Use of CAPS molecular marker GW18 in identifying foxtail millet resistance to glume blotch

By developing the CAPS molecular marker GW18 and using restriction endonucleases to identify polymorphisms on millet chromosome 6, the problem of identifying millet blast resistance has been solved, enabling rapid and accurate genotyping and improving the scale and precision of breeding.

CN122104988APending Publication Date: 2026-05-29GRAIN RES INST HEBEI ACAD OF AGRI & FORESTRY SCI +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
GRAIN RES INST HEBEI ACAD OF AGRI & FORESTRY SCI
Filing Date
2026-04-03
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

The lack of tightly linked functional markers in existing technologies for identifying millet blast resistance limits the large-scale and precise application of disease-resistant breeding.

Method used

We developed the CAPS molecular marker GW18 and used restriction endonucleases XceI or NspI to recognize the G/T polymorphism at 34523782 bp on chromosome 6 of millet. Through PCR amplification and enzyme digestion, we distinguished between resistance and susceptibility to millet blast disease. We designed specific primer pairs and provided kits for identification.

Benefits of technology

It enables rapid, accurate, and low-cost identification of blast disease genotypes, is suitable for high-throughput detection of large-scale samples, shortens the breeding cycle, and improves breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104988A_ABST
    Figure CN122104988A_ABST
Patent Text Reader

Abstract

The application provides application of a CAPS molecular marker GW18 in identification of foxtail millet (Setaria italica) resistance to rice blast, and belongs to the technical field of molecular marker breeding. The application provides the application of the CAPS molecular marker GW18 in identification of the foxtail millet resistance to the rice blast, and G / T polymorphism exists at 34523782 bp of the 6th chromosome of the foxtail millet; when the polymorphism is G, the resistance to the rice blast cannot be recognized by a restriction enzyme, and is identified as the susceptibility to the rice blast; when the polymorphism site is T, the GW18 target sequence can be recognized by the restriction enzyme and is cut into two segments, and is identified as the resistance to the rice blast. The marker has a high co-separation rate with the disease resistance, a rapid, accurate and low-cost detection method, and can be used for rapid identification of foxtail millet germplasm resources resistant to the rice blast and molecular marker assisted breeding, and has important significance for improving breeding efficiency and guaranteeing safe production of the foxtail millet.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular marker breeding technology, and in particular to the application of a CAPS molecular marker GW18 in identifying millet blast resistance. Background Technology

[0002] Millet ( Setaria italica Millet is an important C4 coarse grain and functional model crop originating in my country, characterized by its small genome, short growth period, and drought and barren soil resistance. Its grains (millet) are rich in nutrients, containing high-quality protein, dietary fiber, and various micronutrients, and have a low glycemic index. It is not only a traditional high-quality staple food but also plays an important role in maternal and child nutrition and dietary management of chronic diseases. However, millet is susceptible to various diseases during its growth, such as blast, rust, white spot disease, and sheath blight, which affect normal growth and development, leading to large-scale yield reduction or even complete crop failure. Among these, diseases caused by *Pyrophyllus oryzae* (a type of fungus) are particularly problematic. Magnaporthe oryzae Millet blast, caused by [unspecified fungal infection], is one of the most significant fungal diseases affecting the safe production of millet. This disease can occur throughout the entire growth cycle of millet, but it is particularly prone to outbreaks in the later stages of planting in hot and humid climates. Severe outbreaks of leaf blast and ear blast can lead to significant yield reductions or even crop failure. Currently, the control of millet blast still relies on chemical control, but due to the rapid mutation of the pathogen and the easy development of drug resistance, the effectiveness is difficult to sustain. Therefore, breeding and promoting disease-resistant varieties is the fundamental way to achieve green and sustainable control.

[0003] In recent years, using Bulked Segregant Analysis (BSA) to assist in the localization of resistance genes has become an important direction in breeding disease-resistant varieties. For example, the team led by Ji Zhiyuan at the Institute of Crop Science, Chinese Academy of Agricultural Sciences, used a population constructed from the resistant variety "Yugu 1" and the susceptible variety "Ci846" to initially locate resistance-related regions using BSA-seq, and further refined the major resistance locus to a 56.8 kb interval on chromosome 3. Nevertheless, there is still a lack of functional markers closely linked to resistance to rice blast that are suitable for efficient molecular detection, limiting the large-scale and precise application of resistance breeding.

