Molecular markers associated with pork quality traits and their applications

Abstract

This invention belongs to the field of molecular marker-assisted selection technology for pig breeding and pigs, specifically involving molecular markers related to pork quality traits and their applications. This invention will be located in... PPP3CB 5' flanking promoter region of the gene InDel Polymorphic sites are associated with pork quality traits including water loss rate, water holding capacity, and intramuscular fat. InDel When the genotype at the polymorphic locus is TT, the pork has a lower water loss rate, a higher water holding capacity, and a higher intramuscular fat content. InDel InDel When the genotype of a polymorphic locus is deleted, the pork has a higher water loss rate, lower water holding capacity, and lower intramuscular fat content. This invention enables early prediction and selection of meat quality traits that can only be measured after slaughter, during the early stages of pig growth and development. It not only allows for live detection and screening of pork quality traits but also significantly shortens the generation interval, accelerates the breeding process, and provides technical support for early pig breeding.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker-assisted selection technology for pig breeding and pigs, specifically involving molecular markers related to pork quality traits and their applications. Background Technology

[0002] In recent years, with the rapid development of genomics research and the deepening understanding of gene structure and function, marker-assisted selection (MAS), a novel breeding technology based on DNA polymorphism for genetic analysis, has gradually developed and gained widespread attention. This technology identifies genotypic differences between individuals at the molecular level through DNA markers, offering significant advantages. Molecular markers, as direct reflections of DNA sequence variations, can be detected in different tissues and at various developmental stages of an organism, unaffected by external factors such as season and environment. Furthermore, molecular markers are rich in polymorphism, diverse in type, and most are co-dominant, effectively distinguishing between homozygotes and heterozygotes. Leveraging these advantages, MAS exhibits high accuracy in genetic selection, enabling early selection and significantly shortening the breeding cycle. Combining it with traditional breeding methods can further improve selection efficiency and accelerate the breeding process, thus possessing broad application prospects.

[0003] InDels (Insertion / Deletion) refer to the insertion or deletion of small nucleotide fragments at the same locus in the genome of closely related species or different individuals of the same species. They are a phenomenon resulting from homologous sequence alignment and the creation of gaps. InDels have significant applications in genetic research, population genetics, molecular evolution, and disease diagnosis. For example, some InDels may be associated with human hereditary diseases; detecting these InDels can aid in disease diagnosis and genetic counseling. In population genetics, analyzing InDel differences among individuals can reveal the genetic structure and evolutionary history of a population, and InDels are often used as molecular markers for gene localization and genetic mapping. Promoters, as crucial cis-regulatory elements in eukaryotic gene expression regulation, contain rich information on gene regulation. The intensity and spatiotemporal specificity of gene expression largely depend on the regulatory role of the promoter region. Therefore, SNPs in the 5′ flanking promoter regions of functional genes often have greater biological significance and may further alter gene expression levels by influencing transcriptional regulation.

[0004] calcineurin is a Ca2+ neurotransmitter enzyme. 2+A key component of the calcineurin-dependent signaling pathway, PPP3CB participates in the regulation of myofibril development, differentiation, and hypertrophy in skeletal muscle, playing a particularly important role in the formation of the slow-oxidation myofibril phenotype. Once activated, PPP3CB can dephosphorylate various substrates, including transcription factors, receptors, and ion channels, thereby regulating their physiological functions. PPP3CB is the catalytic subunit of the serine / threonine protein phosphatase calcineurin, and is a Ca2+-dependent calcineurin-dependent signaling pathway. 2+ Calmodulin-dependent serine / threonine protein phosphatases belong to the protein phosphatase 2B (PPP3) family. These proteins typically exist as heterodimers, composed of a catalytic subunit (PPP3C) of approximately 60 kDa and a regulatory subunit (PPP3R) of approximately 19 kDa, both of which have multiple isoforms. Among the catalytic subunit PPP3C, three isoforms have been identified: PPP3CA (CnAα), PPP3CB (CnAβ), and PPP3CC (CnAγ). The α and β isoforms are widely distributed in various tissues, while the γ isoform is mainly expressed in testicular and brain tissues. All PPP3C isoforms contain a serine / threonine phosphatase catalytic domain, as well as regulatory domains involved in autoinhibition, calmodulin binding, and PPP3R binding; in the absence of Ca2+, they exhibit various regulatory domains. 2+ When calmodulin is present, its self-inhibitory domain can bind to the active site of calmodulin, thereby inhibiting its enzyme activity.

