Molecular markers of logarithmic traits of meishan rib and their application

Abstract

The application provides a molecular marker of rib pair logarithmic traits of Meihuaxing pigs and application thereof, and a probe, a chip, KASP, a kit and application for detecting the molecular marker. The application has the advantages that the molecular marker of rib pair logarithmic traits of Meihuaxing pigs and application thereof are obtained by combining significant variation (SNP, InDel and SV) sites of rib pair logarithmic, an important economic trait, and eQTL / sQTL information of a FarmGTEx database, so as to provide more comprehensive and accurate detection molecular markers and detection methods and tools for molecular breeding of Meihuaxing pigs, and thus the effect of more efficient promotion of breeding and protection and utilization of Meihuaxing pigs is achieved.

Description

Technical Field

[0001] This invention belongs to the interdisciplinary field of animal genetics and breeding and molecular biology, specifically the field of molecular markers for the logarithmic traits of the ribs of the Plum Blossom Star Pig and their applications. Background Technology

[0002] Local pig breeds are a core component of my country's pig germplasm resource bank. Meihuaxing Susscrofa, a distinctive local pig breed in Hubei, possesses characteristics such as tolerance to roughage, strong resistance to adverse conditions, high reproductive rate, and excellent meat quality, making it highly valuable in the high-quality pig industry.

[0003] Molecular marker-assisted selection and genomic selection are core technologies in pig genetic breeding. Gene chips are key tools for realizing these technologies, and they are divided into solid-phase and liquid-phase types, enabling rapid and accurate genotyping. Currently, several pig gene chip products have been developed both domestically and internationally. Domestically, there are "Zhongxin-1" and "Wanxin series," while internationally, the Illumina Porcine SNPBeadChips series is the most widely used. These chips integrate tens of thousands to hundreds of thousands of SNP loci for mining molecular markers related to economic traits such as growth, reproduction, and meat quality. Simultaneously, existing technologies have identified some SNP markers related to the number of ribs in pigs, providing a basis for breeding.

[0004] However, existing technologies for Meihua Star pigs have significant drawbacks: First, existing microarray loci are designed based on commercial pig breeds and do not cover the specific genetic background of Meihua Star pigs, resulting in low coverage of effective loci and missed detection of variants associated with desirable traits such as rib count, leading to insufficient selection accuracy. Second, the technology focuses on SNP detection, ignoring important variant types such as InDel and SV, and cannot resolve the complex genetic patterns of quantitative traits such as rib count. Third, the microarray only provides genotype information and does not integrate gene expression and regulatory element data, making it difficult to reveal the causal mechanism between markers and traits. Fourth, high-density microarrays are costly, while low-density microarrays have insufficient loci, making it difficult to meet the needs of grassroots breeding and preservation of Meihua Star pigs.

[0005] In summary, existing technologies are insufficient to meet the precision breeding needs of Plum Blossom Pigs, and there is an urgent need to develop specific molecular markers and efficient, low-cost detection technologies. Summary of the Invention

[0006] This application aims to address the problems existing in the background technology mentioned above. By combining significant variation sites (SNP, InDel, and SV) for the important economic trait of rib logarithm with eQTL / sQTL information from the FarmGTEx database, molecular markers for the rib logarithmic trait of Meihua Star Pig are obtained and their applications are developed. The goal is to provide more comprehensive and accurate molecular markers and detection methods and tools for the molecular breeding of Meihua Star Pig, thereby achieving a more efficient effect in promoting the breeding, conservation, and utilization of Meihua Star Pig.

[0007] To achieve the above objectives, the present invention provides a combination of molecular markers for the logarithmic traits of pig ribs, including 8 SVs, 8 InDels, and 4985 SNPs.

[0008] Among them, the pig breed is the Meihua Xing pig.