[0004] Therefore, in view of the above situation and needs, developing a new functional marker will provide an important technical tool for high-throughput screening and molecular marker-assisted breeding of millet blast-resistant varieties, which is of great significance for improving the efficiency of millet disease resistance breeding. Summary of the Invention

[0005] The purpose of this invention is to provide an application of the CAPS molecular marker GW18 in identifying millet blast resistance, which can be used to rapidly, accurately, and cost-effectively identify the disease-resistant genotype of millet materials, providing an effective molecular tool for the breeding of blast-resistant varieties.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides an application of the CAPS molecular marker GW18 in identifying millet blast resistance. The GW18 exhibits a G / T polymorphism at 34523782 bp on millet chromosome 6. When the polymorphism is G, it cannot be recognized by restriction endonucleases and is identified as susceptibility to millet blast. When the polymorphism site is T, it can be recognized by restriction endonucleases and the GW18 target sequence is cut into two segments, thus identifying millet blast resistance.

[0007] Preferably, the restriction endonuclease is a restriction endonuclease. Xce I or restriction endonuclease Nsp I.

[0008] The present invention also provides a primer pair for amplifying the target sequence of the CAPS molecular marker GW18 in the application, wherein the upstream primer sequence is shown in SEQ ID NO.1 and the downstream primer sequence is shown in SEQ ID NO.2.

[0009] The present invention also provides a kit containing the primer pair described in claim 3, comprising the primer pair as described in claim 3, 2×Taq Master Mix and double-distilled water.

[0010] Preferably, the concentration of the primer pair is 8~10 μM and the volume ratio is 1~2:1~2.

[0011] The present invention also provides the application of the primer pair or the kit described herein in identifying millet blast resistance.

[0012] Preferably, the method for identifying millet blast resistance includes the following steps: 1) Extract genomic DNA from the millet material to be tested; 2) Using the genomic DNA described in step 1) as a template, perform PCR amplification using the primer pair described in claim 3; 3) Digest the PCR amplification product from step 2) with restriction endonucleases; 4) Electrophoresis is used to detect the enzyme digestion products in step 3), and the resistance of millet to blast disease is determined based on the size and number of bands.

[0013] Preferably, the method for judging millet blast resistance based on band size and number in step 4) is as follows: the presence of two bands, 510 bp and 173 bp, indicates blast resistance, while the presence of only one band, 683 bp, indicates blast susceptibility.

[0014] Beneficial effects

[0015] The CAPS molecular marker GW18 developed in this invention is tightly linked to the millet blast resistance gene, with accurate localization and high specificity, and can accurately distinguish between millet blast-resistant and susceptible genotypes, solving the problem of the lack of existing molecular markers for millet blast resistance. The identification method based on this marker is simple, rapid and efficient, with mild and easily controllable PCR amplification and enzyme digestion conditions, and intuitive detection results. It does not require complex and expensive detection equipment, is low in cost, and is suitable for high-throughput detection of large-scale samples. This molecular marker and identification method can be widely used in the screening of millet blast-resistant germplasm resources and molecular marker-assisted breeding. It can quickly screen individuals with disease-resistant genotypes in the early stages of breeding, reduce the workload of field disease resistance identification, shorten the breeding cycle, and significantly improve the scale and precision of millet blast resistance breeding. It provides strong support for the green and sustainable control of millet blast and has important economic value and application prospects. Attached Figure Description

[0016] Figure 1 The results of SNP-index analysis are shown for the highly susceptible and highly resistant mixed ponds of grain blast in Example 1. Figure 2 The image shows the PCR amplification product of the molecular marker GW18 and the electrophoresis results after enzyme digestion in the anti- and susceptible materials of blast fungus in Example 1. Detailed Implementation

[0017] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0018] Example 1

[0019] 1. Locating the regulatory sites for millet resistance to millet blast disease

[0020] Experimental materials: Male parent: Resource TK001 (a millet variety resistant to millet blast, preserved by Wang Genping's team at the Millet Breeding Research Office of the Millet Research Institute of Hebei Academy of Agricultural and Forestry Sciences). Female parent: Jigu 19 (a millet variety highly susceptible to millet blast, bred by Wang Genping's team at the Millet Breeding Research Office of the Millet Research Institute of Hebei Academy of Agricultural and Forestry Sciences). Genetic population: Using TK001 as the male parent and Jigu 19 as the female parent, the F1 generation was obtained through hybridization. The F1 generation was then self-crossed to the F5 generation to construct a population of 233 recombinant inbred lines (RILs) for the F5 generation.