[0005] Although PPP3CA and PPP3CB show overlapping expression in various tissues, their physiological functions are not entirely the same. Studies have shown that CnAα mutant mice are smaller and only survive for a few weeks, while PPP3CB (CnAβ) mutant mice survive longer and maintain reproductive capacity. Further research has revealed that the upstream superenhancer of PPP3CB can enhance the transcriptional level of PPP3CB by recruiting the transcription factor MEF2C, while PPP3CB enhances the transcriptional activity of MEF2C by dephosphorylating NFATc1, thereby promoting the conversion of glycolytic myofiber to oxidative myofiber. Therefore, PPP3CB is closely related to energy metabolism and myofiber type regulation, and is an important candidate functional gene affecting economic traits such as pork quality. However, to date, there are no reports on the InDel site of the porcine PPP3CB gene promoter. Summary of the Invention

[0006] Based on the above background, this invention relates to molecular markers related to pork quality traits and their applications. By developing InDel molecular markers associated with pork quality traits, including water loss rate, water holding capacity, and intramuscular fat, through a specific DNA fragment from the 5' flanking promoter region of the porcine PPP3CB gene, this invention provides an effective and reliable molecular-assisted selection method for the identification of pork quality traits and the breeding and improvement of pigs.

[0007] The technical solution of this invention is as follows: Molecular markers associated with pork quality traits are located in the 5' flanking promoter region of the porcine PPP3CB gene. The nucleotide sequence of the molecular markers is shown in SEQ ID NO.1. An InDel polymorphism site is present at position 152 of the nucleotide sequence shown in SEQ ID NO.1, and the InDel polymorphism site is characterized by an insertion / deletion variation of a T base. SEQ ID NO.1: TCAGAGAGAGCCATGACACAAAGATATCTATCTGTGATTGACAGTGAGGAGCCAAAAAGGAGCTGAAGGATATTTGAAGGGCGTATATTCAAGGTAGGAGTCAATGGGACCTAATATAGACTGACTTTCCCTATTACTAATTATTA TTTTTTGCTTTTTAGGGCCACACCCGCAGCATACGGAGGTTCCCAGGCTAGGGGTCGAATTGGAGCTATAGCTGCTGGCCTATACCACAGCCACAGCAATGCAGGATTTGAGATGCATTTGTGACCTACACCACAGCTCACGACAA.

[0008] Furthermore, the pork quality traits include at least one of water loss rate, water holding rate, and intramuscular fat.

[0009] Furthermore, when the genotype of the Indel polymorphic site is T / T, the water loss rate of pork is low, the water holding rate of pork is high, and the intramuscular fat of pork is high. When the genotype of the Indel polymorphic site is deleted, the pork has a higher water loss rate, a lower water holding rate, and a lower intramuscular fat content.

[0010] Based on the same inventive concept, the present invention also provides the application of biological materials related to pork quality traits, said biological materials being selected from any one of A1) to A4) below; A1) Molecular markers related to pork quality traits as claimed in any one of claims 1 to 3; A2) Primers for amplifying the molecular markers related to pork quality traits in A1), said primers comprising a forward primer with the nucleotide sequence shown in SEQ ID NO.2 and a reverse primer with the nucleotide sequence shown in SEQ ID NO.3: Forward primer F SEQ ID NO.2: 5'-GAACCCCTAAAGGACCTGGC-3'; Reverse primer R SEQ ID NO.3: 5'-ACGAGGCTAAGGGATCAGGT-3' A3) A kit containing the primers described in A2); A4) Probes or gene chips for specific detection of the InDel polymorphic site genotype as described in any one of claims 1 to 3; The application includes any one of the following B1) to B4): B1) Application in detecting or assisting in the detection of pork quality traits; said pork quality traits include at least one of water loss rate, water holding rate, and intramuscular fat; B2) Application in the genetic improvement of pork quality traits; B3) Application in screening pig breeds with high water-holding capacity and low water loss rate pork quality; B4) Application in the selection, breeding, or assisted breeding of pig breeds with high water-holding capacity and low water loss rate in pork quality.

