A method for improving the sensitivity of rpa-crisspr-cas12a detection and its application in one tube detection of chikungunya virus
By structurally modifying the full-length crRNA to form a truncated crRNA, the problems of premature activation and non-specific interaction in RPA-CRISPR-Cas12a detection are solved, achieving highly sensitive detection of low viral nucleic acid loads, which is suitable for rapid on-site detection of pathogens.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- THE SEVENTH AFFILIATED HOSPITAL SUN YAT SEN UNIV SHENZHEN
- Filing Date
- 2026-03-09
- Publication Date
- 2026-05-29
AI Technical Summary
The existing RPA-CRISPR-Cas12a detection technology suffers from premature activation and non-specific interactions of full-length crRNA in nucleic acid detection, leading to reduced detection sensitivity and failing to meet the needs of rapid on-site detection of pathogens.
By structurally modifying the full-length crRNA and truncating its repetitive sequence regions to form truncated crRNA, the activity of Cas protein can be precisely regulated to avoid premature activation during the RPA amplification stage. Cas12a can be activated when the target nucleic acid sequence is present, thereby achieving specific recognition and signal release.
It improves the sensitivity and specificity of detection, can accurately detect viruses in low-load viral nucleic acid samples, is suitable for on-site real-time detection, and is applicable to the rapid detection of pathogenic microorganisms such as viruses and bacteria.
Smart Images

Figure CN122105008A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to a method for improving the detection sensitivity of RPA-CRISPR-Cas12a and its application in the one-tube method for detecting chikungunya virus. Background Technology
[0002] Traditional chikungunya virus detection primarily employs reverse transcription-polymerase chain reaction (RT-PCR). Its core principle involves collecting serum or plasma samples from patients and extracting RNA. The viral RNA is then reverse transcribed into complementary DNA (cDNA). PCR technology is then used to specifically amplify conserved gene fragments of the chikungunya virus (such as the E1, E2, or NS1 genes). Finally, the amplification products are monitored in real-time using fluorescence signals to determine the presence of viral RNA. RT-PCR boasts high sensitivity and specificity, capable of detecting low viral loads and detecting viral RNA as early as 1-3 days after symptom onset, aiding in early diagnosis and isolation. However, RT-PCR requires specialized equipment, has expensive reagents and consumables, and is time-consuming. Furthermore, it demands a demanding operating environment and is susceptible to contamination, failing to meet the needs for rapid on-site pathogen detection.
[0003] CRISPR-Cas 12a detection technology offers significant advantages in nucleic acid detection, including high specificity, high sensitivity, low cost, wide applicability, and portability. It is particularly suitable for pathogen detection, gene editing, and biosensor development. By combining it with isothermal amplification (RPA), rapid and sensitive detection of extremely low concentrations of nucleic acids can be achieved under isothermal conditions. Results can be read via test strips or a fluorometer, enabling rapid on-site detection. RPA-CRISPR-Cas 12a detection often uses full-length crRNA to guide Cas12a. Full-length crRNA has a strong binding affinity to Cas12a, which can prematurely activate Cas12a's cleavage activity during the RPA amplification stage (isothermal environment of 37-42℃), leading to target sequence cleavage and affecting RPA amplification. Furthermore, the repetitive sequence regions of full-length crRNA readily interact non-specifically with recombinases and single-stranded binding proteins (SSBs) in the RPA system, interfering with RPA amplification efficiency and reducing detection sensitivity. Summary of the Invention
[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide a method for improving the detection sensitivity of RPA-CRISPR-Cas12a and its application in the one-tube method for detecting chikungunya virus.
[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows: a method for improving the detection sensitivity of RPA-CRISPR-Cas12a, wherein the method modifies the structure of full-length crRNA by truncating the repetitive sequence region of the full-length crRNA.
[0006] Through extensive experimentation, the inventors of this application discovered that structural modification of full-length crRNA to form truncated crRNA (Truncate crRNA) allows for precise shortening of non-critical regions, enabling spatiotemporal control of Cas protein activity. This plays a crucial role in CRISPR molecular detection (such as the RPA-CRISPR-Cas12a system). When the target nucleic acid sequence is absent, Cas12a is difficult to activate; in the RPA-CRISPR one-tube method, premature activation during the RPA amplification stage can be avoided. When the target nucleic acid sequence is present, the spacer region pairs complementaryly with it, activating Cas12a and releasing the detection signal. This specific recognition ensures detection even with low viral nucleic acid loads, making it suitable for point-of-care testing (POCT) and widely applicable for the rapid detection of pathogenic microorganisms such as viruses and bacteria.
