proportion of BrdU-positive cells increases after circAMY2B knockdown; F: BrdU assay results in TE-12 cells, showing that the proportion of BrdU-positive cells increases after circAMY2B knockdown; G: Statistical results of Figure F; H: Plate colony assay results, showing that circAMY2B knockdown promotes KYSE180 cell colony formation ability; I: Plate colony assay results, showing that circAMY2B knockdown promotes TE-12 cell colony formation ability.

[0030] Figure 5 The effect of overexpression of circAMY2B on the migration of esophageal cancer cells was investigated. A: Scratch assay to detect the effect of circAMY2B overexpression on the healing ability of KYSE150 esophageal cancer cells (Scale bar: 100 μm); B: Scratch assay to detect the effect of circAMY2B overexpression on the healing ability of TE-1 esophageal cancer cells (Scale bar: 100 μm); C: Trans-well migration assay to detect the effect of circAMY2B overexpression on the migration ability of KYSE150 esophageal cancer cells (Scale bar: 50 μm); D: Trans-well migration assay to detect the effect of circAMY2B overexpression on the migration ability of TE-1 esophageal cancer cells (Scale bar: 50 μm).

[0031] Figure 6 To investigate the effect of circAMY2B knockdown on the migration of esophageal cancer cells. Among other things, A: Scratch assay to detect the effect of circAMY2B knockdown on the healing ability of KYSE180 esophageal cancer cells (Scale bar: 100 μm); B: Scratch assay to detect the effect of circAMY2B knockdown on the healing ability of TE-12 esophageal cancer cells (Scale bar: 100 μm); C: Trans-well migration assay to detect the effect of circAMY2B knockdown on the migration ability of KYSE180 esophageal cancer cells (Scale bar: 50 μm); D: Trans-well migration assay to detect the effect of circAMY2B knockdown on the migration ability of TE-12 esophageal cancer cells (Scale bar: 50 μm).

[0032] Figure 7 The effect of circAMY2B on tumorigenesis in nude mice. Among them, A: Tumor size diagram of xenografts in nude mice; the tumors in the overexpression group are smaller. B: Changes in the volume of xenografts in nude mice. C: Statistics on the weight of xenografts in nude mice.

[0033] Figure 8 The relationship between circAMY2B and the prognosis of esophageal cancer patients was investigated using Kaplan-Meier survival curves, which showed that patients with low circAMY2B expression had significantly shorter overall survival than those with high expression. Detailed Implementation

[0034] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. Obviously, the described embodiments are only some embodiments of this invention, and not all embodiments.

[0035] The following is a description of the source of the experimental materials involved in this invention: Normal esophageal epithelial cells HET-1A and esophageal cancer cell lines KYSE150, TE-1, KYSE180, TE-12, CAES17, KYSE70, and KYSE450 were provided by the Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences. RPMI 1640, DMEM, and 0.05% Trypsin were purchased from Gibco; fetal bovine serum was purchased from Royalcel; CCK8 reagent was purchased from Meilunbio; actinomycin D was purchased from Aladdin Ltd.; nucleocytoplasmic separation kit was purchased from Wuhan AmyJet Scientific Ltd.; Trizol reagent was purchased from Takara; RNase R and pLO5 empty vector plasmid were purchased from Biosun Biotechnology; BrdU kit was purchased from Beijing Pulilai Gene Technology Co., Ltd.; Trans-well double-layer plates and Matrigel were purchased from Corning; Lipofectamine 2000 liposome transfection reagent was purchased from Thermo Fisher Scientific; crystal violet was purchased from Beyotime Biotechnology Co., Ltd.; centrifuge tubes were purchased from BioFIL; and cell culture plates and culture dishes were purchased from Nest. The circAMY2B overexpression plasmid was obtained from Qingke Biotechnology Co., Ltd., and the SPF-grade nude mice (4-6 weeks old, male) were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd. The clinical samples from esophageal cancer patients were all obtained from the Affiliated Hospital of Zhengzhou University.

[0036] The primer sequences involved in the embodiments of this invention are shown in Table 1: .

[0037] Example 1: Detection of hsa_circ_0000099 expression in esophageal cancer tissues and cells Experimental materials: 10 pairs of adjacent and cancerous tissue specimens from esophageal cancer patients; esophageal cancer cell lines KYSE150, TE-1, KYSE180, and TE-12; normal esophageal epithelial cell line HET-1A; Trizol reagent, reverse transcription kit, RT-qPCR kit, etc.