[0009] The eight SVs include: one located at position 88915382 on chromosome 1, with the original base sequence shown in SEQ ID NO. 1 and the modified sequence being C; another located at position 31760812 on chromosome 2, with the original base sequence being C and the modified sequence being shown in SEQ ID NO. 2; another located at position 16168698 on chromosome 4, with the original base sequence shown in SEQ ID NO. 3 and the modified sequence being G; another located at position 116505905 on chromosome 6, with the original base sequence shown in SEQ ID NO. 4 and the modified sequence being T; another located at position 89528530 on chromosome 7, with the original base sequence shown in SEQ ID NO. 5 and the modified sequence being C; another located at position 91513914 on chromosome 7, with the original base sequence shown in SEQ ID NO. 6 and the modified sequence being T; and another located at position 91896482 on chromosome 7, with the original base sequence shown in SEQ ID NO. 1 and the modified sequence being T. As shown in ID NO.7, the mutated form is T; located at position 91896482 on chromosome 7, the original base is C, and the mutated base sequence is shown in SEQ ID NO.8.

[0010]

[0011] The sequence of SEQ ID NO.2 is: CAGGAGTTCCCGTCGTGGCGCAGTGGTTAACGAATCCGACTAGGAACCATGAGGTTGCGGGTTCGGTCCCTGCCCTTGCTCAGTGGGTTAACGATCCGGCGTTGCCGTGAGCTGTGGTGTAGGTTGCAGACGCGGCTCGGATCCCGCGTTGCTGTGGCTCTGGCGTAGGCCGGTGGCTACAGCTCCGATTCAACCCCTAGCCTGGGAACCTCCATATGCCGCGGGAGTGGCCCAAGAAATAGCAACAATAACAACAACAACAACAAAAAAATAAAAATAAATTGTATTTCA。

[0012] The sequence of SEQ ID NO.3 is: GTCTTGGGTTAACTGTTTTTTTTTTTTTTTTTTTTAATTAATTTATTTTTTCGTCTTTTGTCTTTTTGCTGTTGTTGTTGTTGTTGTTGCTGTTGCTATTTCTTGGGCCGCTCGCGCGGCATATGGAGGTTCCCAGGCTAGGGGTTGAATCAGAGCTGTAGCCACCGGCCTACGCCAGAGCCACAGCAACGCAGGATCCGAGCCGTGTCTGCAACCTACACACAGCTCACGGCAACGCCGGATCGTTAACCCACTGAGCAAGGGCAGGGACCGAACCCGCAACCTCATGGTTCCTAGTCGGATTCGTTAACCACTGCGCCACGACGGGAACTC。

[0013]

[0014] The sequence of SEQ ID NO.5 is: CTATACATCATGTTTTAAGATCTTTGTTTTAACTAAACTTAGTGGGTACAATTTAGGGGCAATTAGGTACA.

[0015] The sequence of SEQ ID NO.6 is: TCAAAGATTTCGAAACCAGGAGTTCCCGTCGTGGCGCAGGGGTTAACGAATCCGACTAGGAACCATGAAGTTGCGGTTCGGTCCTGCCTTGCTCAGTGGGTTAACGATCCGGCGTTGCCGTGAGCTGTGGTGTAGCTTGCAGACGCGGCTCAGATCTGGCGTTGCTGTGGCTCTGGCGTAGGCCGGTGGCTCCAGCTCTGATTCGACCCCTAGGCTGGGAACCTCCATATGCCGCGGGAGTGGCCCAAATAGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAACAAAACAAAAAAA.

[0016] The sequence of SEQ ID NO.7 is: TTAAGACTTTGATCATCCAGGAGTTCCCGTCGTGGCGCAGTGGTTAACGAATCAGATTAGGAACCATGAGGTTGCGGGTTCGGTCCCTGCCCTTGCTCAGTGGGTTAAGGATCGCGCGTCACTGTGAGCTGTGGTGTAGGTTGCAGACGCGGCTTGGATCCTGCGTTGCTGTGGCTCTGGTGTAGGCCGGGGACTACAGCTCTGATTCGACCCCTAGCCTGGGAACCTCCATATGCTGTGGGAGCGGCCCAAAGAAATAGCAAAAAGACAAAAAAAAAAAAAAA.

[0017] The sequence of SEQ ID NO.8 is: CACCCAGCTGATTTGCACCAACCCAAGAACCATGAGAAATGATACATTGTTTTAAGCCATTACATTTTGCACTAGTTTTTTTTTTTTTT.