[0007] In a preferred embodiment of the method described in this invention, the truncation of the repetitive sequence region of the full-length crRNA involves shortening the repetitive sequence to 6-10 nt from the 5' end of the repetitive sequence.
[0008] The method of this invention preserves the specific spacer sequence of crRNA and shortens the crRNA region to form different types of truncated crRNAs. The naming and structure of truncated crRNAs follows the format "Spacer region + length of the 5' retained repeat sequence region," with the core difference being the length gradient design of the 5' auxiliary sequence. Alternatively, the naming rule for truncated crRNAs is "+n Spacer" (where n represents the length of the 5' retained repeat sequence region), with the core difference being the gradient design of the 5' auxiliary sequence.
[0009] In a preferred embodiment of the method described in this invention, the truncation of the repetitive sequence region of the full-length crRNA involves shortening the repetitive sequence to 6 nt from the 5' end of the repetitive sequence.
[0010] Through extensive experiments, the inventors of this application discovered that the +6 Spacer truncated crRNA exhibits the best detection performance.
[0011] This invention also provides the application of the method in detecting pathogenic microorganisms for non-disease diagnostic purposes, or in the preparation of products for detecting pathogenic microorganisms. The present invention also provides the application of the method in the preparation of products for detecting chikungunya virus.
[0012] The present invention also provides a kit for detecting chikungunya virus, the kit comprising crRNA with sequences as shown in any one of SEQ ID NO. 2-6.
[0013] As a preferred embodiment of the kit described in this invention, the kit includes crRNA with the sequence shown in SEQ ID NO.2.
[0014] This invention also provides a one-tube method for detecting chikungunya virus for non-disease diagnostic purposes, comprising the following steps: S1. Design a full-length crRNA based on the chikungunya virus; S2. The repeat sequence of the full-length crRNA is shortened to 6-10 nt from the 5' end to obtain the truncated crRNA; S3. Add the truncated crRNA, RPA primers, and the sample to be tested into the CRISPR-Cas12a system for fluorescence detection.
[0015] As a preferred embodiment of the method described in this invention, the sequence of the full-length crRNA is shown in SEQ ID NO.1.
[0016] As a preferred embodiment of the method described in this invention, the sequence of the truncated crRNA is shown in any one of SEQ ID NO.2-6.
[0017] Preferably, the sequence of the RPA primer is shown in SEQ ID NO.7-8.
[0018] This invention utilizes +6Spacer truncated crRNA as its core to construct an optimized RPA-CRISPR-Cas12a one-tube detection system. This system integrates reverse transcription (targeting RNA), RPA amplification, and CRISPR detection functions into a single reaction tube, eliminating the need for step-by-step operations and completing detection within 25-30 minutes at a constant temperature of 37-42℃. This system completely solves the problems of "pre-activation" and "non-specific interference" with full-length crRNA, and achieves highly sensitive detection of low-load chikungunya virus nucleic acid, making it suitable for various POCT scenarios such as primary healthcare, port quarantine, and field epidemiological investigations.
[0019] The beneficial effects of the present invention: The present invention provides a method for improving the detection sensitivity of RPA-CRISPR-Cas12a, which has the following advantages: (1) Significantly improved specificity and effective avoidance of cross-reaction: The present invention truncates the crRNA and retains the spacer sequence that is highly specific to the target, which improves the sensitivity of single base mismatch, reduces the cross-reaction rate, and avoids false positive misdiagnosis; (2) Inhibition of non-specific premature activation and significant reduction of background signal: The truncated crRNA reduces the binding stability with low abundance non-specific nucleic acids. Only when RPA fully amplifies the high abundance of CHIKV specific target (the concentration reaches the activation threshold) can a stable RPA be formed. - The loop structure activates Cas12a, which can significantly inhibit non-specific activation in the early stage of amplification, reduce the background signal in the early stage of amplification, and avoid misjudgment of results for low viral load samples (such as early infection); (3) Adapt to the "one tube method" operation: Shortening crRNA can optimize the incompatibility problem between RPA and CRISPR. The advantage is that it does not require modification of crRNA or use complex methods such as light control to reduce Cas12a activity. RPA amplification and Cas12a can be completed in the same reaction tube to complete the "amplification-detection" process, avoiding cross-contamination caused by opening the cap and transferring. It only requires a simple constant temperature device to operate, which meets the needs of rapid on-site detection of pathogens. Attached Figure Description
[0020] Figure 1 This is a schematic diagram of full-length crRNA and truncated crRNA.