[0038] Experimental methods: 1) circRNA-seq detection: Total RNA was extracted from the sample, RNA quality was tested and rRNA was removed. If necessary, RNase R was used to enrich circular RNA. Then, a sequencing library was constructed and high-throughput sequencing was performed. Bioinformatics analysis was used to identify back splicing sites, identify circRNAs, and further screen for differentially expressed circRNAs.

[0039] 2) Venn diagram differential gene analysis: Figure 1Intersection analysis was performed between differentially expressed genes in esophageal cancer (selection criteria: P < 0.05 and |Log2FC(Fold Change)| > 2) and the GEO datasets (GSE189830, GSE157803) to screen for co-expressed circRNAs in esophageal cancer tissues.

[0040] 3) RNA extraction: Total RNA was extracted from tissues and cells using Trizol reagent, and the RNA was reverse transcribed into cDNA using a reverse transcription kit; specific PCR primers for hsa_circ_0000099 (i.e. circAMY2B) were designed (circAMY2B-dv-F: CAAAATGGAAACTTGGTTGAATCT (SEQ ID NO: 1), circAMY2B-dv-R: GTCCTTTCCAGAAACTATTTATAT (SEQ ID NO: 2)), and β-actin was used as the internal control (β-actin primers are shown in Table 1); 4) The expression level of circAMY2B in adjacent normal tissues, cancerous tissues and various cell lines was detected by RT-qPCR.

[0041] Experimental results are as follows Figure 1 As shown: Figure 1 In Figure A, the results of circRNA-seq of 10 pairs of esophageal cancer adjacent and cancerous tissues showed 750 differentially expressed circRNAs (179 upregulated and 571 downregulated). Figure 1 Two candidate circRNAs (hsa_circ_0001944 and hsa_circ_0000099) were identified by intersecting differentially expressed genes (B) with GEO databases GSE157803 and GSE189830. Figure 1 C and Figure 1 The results showed that the expression level of hsa_circ_0000099 in esophageal cancer tissues was significantly lower than that in adjacent normal tissues; Figure 1 The results showed that hsa_circ_0000099 was expressed at low levels in esophageal cancer cell lines compared to the normal esophageal epithelial cell line HET-1A.

[0042] The above results indicate that hsa_circ_0000099 is significantly downregulated in esophageal cancer tissues.

[0043] Example 2: Verification of the circAMY2B ring-shaped properties Experimental materials: esophageal cancer cell lines KYSE150 and KYSE180; RNase R, actinomycin D, Trizol reagent, reverse transcription kit, agarose gel electrophoresis reagents, nucleocytoplasmic separation kit, etc.; convergent and divergent primers for circAMY2B; convergent and divergent primers for GAPDH, etc.

[0044] Experimental methods: 1) Sanger sequencing: Total RNA was extracted from KYSE150 cells and reverse transcribed to synthesize cDNA. The cDNA was amplified by PCR using the divergent primers circAMY2B in Table 1. The amplification products were separated by agarose gel electrophoresis, and the target bands were recovered by gel excision and Sanger sequencing analysis.

[0045] 2) Agarose gel electrophoresis verification: Total RNA was extracted from KYSE150 and KYSE180 cells and reverse transcribed into cDNA. At the same time, cellular gDNA was extracted. PCR amplification of cDNA and gDNA was performed using the convergent and divergent primers of circAMY2B in Table 1, respectively. The amplification products were subjected to agarose gel electrophoresis, and GAPDH was used as an internal control. The convergent and divergent primers of GAPDH are shown in Table 1.

[0046] 3) Half-life detection: KYSE150 and KYSE180 cells were treated with actinomycin D, and total RNA was extracted from the cells at 0h, 3h, 6h, 9h, 12h, and 15h, respectively. The expression levels of circAMY2B and AMY2B were detected by RT-qPCR. The divergent primers for circAMY2B and AMY2B listed in Table 1 were used for detection.

[0047] 4) RNase R tolerance assay: The extracted total RNA was divided into two groups. One group was treated with RNase R, while the other group was left untreated. After treatment, the RNA was reverse transcribed into cDNA, and the expression levels of circAMY2B and AMY2B were detected by RT-qPCR. The divergent primers for circAMY2B and AMY2B listed in Table 1 were used for detection.

[0048] 5) Nucleocytoplasmic localization detection: Cytoplasmic and nuclear components of KYSE150 and KYSE180 cells were separated using an RNA nucleocytoplasmic separation kit. RNA was extracted from each component, and the expression level of circAMY2B was detected by RT-qPCR. The divergent primers for circAMY2B, AMY2B primers, convergent primers for GAPDH, and NEAT1 primers listed in Table 1 were used for detection.