[0018] Among them, the 8 InDels are located on chromosome 7 at the following positions: 95588761, where the original base was GT and the new base was G; 97155480, where the original base was A and the new base was AT; 97568477, where the original base was T and the new base was TG; 97620079, where the original base was G and the new base was GAA; 97812991, where the original base was G and the new base was GTGAT; 98074822, where the original base was T and the new base was TC; 98096522, where the original base was GT and the new base was G; and 101415740, where the original base was A and the new base was AG.

[0019] The SNPs are shown in Table 1: Table 1. SNP locus information for logarithmic traits of pig ribs.

[0020]

[0021]

[0022]

[0023]

[0024]

[0025]

[0026]

[0027]

[0028]

[0029]

[0030]

[0031]

[0032]

[0033]

[0034] To achieve the technical objective of this invention, a second aspect of this invention provides a probe for detecting the logarithmic traits of the ribs of the Plum Blossom Star Pig, used to detect the aforementioned molecular marker combination.

[0035] To achieve the technical objective of this invention, a third aspect of this invention provides a chip for detecting the logarithmic traits of ribs in Plum Blossom Star pigs, mainly comprising the probes mentioned above.

[0036] To achieve the technical objective of this invention, a fourth aspect of this invention provides a KASP for detecting the logarithmic traits of ribs in Plum Blossom Star Pig, used to detect the aforementioned molecular marker combination.

[0037] To achieve the technical objective of this invention, the fifth aspect of this invention provides a kit for detecting the logarithmic traits of ribs in Plum Blossom Star Pig, mainly comprising the aforementioned probe and / or KASP.

[0038] The present invention also provides a method for detecting the molecular markers, including detecting a sample using the above-mentioned molecular marker combination, probe, chip, KASP marker, or kit, and determining the number of rib pairs in the sample based on the detection results.

[0039] The molecular markers for the logarithmic traits of ribs in the Plum Blossom Star pig discovered in this invention can be mainly used in the following aspects: (1) Detection of pig body size; (2) Screening and / or identification of pig breeds with logarithmic traits of ribs; (3) Adjustment of group output; (4) Screening and / or identification of superior varieties; (5) Screening and / or identification of high-efficiency genetic resources of superior varieties; (6) Identification of parentage.

[0040] In summary, the beneficial effects of this invention are as follows: 1. Achieving precise breeding of the specific trait (number of rib pairs) of Meihua Star Pig: This invention obtains genetic markers closely related to the key economic traits of Meihua Star Pig (especially the number of rib pairs), enabling precise selection of these traits, shortening the breeding cycle, and accelerating genetic progress.

[0041] 2. Comprehensive Integration of Multiple Types of Genetic Variation Information to Enhance the Depth and Breadth of Genome Analysis: This invention aims to overcome the limitations of existing chips that primarily rely on SNPs (Synthetic Nuclei), innovatively integrating various types of genetic variation information, such as SNPs, insertions / deletions (InDels), and structural variations (SVs), into the chip design. This provides a richer and more accurate genetic basis for the genetic improvement of the Meihua Star Pig. The integration of multi-dimensional genetic information helps to discover key functional variations overlooked by traditional SNP chips, providing a more comprehensive basis for breeding decisions.

[0042] 3. In-depth analysis of the genetic regulatory mechanisms of economic traits: This invention integrates QTL (eQTL / sQTL) information related to economic traits from large databases such as FarmGTEx. While identifying the genetic loci associated with the traits, it reveals how these loci regulate the final traits by affecting gene expression levels or splicing patterns in different tissues. This will help reveal the deep genetic regulatory network of important economic traits and provide new clues for gene function research and breeding target discovery.

[0043] 4. Promoting the protection, development, and sustainable utilization of Meihua Star Pig genetic resources: Developing specialized breeding chips for Meihua Star Pigs will help systematically assess their population's genetic diversity, genetic structure, and kinship with other pig breeds, providing data support for formulating scientific conservation strategies. Simultaneously, it will allow for more efficient integration of their superior genes into the breeding systems of commercial pig breeds, achieving innovative utilization of local pig breed genetic resources, thereby enhancing their market competitiveness and achieving a win-win situation for both economic benefits and genetic resource protection. Attached Figure Description

[0044] Figure 1 This is a flowchart of the chip design in Embodiment 1 of the present invention.