[0011] Based on the same inventive concept, the present invention also provides a method for detecting pork quality traits, comprising the following steps: Genomic DNA was extracted from the individual pigs to be tested. Using the genomic DNA as a template, PCR amplification was performed using the primers described in claim 4 to obtain the amplification product. The amplification product was sequenced. Pork carrying the molecular marker with the nucleotide sequence described in claim 1 as SEQ ID NO.1 had a higher water loss rate, a lower water holding rate, and a lower intramuscular fat content. Alternatively, genomic DNA can be extracted from individual pigs to be tested, and probes or gene chips specifically detecting InDel polymorphic sites can be used to detect the pig's genomic DNA to obtain the base information of the InDel polymorphic sites and identify their genotypes. For example, when the InDel polymorphic site is TT, the pork has a lower water loss rate, a higher water holding rate, and a higher intramuscular fat content; when the genotype of the InDel polymorphic site is deleted, the pork has a higher water loss rate, a lower water holding rate, and a lower intramuscular fat content.

[0012] Furthermore, genomic DNA was extracted from the blood of the pigs to be tested.

[0013] Based on the same inventive concept, the present invention also provides a method for breeding pigs, which involves extracting genomic DNA from an individual pig to be tested, using a probe or gene chip specifically for detecting InDel polymorphic sites to detect the genomic DNA of the pig, obtaining the base information of the InDel polymorphic sites as described in claim 1, identifying their genotypes, and selecting pigs with the genotype of T / T at the InDel polymorphic sites as parents for breeding.

[0014] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention associates the InDel polymorphic site located in the 5' flanking promoter region of the PPP3CB gene with pork quality traits, including water loss rate, water-holding capacity, and intramuscular fat. This develops new molecular markers for pork quality trait correlation, enabling early prediction and selection of meat quality traits that can only be measured after slaughter, even in the early stages of pig growth and development (or at birth). It not only allows for live detection and screening of pork quality traits but also significantly shortens generation intervals, accelerates the breeding process, and provides technical support for early pig breeding. Based on the markers of this invention, it can help establish efficient marker-assisted selection (MAS) schemes. By selecting individuals with the dominant genotype (TT) as parents, it is possible to selectively breed pig breeds or strains with superior meat quality (high water-holding capacity, high intramuscular fat). Attached Figure Description

[0015] Appendix Figure 1 Nucleotide sequence alignment results and InDel sites for the 5' flanking promoter fragments of PPP3CB in Large White, Duroc, Huainan, Jianli, and Laiwu pigs.

[0016] Appendix Figure 2 Analysis of PPP3CB expression levels in lean pigs and Chinese local pigs.

[0017] Appendix Figure 3 Comparison of PPP3CB promoter activity between imported pigs and local Chinese pig breeds. Detailed Implementation

[0018] To make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described in detail below with reference to its embodiments; it should be understood that the specific embodiments described herein are only for explaining the present invention and are not intended to limit the present invention.

[0019] Example 1: Development of InDel polymorphic sites based on porcine PPP3CB 5' flanking promoter region-specific DNA fragments Pigs of foreign bloodlines (Large White and Duroc) and local Chinese pig breeds (Huainan, Jianli, and Laiwu) were selected as experimental materials. Primers were designed based on the pig PPP3CB gene genome sequence (GeneBank accession number DQ396603), and the primer sequences are as follows: Forward primer F: 5' TCAGAGAGAGCCATGACACAA 3', Reverse primer R: 5' CTGGATGTGGTGTCGAGTGCTG 3'.