[0021] Using 30 blast-resistant and 30 blast-susceptible plants from each of the two parental lines and the F5 generation as experimental materials, two mixed-culture ponds with high blast susceptibility and high blast resistance were constructed. SNP-index analysis (e.g., ...) was performed. Figure 1As shown in the figure, where A represents the SNP frequency distribution in the highly susceptible mixed pool of grain blast and B represents the SNP frequency distribution in the highly resistant mixed pool of grain blast, the grain blast resistance gene was initially located in the 4.44 M interval between 30661001 and 35100000 on chromosome 6, and the candidate interval is between Seita.6G181800 and Seita.6G241100.

[0022] Two SNP or InDel sites with significant differences in SNP-index or InDel-index were selected from the whole genome. Specifically, the SNP-index or InDel-index of F2 (extremely resistant to blast fungus) was ≥1.0, and the SNP-index or InDel-index of F1 (extremely susceptible to blast fungus) was ≤0.0. A total of 69 candidate SNP and InDel polymorphic marker sites were obtained (as shown in Figure 1).

[0023] Table 1. Candidate SNPs and InDel polymorphic marker sites

[0024] 2. Development of CAPS markers for millet resistance to millet blast

[0025] The resistance and susceptibility to leaf blast in 233 F5 recombinant inbred lines were statistically analyzed. Indel markers based on large chromosomal deletions were designed, with primers designed within 300 bp above and below the deletion site. PCR amplification was performed using DNA from Jigu 19 and Ziyuan TK001 as templates, followed by electrophoresis to observe changes in band size. Changes in the parental bands confirmed that the primers could separate the two parents. After fine mapping, the candidate region was located within 0.5 M of the GW11 (34315788) and GW12 (34816825) markers.

[0026] Further localization revealed that the CAPS marker GW18 was closely linked to the disease resistance trait. The GW18 PCR reaction conditions were as follows: using genomic DNA from Jigu 19 and Ziyuan TK001 as templates, amplification was performed using 2×Taq Master Mix from Nearshore Protein Technology Co., Ltd. The primer sequences were GW18-F (SEQ ID NO.1): AAACAGTGCAGGAGAGCCTT; GW18-R (SEQ ID NO.2): GCAGCTTGGCCAGATTTCCT. The PCR product size was 683 bp (as shown in SEQ ID NO.3 and SEQ ID NO.4). The PCR reaction system is shown in Table 1. The reaction conditions were: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 59℃ annealing for 30 s, 72℃ extension for 43 s, 35 cycles, followed by incubation at 72℃ for 5 min. The electrophoresis results of the PCR amplification products are shown below. Figure 2 As shown in Figure A. PCR products were processed using restriction endonucleases. Xce I ( Nsp I) The restriction enzyme was digested at 37℃ for 60 min. The restriction enzyme reaction system is shown in Table 2. The reaction conditions were 37℃ for 30 min. The results showed that the PCR product of resource TK001 could be digested with restriction endonucleases. Xce I ( Nsp I) The enzyme digestion products were 510bp and 173bp in size; the PCR product of Jigu 19 could not be cleaved by the restriction enzyme (e.g., ...). Figure 2 As shown in B).