[0045] Figure 2 This is a map showing the distribution of microarray loci on the whole genome of Sscrofa11.1.113; Figure 3 A genomic functional annotation diagram of microarray sites; Figure 4 This represents the number of priority loci on different chromosomes. Figure 5 This is a graph showing the minimum allele frequency (MAF) of SNPs. Figure 6 Principal component analysis plot; Figure 7 This is a topological diagram of the evolutionary tree. Detailed Implementation

[0046] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments will be clearly and completely described below with reference to the accompanying drawings. The following embodiments are used to illustrate the present invention, but are not intended to limit the scope of the present invention.

[0047] Example 1: The method for screening molecular markers for logarithmic traits of ribs in Plum Blossom Star pigs obtained by the present invention. 1. Sample and Data Acquisition 519 Sika Star pigs were selected from the core breeding farm. DNA was extracted from tail tissues and genotyped. Simultaneously, logarithmic phenotypic data of the ribs were collected using a Vetoo GJ-2 high-frequency digital X-ray (DR) machine. Whole-genome 20× resequencing was performed on 102 Sika Star pigs, while genotyping was conducted on the remaining 417 pigs using an 80K gene chip. The collection of logarithmic phenotypic data of the ribs using the DR machine was performed according to conventional methods; however, other instruments can also be used to collect this data, and this invention is not limited thereto.

[0048] 2. Obtaining SNP sites 2.1 Detection of SNP sites in the whole genome of resequencing individuals For adapters and low-quality reads in the raw sequencing data, the data processing steps are as follows: remove adapter sequences; remove reads with more than 3% N bases; remove reads with a length of less than 30 bases; remove reads with a low-quality (quality value less than 15) base ratio of more than 40%.

[0049] The obtained quality-controlled files were aligned to the pig reference genome (https: / / ftp.ensembl.org / pub / release-115 / fasta / sus_scrofa / dna / , Sus_scrofa.Sscrofa11.1) using BWA software. Then, samtools was used to sort, deduplicate, remove redundancy, and index the obtained BAM files, thus obtaining the preliminarily processed BAM files.

[0050] Genetic variant detection and genotyping were performed using the GATK tool. First, the Haplotype Caller tool was used to detect variants in each sample, generating GVCF files. Subsequently, the CombineGVCFs tool was used to merge all GVCF files, and the GenotypeGVCFs tool was used for joint genotyping to obtain VCF files containing SNP variant information.

[0051] To ensure the accuracy of the variant data, we implemented rigorous quality control. First, SNP loci were extracted using the SelectVariants tool, followed by hard filtering using the Variant Filtration tool. The filtering parameters included: QD < 2.0, QUAL < 30.0, SOR > 3.0, FS > 60.0, MQ < 40.0, MQRankSum < -12.5, and ReadPosRankSum < -8.0. Based on this, variants with a coverage greater than 30% and a minor allele frequency (MAF) greater than 0.01 were retained, while SNPs within a 5 bp radius of the InDel locus were removed, ultimately yielding 31,547,878 SNP loci and 3,700,872 InDel loci. Plink was used for quality control of the SNPs and InDel loci, removing loci with a detection rate less than 90% and a minimum allele frequency less than 0.05, resulting in 21,529,984 high-quality SNPs and 1,031,493 high-quality InDel loci for subsequent analysis.

[0052] Four different tools, Delly (v1.2.6), Manta (v1.6.0), Wham (v1.8.0), and Smoove (v0.2.8), were used to detect insertions and deletions. SVs with a deletion rate of <30% and MAF >0.01 were retained, resulting in 17,998 SV sites. The detection methods were all performed in accordance with the tool's instructions, and this invention does not impose any limitations.

[0053] 2.2 Obtaining the Candidate Site Set Comprehensive quality control was performed on the microarray data obtained from SNP genotyping. The quality control standards for microarray data are as follows (all of the following quality control processes can be completed using PLINK software): SNPs with unknown physical locations or located on the X chromosome were removed; the call rate for a single SNP locus reached 90% or higher; and the call rate for an individual reached 90% or higher.