[0049] Experimental results are as follows Figure 2 As shown: Figure 2 In the middle, A is hsa_circ_0000099 (named circAMY2B), which originates from the AMY2B gene on the first subband of region 1, band 2 of chromosome 1. It is formed by the reverse splicing and circularization of exons 2-9 of the AMY2B gene.

[0050] Figure 2 The results from the B-cell sequencing show that Sanger sequencing successfully detected the specific inverse splicing site sequence of circAMY2B. Figure 2 The results of C1 agarose gel electrophoresis showed that the divergent primers of circAMY2B could amplify the specific band of circAMY2B in cDNA, but could not amplify it in gDNA. The converging primers of circAMY2B amplified the band in both cDNA and gDNA. In contrast, the divergent primers of GAPDH could not amplify the band in either cDNA or gDNA, while the converging primers of GAPDH amplified the band in both cDNA and gDNA. Figure 2 The results showed that after treatment with actinomycin D, the half-life of circAMY2B was significantly longer than that of linear AMY2B. Figure 2 The results of the study showed that after treatment with RNase R, the expression level of circAMY2B did not change significantly, while the expression level of AMY2B mRNA decreased significantly. Figure 2 The results showed that circAMY2B was mainly located in the cytoplasm, with approximately 80% of its distribution in the cytoplasm.

[0051] The above results indicate that circAMY2B has typical circRNA circular structure characteristics.

[0052] Example 3: Effect of circAMY2B overexpression on esophageal cancer cell proliferation Experimental materials: esophageal cancer cell lines KYSE150, TE-1, KYSE180, and TE-12; circAMY2B overexpression plasmid and pLO5 empty vector plasmid; CCK8 kit, BrdU kit, crystal violet, etc.; flow cytometer.

[0053] The circAMY2B (hsa_circ_0000099) sequence is derived from the circBase database, and the detailed sequence is shown in SEQ ID NO: 15.

[0054] Experimental methods: 1) Cell line construction: The circAMY2B overexpression plasmid and empty vector plasmid were transfected into KYSE150 and TE-1 cells to construct overexpression cell lines and an empty vector control group. 48 h after transfection, RT-qPCR was used to detect the expression level of circAMY2B to verify successful cell line construction. The divergent primers for circAMY2B and AMY2B primers listed in Table 1 were used for detection.

[0055] 2) CCK8 assay: Cells from each experimental group were seeded in 96-well plates, 1×10⁶ cells per well. 3 Cells were incubated with CCK8 reagent on days 0, 1, 2, 3, 4, and 5, and the absorbance at 450 nm was measured to plot cell growth curves.

[0056] 3) BrdU assay: Cells were seeded in 24-well plates and cultured for 48 hours. BrdU reagent was added, and the cells were incubated, fixed, and permeabilized. Primary and secondary antibodies were added, and finally, the absorbance value was measured to analyze cell proliferation.

[0057] 4) Plate cloning assay: Cells were seeded at a density of 500 cells per well in 6-well plates, cultured for 14 days, fixed with methanol, stained with crystal violet, and the number of clones was counted.

[0058] 5) Cell cycle detection: Overexpressing cell lines and empty control cells were collected, fixed with ethanol, stained with propidium iodide, and the cell cycle distribution was detected by flow cytometry.

[0059] Experimental results are as follows Figure 3 As shown: Figure 3 The results from cell line A show that the circAMY2B overexpression cell line was successfully constructed. Figure 3 The results of the CCK-8 assay showed that overexpression of circAMY2B could inhibit the proliferation of esophageal cancer cells. Figure 3 The results showed that overexpression of circAMY2B reduced the proportion of BrdU-positive cells; Figure 3 The results showed that overexpression of circAMY2B inhibited the clonogenic ability of esophageal cancer cells; Figure 3 The results showed that overexpression of circAMY2B could lead to cell cycle arrest in KYSE150 cells at the G2 / M phase; Figure 3 The results showed that overexpression of circAMY2B could lead to cell cycle arrest in TE-1 cells at the G2 / M phase.

[0060] The above results indicate that overexpression of circAMY2B inhibits the proliferation of esophageal cancer cells.

[0061] Example 4: Effect of circAMY2B knockdown on esophageal cancer cell proliferation Experimental materials: Esophageal cancer cell lines KYSE150, TE-1, KYSE180, TE-12; circAMY2B siRNA (si#1: CAAAAUGGAAACUUGGUUGAA (SEQ ID NO: 16); si#2: GAAACUUGGUUGAAUCUGGCG (SEQ ID NO: 17)), negative control siRNA (ACGUGACACGUUCGGAGAATT (SEQ ID NO: 18); liposome transfection reagent Lipofectamine 2000; CCK8 kit, BrdU kit, crystal violet, etc.