[0020] PCR amplification was performed on the genomic DNA of Large White pigs, Duroc pigs, Huainan pigs, Jianli pigs, and Laiwu pigs using the primers mentioned above (for the extraction method of pig genomic DNA, please refer to the literature: Xiong Yuan, Introduction to Biochemical and Molecular Genetic Experiments in Pigs, Beijing: China Agriculture Press, 1999, 39-51).

[0021] The PCR reaction system is shown in Table 1.

[0022] Table 1: PCR reaction system The PCR reaction conditions are shown in Table 2.

[0023] Table 2: PCR reaction conditions The PCR products from the aforementioned pig breeds were purified, cloned, and then sequenced. Sequencing was performed by Shanghai Sangon Biotech Co., Ltd. The sequence alignment results, obtained through Cluster W alignment analysis, are shown below. Figure 1 The nucleotide sequence was found to be as follows: The sequence shown in SEQ ID NO.1 (TCAGAGAGAGCCATGACACAAAGATATCTATCTGTGATTGACAGTGAGGAGCCAAAAAGGAGCTGAAGGATATTTGAAGGGCGTATATTCAAGGTAGGAGTCAATGGGACCTAATATAGACTGACTTTCCCTATTACTAATTATTATTTTTTGCTTTTTAGGGCCACACCCGCAGCATACGGAGGTTCCCAGGCTAGGGTCGAATTGGAGCTATAGCTGCTGGCCTATACCACAGCCACAGCAATGCAGGATTTGAGATGCATTTGTGACCTACACCACAGCTCACGACAA.) contains an InDel mutation of T base insertion / deletion at position 152 bp. Specifically, the Large White and Duroc pig breeds have T base insertion mutations at this site, while the Chinese local pig breeds Huainan, Jianli, and Laiwu pigs have T base deletion mutations at this site.

[0024] Example 2: Association analysis and application of the genetic markers cloned in this invention with pork quality traits To determine whether the InDel variant in the 5' flanking promoter region of the porcine PPP3CB gene is related to phenotypic differences in pigs, an experimental population of 88 Large White pigs × Meishan pigs from the Key Laboratory of Swine Genetics and Breeding, Ministry of Agriculture, Huazhong Agricultural University, Wuhan, Hubei Province, China (Xu DQ, Xiong YZ, Liu M, Lan J, Ling XF, DengCY, Jiang SW. Association analyses with carcass traits in the porcine KIAA1717 and HUMMLC2B genes. Asian-Aust J Anim Sci. 2005, 18: 1519-1523) was selected. Polymorphism was detected by sequencing, and the correlation between the InDel variant in the 5' flanking promoter region of the PPP3CB gene and pork quality traits in different pig breeds was analyzed. One-marker ANOVA was performed using the GLM program in SAS statistical software. The model is as follows: Y_{ijk} = μ + InDel_i + AGE_j + CROSS_k + ε_{ijk} Where Y_{ijk} represents the observed phenotypic traits, μ is the population mean, InDel_i is the SNP type fixed effect (i=0 missing, i=1 normal), AGE_j is the age effect (continuous variable), CROSS_k is the crossbreeding pattern fixed effect (k=1 large, k=2 large), and ε_{ijk} is the random error term. Parameter estimation was performed using the PROC GLM procedure in SAS 9.4, and the adjusted mean was calculated using the least squares method. Between-group comparisons in InDel were corrected using the Tukey-Kramer method, with a significance level set at α=0.05. Results are expressed as least squares mean ± standard error (corrected for age and crossbreeding pattern effects), and the mean difference and corrected p-value of significantly different groups are reported.

[0025] Table 3: Statistical analysis of the genotypes of the 5' flanking sequence of the porcine PPP3CB gene and pork quality traits. Note: The above values ​​are the least squares mean (standard error).

[0026] Among the 88 Large White × Meishan pig F2 generation individuals tested, 47 T-base deletion variants and 41 T-base insertion variants were observed at the InDel polymorphism site. The statistical analysis results of different genotypes and pork quality traits are shown in Table 3. Table 3 shows that there were highly significant differences in water loss rate (%), water holding capacity (%), and intramuscular fat (%) among different genotypes.