[0054] The genotype data after quality control were filled using whole-genome 20× resequencing data from 102 Sika Star pigs. The resulting bcf format files were then processed using bcftools software to remove R-values. 2 Loci with a mean value less than 0.9 and a mean amplitude of less than 0.05 were selected, and duplicate loci were removed. A total of 8,073,180 valid SNP loci were obtained for subsequent GWAS analysis.

[0055] ① Locus set 1 obtained In one embodiment of the invention, GWAS was performed on SNPs, InDel, and SVs based on kinship construction and genome-wide association analysis. First, 20× resequencing data of the whole genomes of 102 Sika Star pigs were used to construct a kinship matrix based on 21,529,984 high-quality SNPs to correct for genetic correlations caused by population structure and kinship, reducing false positives. Subsequently, GWAS was performed on SNPs only after genotyping of 417 Sika Star pigs, and a kinship matrix was constructed based on 8,073,180 valid SNPs after quality control of the genotyping results for mixed linear model analysis.

[0056] This invention uses the single-label regression analysis method in GCTA software for GWAS analysis, and the mixed linear model is as follows:

[0057] In the above model, y Indicates phenotypic value; b For the effect of the variation to be tested, a This indicates the remaining polygenic effect. , For individual additive genetic variance, G This is a kinship matrix constructed based on SNPs. X and Z These are the correlation matrices for b and a, respectively; e Represents the residual effect vector. , This represents the residual variance.

[0058] GWAS analysis yielded 9757 significant loci, including 9669 SNP loci, 78 Indel loci, and 9 SV loci. These loci constitute locus set 1A.

[0059] Pig cis-eQTL and cis-sQTL data were downloaded from the publicly available database FarmGTEx (https: / / piggtex.farmgtex.org / ), and QTL loci with FDR < 0.05 were extracted as candidate loci. This set of loci constitutes locus set 1B.

[0060] ② Locus set 2 obtained Considering chip compatibility, in one embodiment of the present invention, a total of 12,352 loci were screened based on the porcine 80K functional locus gene chip (Wuhan Shadow Gene Technology Co., Ltd.), forming locus set 2.

[0061] ③ Locus set 3 obtained To improve the uniformity of the distribution of microarray loci across the whole genome, enhance the accuracy of association analysis, and ensure that microarray loci are linked to potential causative mutations, while prioritizing highly polymorphic loci in the Meihuaxing pig population to make the microarray more consistent with the genetic background of the population, allele frequencies of all SNP loci in all individuals were calculated, and loci with the lowest allele frequency greater than 0.2 were selected, resulting in a total of 11,992,385 loci, constituting locus set 3.

[0062] 2.3 Optimization of the site set The process steps for optimizing the above candidate site set are as follows: Figure 1 As shown, specifically: Regarding locus set 1A and locus set 1B: The intersection of the significant loci obtained from the above GWAS analysis (i.e., locus set 1A) and the significant eQTL / sQTL loci in the FarmGTEx database (i.e., locus set 1B) is given a priority of level 1, which is used for the precise selection and functional analysis of the specific trait (number of rib pairs) of the Plum Blossom Star Pig. Regarding locus set 2, the priority of the porcine 80K functional locus gene chip locus (i.e., locus set 2) is set as level two to ensure that the chip data can be interfaced with existing mainstream commercial chip data. Regarding locus set 3, the priority of polymorphic loci (i.e., locus set 3) is set to level three, serving as density compensation markers to realize a genome-wide genetic marker framework, ensuring that loci achieve uniform physical coverage on chromosomes, in order to support robust genome breeding value estimation. Then, optimization is performed based on statistical analysis of window filling.

[0063] To ensure a uniform distribution of SNP loci across the chromosome, in one embodiment of this invention, chromosomes are segmented into windows of 1.2 Mb, and the density of candidate SNP loci within each window on each chromosome is calculated. Further screening is performed based on the number of SNPs within each window, and the selected candidate loci are then prioritized into three categories: A. If the number of SNPs inside a window is 1, then the SNPs inside that window are directly selected as candidate sites.