[0062] Experimental methods: 1) Cell line construction: circAMY2B siRNA and negative control siRNA were transfected into KYSE180 and TE-12 cells to construct knockdown cell lines and negative control groups. 48 h after transfection, RT-qPCR was used to detect the expression level of circAMY2B to verify successful cell line construction. The divergent primers for circAMY2B and AMY2B primers listed in Table 1 were used for detection.

[0063] 2) CCK8 assay: Cells from each experimental group were seeded in 96-well plates, 1×10⁶ cells per well. 3 Cells were incubated with CCK8 reagent on days 0, 1, 2, 3, 4, and 5, and the absorbance at 450 nm was measured to plot cell growth curves.

[0064] 3) BrdU assay: Cells were seeded in 24-well plates and cultured for 48 hours. BrdU reagent was added, and the cells were incubated, fixed, and permeabilized. Primary and secondary antibodies were added, and finally, the absorbance value was measured to analyze cell proliferation.

[0065] 4) Plate cloning assay: Cells were seeded at a density of 500 cells per well in 6-well plates, cultured for 14 days, fixed with methanol, stained with crystal violet, and the number of clones was counted.

[0066] Experimental results are as follows Figure 4 As shown: Figure 4 China A and Figure 4 The results from RT-qPCR showed that the circAMY2B knockdown efficiency was good. Figure 4 C and Figure 4 The results showed that knocking down circAMY2B could promote the proliferation of esophageal cancer cells; Figure 4 Chinese E, Figure 4 China F and Figure 4 The results showed that in KYSE180 and TE-12 cells, knocking down circAMY2B increased the proportion of BrdU-positive cells; Figure 4 H and Figure 4 The study showed that knocking down circAMY2B promoted the clonogenic ability of esophageal cancer cells.

[0067] The above results indicate that knocking down circAMY2B promotes the proliferation of esophageal cancer cells.

[0068] Example 5: Effect of circAMY2B overexpression on esophageal cancer cell migration Experimental materials: the circAMY2B overexpressing cell line constructed in Example 3 and the corresponding control cell line; Trans-well chambers; inverted microscope.

[0069] Experimental methods: 1) Scratch assay: Cells from each experimental group were seeded into 6-well plates. When the cells reached more than 90% confluence, a straight line was drawn in the well plate with a sterile pipette tip. The cells were washed with PBS and serum-free culture medium was added. The scratched areas were observed and photographed under an inverted microscope at 0h and 36h, and the scratch healing rate was calculated.

[0070] 2) Trans-well migration assay: Cells from each experimental group were suspended in serum-free medium and seeded in the upper chamber of a Trans-well chamber. Medium containing 10% fetal bovine serum was added to the lower chamber. After culturing for 24 hours, unmigrated cells in the upper chamber were wiped off with a cotton swab, fixed with methanol, stained with crystal violet, and the number of migrating cells was counted under an inverted microscope.

[0071] Experimental results are as follows Figure 5 As shown: Figure 5 China A and Figure 5 The results from the B and C studies show that overexpression of circAMY2B can significantly inhibit the scratch healing ability of esophageal cancer cells KYSE150 and TE-1. Figure 5 C and Figure 5 Trans-well migration assays showed that overexpression of circAMY2B significantly inhibited the migration ability of KYSE150 and TE-1 cells. In summary, the scratch healing rate and the number of migrating cells in the circAMY2B overexpression group were significantly lower than those in the control group, indicating that circAMY2B can significantly inhibit the migration ability of esophageal cancer cells.

[0072] Example 6: Effect of circAMY2B knockdown on esophageal cancer cell migration Experimental materials: circAMY2B knockdown and corresponding control cell lines constructed in Example 4; Trans-well chambers; inverted microscope.

[0073] Experimental methods: 1) Scratch assay: Cells from each experimental group were seeded into 6-well plates. When the cells reached more than 90% confluence, a straight line was drawn in the well plate with a sterile pipette tip. The cells were washed with PBS and serum-free culture medium was added. The scratched areas were observed and photographed under an inverted microscope at 0h and 24h, and the scratch healing rate was calculated.