[0027] Example 3: Expression level analysis of PPP3CB gene in different varieties RNA was extracted from the muscle of 2-week-old Large White pigs, Duroc pigs, Huainan pigs, Jianli pigs, and Laiwu pigs (see invitrogen TRIzol). ® (Reagent instructions), and reverse transcribed RNA into cDNA. Using the reverse-transcribed cDNA as a template, real-time quantitative PCR was performed using designed primers to analyze the expression level of the PPP3CB gene in different varieties.

[0028] The DNA sequences of the primers used in real-time quantitative PCR are as follows: Forward primer F: GATAGCCTCCCTCTTGCTGC, Reverse primer R: TCCAAATGCAGGTGGCTCTT.

[0029] The real-time quantitative PCR system is shown in Table 4.

[0030] Table 4: Real-time quantitative PCR system The conditions for real-time quantitative PCR reaction are shown in Table 5.

[0031] Table 5: Real-time quantitative PCR reaction conditions are as follows See results Figure 3 It is evident that the expression level of PPP3CB in foreign-blooded pigs (Large White and Duroc pigs) is significantly higher than that in Chinese local pig breeds (Huainan pig, Jianli pig, and Laiwu pig).

[0032] Example 4: The effect of the InDel site of the present invention on the activity of the PPP3CB promoter Based on the aforementioned sequence alignment results, it was found that within the amplified 292bp region, the sequences were identical in both the imported pig group and the Chinese local pig group, while a stable InDel differential site existed between the two groups. Therefore, in this embodiment, one imported pig and one Chinese local pig were selected as representatives to amplify their corresponding PPP3CB promoter fragments and construct a luciferase reporter vector to compare the transcriptional activity of promoter fragments from different sources. The promoter sequence from the imported pig was named WT, and the promoter sequence from the Chinese local pig was named CT. Genomic DNA was extracted from the muscle tissue of 2-week-old imported pigs (Large White and Duroc) and Chinese local pig breeds (Huainan, Jianli, and Laiwu). Using this DNA as a template, the PPP3CB promoter sequence containing the InDel site was amplified using PPP3CB-Promoter primers. The primer sequences are as follows: PPP3CB-Promoter-F: GAACCCCTAAAGGACCTGGC; PPP3CB-Promoter-R: ACGAGGCTAAGGGATCAGGT.

[0033] The amplified fragment was 291 bp in length, and the annealing temperature was 60℃. The PCR reaction system and PCR reaction procedure are shown in Table 6.

[0034] Table 6: PCR reaction system and procedure (2) Connection of recycled products with carrier After PCR amplification, the obtained PCR products were detected by agarose gel electrophoresis. After the target band was completely separated, the gel containing the target fragment was cut under UV light, and the target band was recovered and purified using a gel extraction kit to obtain the purified PPP3CB promoter fragment.

[0035] The purified PCR product was ligated into the pMD18-T vector to construct a recombinant cloning vector. Subsequently, the ligation product was transformed into competent cells, and after ice bath, heat shock and recovery treatment, it was evenly spread on LB solid medium plates containing the corresponding antibiotics and incubated upside down at 37°C overnight.

[0036] Positive clone screening and recombinant plasmid extraction After cultivation, single colonies were picked and inoculated into LB liquid medium containing the corresponding antibiotics for expansion culture, and PCR identification was performed using the bacterial culture as a template. Simultaneously, the selected positive clones were sequenced to confirm the correctness of the inserted fragment sequence, ultimately obtaining positive recombinant strains containing the correct PPP3CB promoter fragment.

[0037] Positive clones with correct sequencing results were further cultured and recombinant plasmids were extracted using a plasmid extraction kit. The extracted plasmids were then subjected to concentration, purity, and enzyme digestion tests to ensure that the obtained recombinant plasmids met the requirements for subsequent cell transfection and luciferase reporter assays.