[0064] B. If the number of SNPs within the window is greater than or equal to 2, then further filtering based on additional information about the loci is required. The filtering method is as follows:

[0065] In the formula above, and These are the start and end positions of the window, respectively. and It is the location of the target SNP in the window; for and The average value at each location. This can be minimized. SNP and These two sites will be retained, and ultimately, they will be used as candidate sites.

[0066] C. When the number of SNPs inside the window is 0, all unselected sites are supplemented and filtered, and further filtered based on the additional information of these sites. The filtering conditions are based on priority (priority 1 > priority 2 > priority 3), and finally the site with the highest priority is selected as the candidate site.

[0067] A total of 5001 sites were obtained after screening, including 8 SVs, 8 InDels, and 4985 SNPs. The 8 SVs are as follows: Located at position 88915382 on chromosome 1, the original base sequence is shown in SEQ ID NO.1, and the modified sequence is C; located at position 31760812 on chromosome 2, the original base sequence is C, and the modified sequence is shown in SEQ ID NO.2; located at position 16168698 on chromosome 4, the original base sequence is shown in SEQ ID NO.3, and the modified sequence is G; located at position 116505905 on chromosome 6, the original base sequence is shown in SEQ ID NO.4, and the modified sequence is T; located at position 89528530 on chromosome 7, the original base sequence is shown in SEQ ID NO.5, and the modified sequence is C; located at position 91513914 on chromosome 7, the original base sequence is shown in SEQ ID NO. As shown in NO.6, the mutated form is T; located at position 91896482 on chromosome 7. The original base sequence is shown in SEQ ID NO.7, and the mutated form is T; located at position 91896482 on chromosome 7. The original base was C, and the mutated base sequence is shown in SEQ ID NO.7. As shown in NO.8, the eight InDels include those located on chromosome 7: position 95588761 (previously GT, now G); position 97155480 (previously A, now AT); position 97568477 (previously T, now TG); position 97620079 (previously G, now GAA); position 97812991 (previously G, now GTGAT); position 98074822 (previously T, now TC); position 98096522 (previously GT, now G); and position 101415740 (previously A, now AG). The SNP sites are shown in Table 1.

[0068] Example 2: Gene chip related to logarithmic traits of pig ribs Based on the 5001 loci provided in Example 1, gene chips can be fabricated using conventional methods in the art, and this invention is not limited thereto. The chip specification can be a 5k chip, or it can be used for fabricating larger chips, but the minimum is not less than 4k. In one embodiment of this invention, the above-mentioned loci are preferably fabricated as a 5k liquid-phase chip.