[0027] Table 1 PCR reaction system

[0028] Table 2 PCR reaction system

[0029] The nucleotide sequence obtained by amplification using Jigu 19 as a template is shown in SEQ ID NO.3: AAACAGTGCAGGAGAGCCTTATAGCTCCGTGATGTTTCCCCAGCTTGAGGAGCTAAGAATCGATAATTGTAGTAAACTTGCACATCTTCCAGAGAGCGCAGCTCTCACACACCTATCCTTTTCATTCGTCAAAAGAGCACGATTATGTCGTTGCATTGATTCTGCAGAAGGCCTTGTTCCTATGAGCATATCTTTGGGCTCTTGCCCGTCCCTTGTCTCGTTGGAAGTTGGGATGCTGGCAGATGTGGTGATGCTTTTCGATGACCAGCAGAGTCAAAGCCAAAGATCTGTGGATACCCTGCGAAATTTAAAGCTATCGGGTGATGATGCCTTTGTATCGATTTTTAACATTTCCAAATTGCAACTTGGACTTGGGGATTGCTTTGCCTTCTTGGAGGAATTAGATATCTCAGGTTGCGACAGCATCCTCCGCTGGCCAGTGGAGGAGCTGCGTTGCTTGCCTCTGCTTCGATCTTTGAGTATTTGCCTTAAGAATTTGGAGGGCACAGGCTCATCATATGAGGAGATCCTTCCTCTGCCTCGTCTGGAAAAGTTATACATATATTTTTGTCACAGCTTGCTGGAGATTCCAAAGTTGCCTGCATCACTTGTCGAAGTGGAGATTTGCTGGTGCAAAAGTTTGATAGCACTGCCTTCAAACCTAGGAAATCTGGCCAAGCTGC; The nucleotide sequence amplified with resource TK001 as a template is shown in SEQ ID NO.4: .

[0030] 3. Validation of CAPS molecular markers in RIL populations

[0031] Disease resistance was assessed in 233 lines of the “Jigu 19 × Ziyuan TK001” F5 population (according to Hebei Provincial Standard DB13 / T 2338.2—2016). 78 progeny lines showed high susceptibility to leaf blast symptoms, while 155 progeny lines showed high resistance. The CAPS marker GW18 was used to validate the 233 (RIL) recombinant inbred lines. The results showed that susceptible progeny lines exhibited the Jigu 19 genotype, while resistant progeny lines exhibited the Ziyuan TK001 genotype. The results are shown in Table 2 (where 1 represents the Ziyuan TK001 genotype and 2 represents the Jigu 19 genotype), indicating that this marker can be applied to field marker-assisted breeding.

[0032] Table 2 Results of Disease Resistance Identification

[0033] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of a CAPS molecular marker GW18 in identifying millet blast resistance, characterized in that, The GW18 gene contains a G / T polymorphism at 34523782 bp on chromosome 6 of millet. When the polymorphism is G, it cannot be recognized by restriction endonucleases and is identified as susceptibility to millet blast. When the polymorphism site is T, it can be recognized by restriction endonucleases and the GW18 target sequence is cut into two segments, which is identified as resistance to millet blast.

2. The application as described in claim 1, characterized in that, The restriction endonuclease is a restriction endonuclease. Xce I or restriction endonuclease Nsp I.

3. A primer pair for amplifying the target sequence of the CAPS molecular marker GW18 in any one of claims 1-2, characterized in that, The upstream primer sequence is shown in SEQ ID NO.1, and the downstream primer sequence is shown in SEQ ID NO.

2.

4. A kit containing the primer pair of claim 3, characterized in that, It contains the primer pair as described in claim 3, 2×Taq Master Mix and double-distilled water.

5. The kit according to claim 4, characterized in that, The primer pair has a concentration of 8-10 μM and a volume ratio of 1-2:1-2.

6. The use of the primer pair of claim 3 or the kit of claim 4 or 5 in the identification of millet blast resistance.

7. The application as described in claim 6, characterized in that, The method for identifying millet blast resistance includes the following steps: 1) Extract genomic DNA from the millet material to be tested; 2) Using the genomic DNA described in step 1) as a template, perform PCR amplification using the primer pair described in claim 3; 3) Digest the PCR amplification product from step 2) with restriction endonucleases; 4) Electrophoresis is used to detect the enzyme digestion products in step 3), and the resistance of millet to blast disease is determined based on the size and number of bands.

8. The application as described in claim 7, characterized in that, The method for determining millet blast resistance based on band size and number described in step 4) is as follows: the presence of two bands, 510 bp and 173 bp, indicates blast resistance, while the presence of only one band, 683 bp, indicates blast susceptibility.