[0038] (4) Cell transfection After verification, the recombinant plasmid was used for cell transfection experiments. Specifically, cells were seeded in 6-well plates and cultured. When the cell confluence reached approximately 80%, the original culture medium was discarded, and the cells were gently washed twice with PBS buffer. Subsequently, 1.5 mL of serum-free Opti-MEM medium was added to each well, and the plates were incubated at 37°C in a 5% CO2 incubator for later use.

[0039] For each well of cells, add 4 μg of recombinant plasmid to 250 μL of Opti-MEM serum-free medium, mix gently, and prepare solution A; separately add 7 μL of Lipofectamine 2000 to 250 μL of Opti-MEM serum-free medium, mix gently, and prepare solution B. Incubate solutions A and B separately at room temperature for 5 min, then mix them, gently pipetting to mix, and incubate at room temperature for 20 min to form the plasmid-liposome complex.

[0040] The resulting complex was then slowly added to the corresponding wells and gently shaken to ensure full contact with the cells. After culturing at 37°C and 5% CO2 for 6 h, the transfection solution was discarded, the cells were washed twice with PBS buffer, and 2 mL of complete culture medium containing 10% fetal bovine serum was added to each well. The cells were then cultured for the specified time.

[0041] (5) Dual-luciferase activity detection Thirty-six hours after transfection, dual-luciferase activity was measured using the Promega Dual-Luciferase Reporter Assay System kit to evaluate the transcriptional activity of the PPP3CB promoter fragment.

[0042] Before testing, prepare the relevant working solutions according to the kit instructions: dilute 5× Passive Lysis Buffer with distilled water to prepare 1× working solution; add Luciferase Assay Substrate to Luciferase Assay Buffer II to prepare firefly luciferase detection working solution; dilute Stop Substrate with Stop Buffer to prepare working solution.

[0043] For the assay, the culture medium was first discarded, and the cells were gently washed twice with PBS buffer. Then, an appropriate amount of 1× Passive Lysis Buffer was added to each well, and the cells were lysed at room temperature for 30 min to allow for the full release of intracellular luciferase. After lysis, 10 μL of cell lysate was added to the assay plate or EP tube, followed by 50 μL of Luciferase AssayReagent II. After gentle mixing, the firefly luciferase activity was immediately measured. After the first reading, 50 μL of Stop&Glo Reagent was added to the same system, and after gentle mixing, the Renida luciferase activity was measured. The assay was performed using a multi-functional microplate reader.

[0044] Firefly luciferase activity and Renilla luciferase activity were obtained for each sample. The former reflects the ability of the PPP3CB promoter fragment to drive reporter gene expression, while the latter serves as an internal control to correct for transfection efficiency and cell state differences. The ratio of firefly luciferase activity to Renilla luciferase activity was used as relative fluorescence activity to characterize the transcriptional activity of the PPP3CB promoter.

[0045] (6) Results Analysis To verify the transcriptional regulatory activity of PPP3CB promoter fragments from different sources, this embodiment cloned representative sequences from foreign-blooded pigs (WT) and Chinese local pigs (CT) into pGL3-basic luciferase reporter vectors, constructing pGL3-WT and pGL3-CT recombinant plasmids, and performed dual-luciferase activity assays. The results showed that compared with the empty vector control group, the luciferase activity of both WT and CT recombinant vectors was significantly increased, indicating that this 291 bp region has significant promoter activity. Further comparison revealed that the relative fluorescence activity of the WT group was significantly higher than that of the CT group, indicating that the transcriptional activity of the PPP3CB promoter fragment from foreign-blooded pigs was higher than that from Chinese local pigs, suggesting that the InDel difference between the two may be an important molecular basis affecting promoter activity. Figure 3 ).