[0021] Figure 2 Structural features of the full-length crRNA and the +1 to +10 spacer truncated crRNA of Chikungunya virus.
[0022] Figure 3 Structural features of the truncated crRNA of the +11 to +19 spacers of Chikungunya virus.
[0023] Figure 4 Heatmaps showing the detection performance of full-length crRNA and different truncated crRNAs.
[0024] Figure 5 The fluorescence response kinetics and reaction rate-substrate concentration characteristic curves of +6 Spacer and full-length crRNA at different target concentrations are shown.
[0025] Figure 6 This is a flowchart of the one-tube method for detecting chikungunya virus RNA. Detailed Implementation
[0026] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention.
[0027] The full-length crRNA commonly used in RPA-CRISPR-Cas12a detection contains a 20-22 nt repeat region + a 20-24 nt spacer region, with a total length of 42-46 nt. This invention provides a method to improve the sensitivity of RPA-CRISPR-Cas12a detection, such as... Figure 1 As shown, the method preserves the chikungunya virus-specific spacer sequence and shortens the crRNA region to form different types of truncated crRNAs. The naming rule for truncated crRNAs is "+n Spacer" (where n represents the length of the repetitive sequence region retained at the 5' end). The core difference lies in the gradient design of the 5' auxiliary sequences, such as... Figures 2-3 (The blue-marked Spacer region in the diagram is the core functional domain for complementary binding between crRNA and target DNA; its sequence specificity directly determines the accuracy of target identification. The pink-marked sequence corresponds to the 5' auxiliary domain of crRNA, which participates in regulating the assembly efficiency of crRNA and Cas12a protein. The 5' end of the full-length crRNA contains an auxiliary region composed of a stem-loop structure (sequence AAUUUCUACUAAGUGUAGAU). The structural difference between the +6 to +10 Spacer truncated crRNAs is the progressive truncation of the 5' auxiliary domain: the +6 Spacer retains only the Spacer region and a 6-nucleotide auxiliary sequence at the 5' end, while the +7, +8, +9, and +10 Spacers successively add one nucleotide at the 5' end.) As shown, the +6 Spacer truncated crRNA consists of a chikungunya virus-specific Spacer sequence and a 6-nt auxiliary sequence at the 5' end; +7~+10 Spacer-truncation crRNA adds one nucleotide sequentially along the 5' end, corresponding to a 5' auxiliary sequence length of 7-10 nt. By varying the length of the auxiliary sequence, precise regulation of the binding affinity between crRNA and Cas12a is achieved.
[0028] The sequences and primers of the truncated crRNA involved in the embodiments of the present invention are shown in Table 1.
[0029] Table 1 Example 1 This embodiment systematically evaluates the detection performance of full-length crRNA and different truncated crRNAs. Specific experimental procedures are as follows: To systematically evaluate the detection performance of different types of truncated crRNAs, target concentration gradients (0 aM to 10 aM) were set up. 5 Reaction systems were constructed with truncated crRNAs and full-length crRNAs in the range of +1 to +19 spacers. Three replicates were set up for each "crRNA type-target concentration" combination, along with a negative control (0 aM target + corresponding crRNA) and a blank control (no target + no crRNA) to eliminate background interference. Detection performance was determined based on the "background signal": the mean endpoint fluorescence intensity of the "0 aM target + corresponding crRNA" group was used as the background signal for that crRNA. A positive detection criterion was set as "endpoint fluorescence intensity ≥ 2 times the background signal, and all three replicates meeting this condition." The positive response range of each crRNA was verified starting from the lowest target concentration. The specific reaction system consisted of: 1×Cas12a reaction buffer (10 mM Tris-HCl (pH 8.5), 40 mM glycine, 10 mM MgCl2, 1 mM DTT, 20 mM KCl, and 0.01% Tween 20), 100 nM LbCas12a, 100 nM truncated crRNA, 500 nM 8CFQ, and 20 nM target sequence, with water added to a final volume of 20 μL. After thorough mixing, the reaction was carried out at 37°C for 60 min. A Celeriter 96 PCR instrument from Yisheng Biotechnology was used for the isothermal reaction and real-time acquisition of FAM fluorescence signals, with data collected every 30 seconds.