[0069] Example 3: Detection of the logarithm of pig ribs Based on the SNP5001 sites obtained according to this invention, a 5K liquid phase chip was fabricated using existing technology. The fabrication method of the liquid phase chip adopts conventional methods in the art, and this invention is not limited thereto. The 5K liquid phase chip prepared using the sites provided by this invention was used to detect samples, and the specific method is as follows: DNA was extracted from the tail tissue of 200 newly collected Sika Star pigs, and genotyping was performed using a 5K liquid-phase chip prepared from the loci provided in Example 1. The genotyping method employed conventional techniques in the art, and this invention does not impose any limitations. The chip test results were then statistically analyzed, and the statistical and analytical results are as follows: Figures 2-7 As shown, the average detection rate of the chip site is 99.73%, indicating that the chip prepared using the sites provided by this invention is extremely sensitive, rarely missing target signals, and possesses high reliability. According to Figure 2 The SNP chromosome distribution map shown shows that the SNP sites on each chromosome are evenly distributed and fully covered. Chromosome 1 has the most SNPs, which is consistent with the proportion of the genome length, indicating that the microarray has high genome coverage and can comprehensively capture genome variation information. Figure 3 The results are from genome functional annotation. This invention uses ANNOVAR to perform functional annotation on the microarray based on the Sscrofa11.1.113 reference genome. The results show that the functional regions of SNP sites are comprehensively covered, including regulatory regions such as intergenic regions and intron regions, as well as functional elements such as exons, UTRs, and non-coding RNAs. It can simultaneously detect coding region variations and regulatory region variations, significantly improving the probability of discovering functional SNPs. Figure 4 The graph shows the number of sites of each priority on different chromosomes. The graph can be seen to show the number of sites of each priority on each chromosome. This indicates that the chip adopts a scientific three-level priority design, with feature core sites dominating and candidate sites being reasonably supplemented. The coverage of each chromosome is balanced and without omission, which ensures the accuracy and comprehensiveness of genome selection. Figure 5 This is the minimum allele frequency (MAF) map of SNPs, which is the frequency of the allele with a frequency of no more than 0.5 at a given SNP locus. It is an important indicator for the quality analysis of genotype data. As can be seen from the map, the MAF distribution is biased towards the high-value region, with the vast majority of loci having an MAF > 0.2. This indicates a high polymorphism information content and a high genotype identification accuracy, laying a data foundation for the accurate genetic assessment of the number of ribs in pigs. Figure 6 and Figure 7 These are the results of genetic analysis, among which... Figure 6 The principal component analysis (PCA) results show that PC1 explains 7.45% of the genetic variation, while PC2 explains 5.74%. The population stratification is clearly discernible, indicating that the chip loci have strong resolution and can effectively distinguish individuals with different genetic backgrounds, providing a reliable basis for population structure correction for association analysis. Figure 7The clustering results of the displayed phylogenetic tree samples are completely consistent with PCA, indicating that the chip can accurately reflect the true genetic relationships of individuals. It can be seen that the liquid-phase chip fabricated based on the loci provided in this invention is of qualified quality and can be used for the analysis of rib counts in pigs.

[0070] Example 4 According to the present invention, 5001 molecular markers consisting of SNP, SV, and InDel sites were obtained from the logarithmic traits of the ribs of the Plum Blossom Star Pig. These markers were compared with a detection chip made only of SNP sites to illustrate the technical effect of the present invention. The specific method steps are as follows: In one embodiment of the present invention, breeding values ​​of a target population were estimated and the prediction effect was evaluated based on two different datasets. On one hand, a dataset containing only SNP loci was used; on the other hand, a complete microarray dataset containing SNP, SV, and InDel loci of the present invention was used to construct rrBLUP models for breeding value estimation. The purpose of this analysis was to evaluate whether integrating different types of genetic variation loci could improve the accuracy of phenotypic prediction and provide a basis for subsequent breeding selection based on whole-genome information. The results showed that the phenotypic prediction accuracy based on the dataset containing only SNP loci was 0.765, while the phenotypic prediction accuracy improved to 0.860 using the microarray dataset of the present invention. This result indicates that the accuracy of breeding value prediction is significantly improved after integrating SV and InDel loci in the present invention.

[0071] Of course, those skilled in the art can also design specific detection probes, KASP, detection kits and other tools based on the molecular markers disclosed in this invention, and can also fix the probes on solid-phase chips for use. Since these design methods are all existing technologies, they will not be described in detail for the sake of saving space.

[0072] As can be seen from the embodiments of this invention, the SNP molecular markers obtained by this invention can be widely applied in scenarios such as pig farming, breeding, genetic resource protection, and forensic identification, possessing the dual technical effects of dominant phenotype prediction and recessive genetic value mining. At the dominant phenotype prediction level, it can accurately detect pig body size, suitable for early body size potential assessment of piglets in breeding enterprises and prediction of adult pig specifications in slaughtering and processing enterprises. It overcomes the lag and subjectivity of traditional observation and weighing, allowing for the identification of dominant individuals at the piglet stage, reducing ineffective breeding costs, and providing targeted improvements for body size traits. It can also achieve in vivo non-destructive screening and identification of breeds with logarithmic traits of pig ribs, assisting breeding bases and conservation farms in screening individuals with high meat yield potential, providing molecular evidence for breed identification, avoiding breed mixing, and ensuring the purity of purebred resources. Based on these detection results, large-scale breeding bases can stratify the genetic potential of the population, optimize breeding strategies, dynamically adjust population yield, achieve "selection of the best among the best," and improve the overall production performance and economic benefits of the population. In terms of exploring the value of recessive genetic traits, this technology can be applied throughout the entire process of cultivating superior varieties. It helps breeding companies accurately screen parents with superior genotypes, build a molecular marker-assisted breeding system, shorten the breeding cycle, reduce breeding risks, and cultivate high-quality new varieties in a targeted manner. It can also explore the potential value of existing genetic resources, screen rare and superior individuals to establish core groups, monitor genetic diversity, avoid variety degradation, and ensure the sustainable use of superior genetic resources. At the same time, it can accurately identify parentage, ensure accurate breeding pedigrees and reliable variety traceability, provide scientific evidence for genetic disputes, and regulate industry order.