[0046] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Molecular markers associated with pork quality traits, characterized in that, The molecular marker is located in pigs PPP3CB In the 5' flanking promoter region sequence of the gene, the nucleotide sequence of the molecular marker is as follows: SEQ ID NO.1 As shown, SEQ ID NO.1 The nucleotide sequence shown contains a nucleotide at position 152. InDel Polymorphic sites, the Indel Polymorphic sites manifest as insertion / deletion variations of T bases: SEQ ID NO.1: TCAGAGAGAGCCATGACACAAAGATATCTATCTGTGATTGACAGTGAGGAGCCAAAAAGGAGCTGAAGGATATTTGAAGGGCGTATATTCAAGGTAGGAGTCAATGGGACCTAATATAGACTGACTTTCCCTATTACTAATTATTA TTTTTTGCTTTTTAGGGCCACACCCGCAGCATACGGAGGTTCCCAGGCTAGGGGTCGAATTGGAGCTATAGCTGCTGGCCTATACCACAGCCACAGCAATGCAGGATTTGAGATGCATTTGTGACCTACACCACAGCTCACGACAA.

2. The molecular marker related to pork quality traits according to claim 1, characterized in that, The pork quality traits include at least one of water loss rate, water holding rate, and intramuscular fat.

3. The molecular marker related to pork quality traits according to claim 2, characterized in that, The IndelInDel When the genotype of the polymorphic site is TT, the water loss rate of pork is low, the water holding rate of pork is high, and the intramuscular fat of pork is high. When the genotype of the Indel polymorphic site is deleted, the pork has a higher water loss rate, a lower water holding rate, and a lower intramuscular fat content.

4. The application of biomaterials related to pork quality traits, characterized in that, The biological material is selected from any one of A1) to A4) below; A1) Molecular markers related to pork quality traits as claimed in any one of claims 1 to 3; A2) Primers for amplifying the molecular markers related to pork quality traits in A1), said primers comprising nucleotide sequences such as SEQ ID NO.2 The forward primers and nucleotide sequences shown are as follows: SEQ ID NO.3 Reverse primer: Forward primer F SEQ ID NO.2: 5'-GAACCCCTAAAGGACCTGGC-3' ; Reverse primer R SEQ ID NO.3 :5'-ACGAGGCTAAGGGATCAGGT-3' A3) A kit containing the primers described in A2); A4) Specific detection as described in any one of claims 1 to 3 InDel Probes or gene chips for polymorphic loci genotypes; The application includes any one of the following B1) to B4): B1) Application in detecting or assisting in the detection of pork quality traits; said pork quality traits include at least one of water loss rate, water holding rate, and intramuscular fat; B2) Application in the genetic improvement of pork quality traits; B3) Application in screening pig breeds with high water-holding capacity and low water loss rate pork quality; B4) Application in the selection, breeding, or assisted breeding of pig breeds with high water-holding capacity and low water loss rate in pork quality.

5. A method for detecting the quality traits of pork, characterized in that, Includes the following steps: Genomic DNA was extracted from the pigs to be tested. Using the genomic DNA as a template, PCR amplification was performed using the primers described in claim 4 to obtain the amplification product. The amplification product was sequenced to carry the nucleotide sequence described in claim 1. SEQ ID NO.1 Pork with the molecular markers has a lower water loss rate, a higher water holding capacity, and a higher intramuscular fat content. Alternatively, genomic DNA can be extracted from individual pigs to be tested and specific detection methods can be used. InDel Probes or gene chips at polymorphic sites are used to detect porcine genomic DNA to obtain the results described in claim 1. InDDel The base sequence of polymorphic sites is used to identify the genotype, such as... InDel At the polymorphic site TT, pork exhibits lower water loss, higher water holding capacity, and higher intramuscular fat content; as described above. InDel When the genotype of a polymorphic locus is deleted, the water loss rate of pork is higher, the water holding rate of pork is lower, and the intramuscular fat of pork is lower.

6. The method for detecting pork quality traits according to claim 5, characterized in that, Genomic DNA was extracted from the blood of the pigs to be tested.

7. A method for breeding pigs, characterized in that, Genomic DNA was extracted from individual pigs to be tested and specific detection was performed. Indel Probes or gene chips at polymorphic sites are used to detect porcine genomic DNA to obtain the results described in claim 1. Indel The base sequence of polymorphic sites is used to identify their genotypes, and the selected sites are then analyzed. Indel Pigs with the TT genotype at the polymorphic locus were used as parents for breeding.

Images