[0030] The results are as follows Figure 4 As shown, the results are visualized using a heatmap (vertical axis represents target input concentration (aM), horizontal axis represents truncated crRNA spacer length (+1 to +19 nt) and full-length crRNA). Color intensity represents fluorescence response signal intensity (ΔF, au), and color scales indicate fluorescence intensity; the red dashed box marks the optimal response range; "*" indicates a difference between the detected signal and the background signal. The detection limit (LOD) for full-length crRNA is relatively high, only reaching its limit when the target concentration reaches 10-1. 5 Only at aM did a response signal effectively distinguishable from the background be observed. The truncated crRNA (marked by the red dashed box) exhibited the best fluorescence signal response at +6 to +10 concentrations, with different target concentrations (10... 0 aM to 10 5 Both aM and αM can trigger high-intensity fluorescence signals, and the signal intensity shows a clear concentration dependence with the target concentration gradient. Among them, the +6 spacer is the optimal length, which maintains high fluorescence signal values across the entire concentration gradient, and even at concentrations as low as 10. 0The target of aM can still be stably detected, showing a highly significant difference from the background signal, demonstrating the best detection sensitivity and signal stability. When the truncated length is in the range of +1 to +5 nt, the fluorescence signal of the detection system drops sharply, even at the highest target concentration (10 nt). 5 Under the influence of aM, only a weak fluorescence signal was observed, indicating that crRNAs within this truncated length range cannot form a functional detection complex. When the truncated length is in the range of +11 to +19 nt, the fluorescence signal decreases gradually with increasing length: the +11 to +13 range still retains some detection capability for medium to high concentration targets (≥10³ aM), but the signal intensity is significantly lower than that in the +6 to +10 nt range; while for crRNAs of +14 and above, the detection signal is further weakened, only detecting extremely high concentration targets (≥10³ aM). 5 (aM) showed a weak response.
[0031] The above results confirm that the performance of the CRISPR detection system is subject to a relatively strict range of limitations on the spacer length. +6 is the optimal truncation length of the spacer, and "+6 to +10" is the core length range for maintaining high sensitivity and strong signal response of the detection system. If the truncation length is less than 6 or greater than 10, the detection performance will be significantly reduced due to decreased complex assembly efficiency or impaired target recognition ability.
[0032] Example 2 To further analyze the performance advantages of the +6 Spacer truncated crRNA described in Example 1, this embodiment conducted a comparative experiment on its reaction kinetics with full-length crRNA. The specific experimental method is as follows: The substrate 8CFQ (specific sequence: / 5'6-FAM / -CCCCCCCC- / 3'BHQ1) was serially diluted twofold, and a 1:1 complex was formed with LbCas12a and crRNA. The dsDNA target (250 nM) and 1× buffer were incubated at 37°C for 1 hour. The final fluorescence intensity was detected, and a standard curve was established to determine the relationship between fluorescence intensity and the concentrations of cleaved and uncleaved FQ. A series of dilutions of 8CFQ (0, 15.6, 31.2, 62.5, 125, 250, and 500 nM), along with crRNA (250 nM) and 250 nM dsDNA activator, were added to the reaction system. Continuous fluorescence detection was performed for 300 seconds at 37°C using a YEASEN Celermetor 96 real-time quantitative PCR instrument. The reaction rate was calculated using linear fitting, and a kinetic curve was plotted with 8CFQ concentration on the x-axis and reaction rate on the y-axis.
[0033] The results are as follows Figure 5As shown, the fluorescence intensity of both crRNAs showed a significant increasing trend with increasing substrate concentration. Under the same substrate concentration, the peak fluorescence intensity of the full-length crRNA was higher than that of the +6 Spacer crRNA, indicating that it had a stronger signal amplification ability in this reaction system. The right figure shows the reaction rate (nM / s) as a function of substrate concentration, and the curve represents the result of reaction kinetic fitting. It can be seen that the reaction rates of both +6 Spacer and full-length crRNA increased with increasing substrate concentration and gradually approached saturation. In comparison, at the same substrate concentration, the reaction rate of full-length crRNA was higher than that of +6 Spacer. Although full-length crRNA has advantages in fluorescence intensity and reaction rate, as shown in the left figure, the fluorescence signal of the +6 Spacer truncated crRNA at lower concentrations (e.g., 16.5 nM, 31.3 nM) showed a clearer distinction from the higher concentration group. In contrast, the signal curves of full-length crRNA had a higher degree of overlap and weaker distinguishing ability within the same low concentration range. This indicates that the +6 Spacer truncated crRNA can more effectively generate specific signals that are distinguishable from background and other concentration groups under low-abundance target conditions, achieving stable detection. As shown in the right figure, in the low-concentration range (0~100 nM), the reaction rate curve corresponding to the +6 Spacer truncated crRNA exhibits a steeper upward slope, indicating its more sensitive response to low-abundance targets. In actual detection, the effective substrate concentration formed in low-abundance target samples is usually within this range. The +6 Spacer can more efficiently initiate and accelerate the reaction within this range, rapidly accumulating fluorescence signals, thus avoiding missed detections of low-abundance targets due to signal lag or insufficient intensity. As shown above, the reaction rate growth slope of the +6 Spacer truncated crRNA in the low-concentration range (≤125 nM) is significantly higher than that of the full-length crRNA, indicating its superior activation efficiency for Cas12a under low target load conditions; while the maximum reaction rate of the full-length crRNA is slightly higher, its response sensitivity is insufficient at low crRNA concentrations. This kinetic difference further validates the unique advantages of +6 Spacer truncated crRNA in low-load detection scenarios.