[0073] Therefore, the technical solutions provided by this invention, including SNP molecular markers, probes, chips, KASP, and detection methods, construct a complete technical system, achieving "cost reduction, efficiency improvement, quality enhancement, and resource protection," promoting the transformation of pig breeding towards molecular precision, providing support for the standardized and large-scale development of the pig industry, helping to break through industry bottlenecks, and enhancing core competitiveness.

[0074] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-described technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes, and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. Molecular markers for the logarithmic traits of ribs in Plum Blossom Star pigs, characterized in that, Includes 8 SVs, 8 InDels, and 4985 SNPs; Among them, the 8 SVs include: Located at position 88915382 on chromosome 1, the original base sequence is shown in SEQ ID NO.1, and the modified sequence is C; Located at position 31760812 on chromosome 2, the original base was C, and the modified base sequence is shown in SEQ ID NO.2; Located at position 16168698 on chromosome 4, the original base sequence is shown in SEQ ID NO.3, and the modified sequence is G; Located at position 116505905 on chromosome 6, the original base sequence is shown in SEQ ID NO.4, and the modified sequence is T; Located at position 89528530 on chromosome 7, the original base sequence is shown in SEQ ID NO.5, and the modified sequence is C; Located at position 91513914 on chromosome 7, the original base sequence is shown in SEQ ID NO.6, and the modified sequence is T; Located at position 91896482 on chromosome 7, the original base sequence is shown in SEQ ID NO.7, and the modified sequence is T; Located at position 91896482 on chromosome 7, the original base was C, and the modified base sequence is shown in SEQ ID NO. 8; Of these, 8 InDels include those located on chromosome 7. At position 95588761, the base before the mutation is GT, and the base after the mutation is G; At position 97155480, the base before the mutation is A, and the base after the mutation is AT; At position 97568477, the base before the mutation is T, and the base after the mutation is TG; At position 97620079, the base before the mutation is G, and the base after the mutation is GAA; At position 97812991, the base before the mutation is G, and the base after the mutation is GTGAT; At position 98074822, the base before the mutation is T, and the base after the mutation is TC; At position 98096522, the base before the mutation is GT, and the base after the mutation is G; At position 101415740, the base before the mutation is A, and the base after the mutation is AG; The SNPs are shown in the table below: The pig breed mentioned is the Meihuaxing pig.

2. A probe for detecting the logarithmic trait of pig ribs, characterized in that, Used for detecting the molecular marker described in claim 1.

3. A chip for detecting the logarithmic traits of pig ribs, characterized in that, Includes the probe described in claim 2.

4. A KASP assay for detecting the logarithmic traits of pig ribs, characterized in that, The molecular marker used to detect the SNP1-5001.

5. A kit for detecting the logarithmic traits of pig ribs, characterized in that, Includes the probe of claim 2, or the KASP of claim 4.

6. The method for detecting molecular markers according to claim 1, characterized in that, This includes using the molecular marker combination of claim 1, the probe of claim 2, the chip of claim 3, the KASP marker of claim 4, or the kit of claim 5 to detect the sample, and determining the number of rib pairs in the sample based on the detection results.

7. The application of molecular markers for the logarithmic traits of pig ribs, characterized in that, Use this molecular marker for: (1) Detection of pig body size; (2) Screening and / or identification of pig breeds with logarithmic traits of ribs; (3) Adjustment of group output; (4) Screening and / or identification of superior varieties; (5) Screening and / or identification of high-efficiency genetic resources of superior varieties; (6) Identification of parentage.

Images