[0074] 2) Trans-well migration assay: Cells from each experimental group were suspended in serum-free medium and seeded in the upper chamber of a Trans-well chamber. Medium containing 10% fetal bovine serum was added to the lower chamber. After culturing for 24 hours, unmigrated cells in the upper chamber were wiped off with a cotton swab, fixed with methanol, stained with crystal violet, and the number of migrating cells was counted under an inverted microscope.

[0075] Experimental results are as follows Figure 6 As shown: Figure 6 China A and Figure 6 The results showed that knocking down circAMY2B significantly enhanced the scratch healing ability of KYSE180 and TE-12 cells; Figure 6 C and Figure 6 The results showed that, compared with the control group, knockdown of circAMY2B significantly increased the number of migrating KYSE180 and TE-12 cells.

[0076] In summary, knockdown of circAMY2B increased the scratch healing rate and the number of migrating cells, indicating that knockdown of circAMY2B significantly promoted the migration ability of esophageal cancer cells.

[0077] Example 7: Effect of circAMY2B on tumorigenesis in nude mice Experimental materials: SPF-grade nude mice (4-6 weeks old, male); circAMY2B overexpressing KYSE150 cell line and empty vector control KYSE150 cell line; sterile PBS and Matrigel.

[0078] Experimental methods: The overexpressing cell line and the empty vector control group cells were resuspended in sterile PBS, mixed with Matrigel at a ratio of 1:4, and then subcutaneously inoculated into the right back of nude mice, with 6 nude mice in each group. After inoculation, the long diameter (a) and short diameter (b) of the xenograft in the nude mice were measured weekly, and the tumor volume was calculated (V=1 / 2×a×b²). 25 days after inoculation, the nude mice were euthanized, the xenograft was dissected, weighed, and recorded.

[0079] Experimental results are as follows Figure 7 As shown: Figure 7 China A and Figure 7 The results showed that, compared with the empty vector control group, overexpression of circAMY2B significantly inhibited the growth of xenografts in nude mice and reduced tumor volume; Figure 7 The results showed that the tumor weight in the circAMY2B overexpression group was significantly lower than that in the control group (P≤0.05).

[0080] The above results indicate that circAMY2B can significantly inhibit the tumorigenicity of esophageal cancer in vivo.

[0081] Example 8: Correlation analysis of circAMY2B with the prognosis of esophageal cancer patients Experimental materials: cancer tissue specimens from 51 patients with esophageal cancer; in situ hybridization kit, circAMY2B specific probe (ACATCGCCACATTCAACCAAGTTTCCATTTTGAAACTGTC (SEQ ID NO: 19)); microscope, image analysis system; Kaplan-Meier survival analysis software.

[0082] Experimental methods: The expression level of circAMY2B in cancer tissues of 51 esophageal cancer patients was detected using an in situ hybridization kit. The hybridization signal was scored using an image analysis system, and the patients were divided into a low circAMY2B expression group and a high circAMY2B expression group using the median score as the cutoff point. Clinical follow-up data of the patients were collected, and survival analysis was performed using the Kaplan-Meier method. Overall survival curves were plotted to compare the overall survival of the two groups.

[0083] Experimental results: such as Figure 8 As shown in the figure, the overall survival of patients in the low circAMY2B expression group was significantly shorter than that in the high expression group (P≤0.05). The survival curve of the low expression group decreased significantly faster, and the median survival time was significantly shorter than that of the high expression group. These results indicate that the expression level of circAMY2B is closely related to the prognosis of esophageal cancer patients, and its low expression suggests a poor prognosis, thus possessing potential value as a prognostic biomarker.

[0084] The above are merely embodiments of the present invention and do not limit the scope of the patent. Any equivalent modifications made based on the content of this specification, or direct or indirect applications in other related technical fields, are similarly included within the scope of patent protection of the present invention.

Claims

1. The application of a reagent for detecting circAMY2B expression levels in the preparation of products for esophageal cancer diagnosis and / or prognostic assessment, wherein the nucleotide sequence of circAMY2B is shown in SEQ ID NO:

15.

2. The application according to claim 1, characterized in that, The reagent contains specific primers for RT-qPCR detection of circAMY2B.

3. The application according to claim 2, characterized in that, The specific primers include an upstream primer with the sequence shown in SEQ ID NO:1 and a downstream primer with the sequence shown in SEQ ID NO:

2.

4. The application according to claim 3, characterized in that, The reagents also include RT-qPCR reaction reagents.

5. The application according to any one of claims 1-4, characterized in that, The diagnostic and / or prognostic assessment products are kits or gene chips.

6. A kit for the diagnosis and / or prognostic assessment of esophageal cancer, characterized in that, It contains the reagent as described in any one of claims 1-4.