[0034] Example 3 This embodiment applies +6 spacer truncated crRNA to a one-tube method for detecting chikungunya virus. The experimental procedure is as follows: Figure 6 As shown, it includes the following steps: 1.1 Sample processing and RNA extraction: After preprocessing, the target RNA is extracted from the sample containing the target pathogen.
[0035] 2. One-pot assay: The extracted RNA was added to an integrated reaction system (20 µL) comprising 1× Cas12a reaction buffer, 9 µL RPA buffer, 1 µL MgCl2, 100 nM LbCas12a, 1 µM +6 Spacer truncated crRNA, 500 nM 8CFQ, 200 nM RPA primer F, 200 nM RPA primer R, and 2 µL target sequence. The reaction was carried out at 37 °C for 60 min. A Celeriter 96 PCR instrument from Yisheng Biotechnology was used for the isothermal reaction and real-time acquisition of FAM fluorescence signals, with data collected every 30 seconds. After adding the extracted RNA, the reverse transcriptase first reverse transcribed it into cDNA. The RPA module isothermally amplified the cDNA to generate the target sequence. The truncated crRNA specifically binds to the target sequence, thereby guiding the Cas12a protein to recognize the target and activate its trans-cleavage activity.
[0036] 3. Signal Output: Cas12a's trans-cleavage activity can shear the fluorescent reporter probe, corresponding to the fluorescence signal growth curve in the upper right corner as a function of cycle number (achieving quantitative detection). Simultaneously, visual qualitative detection can be achieved via a lateral flow chromatography strip (lower right corner), with "+" representing a positive result (upper band) and "-" representing a negative result (lower band). This process integrates amplification and detection steps in a "one-step" manner, combining ease of operation with detection flexibility. It simultaneously supports both quantitative fluorescence and strip visualization detection modes, adapting to different detection needs in various scenarios.
[0037] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.
Claims
1. A method for improving the detection sensitivity of RPA-CRISPR-Cas12a, characterized in that, The method describes a structural modification of full-length crRNA by truncating the repetitive sequence regions of the full-length crRNA.
2. The method according to claim 1, characterized in that, The process of truncating the repetitive sequence region of the full-length crRNA involves shortening the repetitive sequence to 6-10 nt from the 5' end of the repetitive sequence.
3. The method according to claim 1, characterized in that, The process of truncating the repetitive sequence region of the full-length crRNA involves shortening the repetitive sequence to 6 nt from the 5' end of the repetitive sequence.
4. The method of any one of claims 1-3 is used in the detection of pathogenic microorganisms at a non-disease diagnostic destination, or in the preparation of products for the detection of pathogenic microorganisms.
5. The use of the method according to any one of claims 1-3 in the preparation of a product for detecting chikungunya virus.
6. A kit for detecting chikungunya virus, characterized in that, The kit contains crRNA with sequences as shown in any one of SEQ ID NO. 2-6.
7. The reagent kit according to claim 6, characterized in that, The kit contains crRNA with the sequence shown in SEQ ID NO.
2.
8. A one-tube method for detecting chikungunya virus for non-disease diagnostic purposes, characterized in that, Includes the following steps: S1. Design a full-length crRNA based on the chikungunya virus; S2. The repeat sequence of the full-length crRNA is shortened to 6-10 nt from the 5' end to obtain the truncated crRNA; S3. Add the truncated crRNA, RPA primers, and the sample to be tested into the CRISPR-Cas12a system for fluorescence detection.
9. The method according to claim 8, characterized in that, The sequence of the full-length crRNA is shown in SEQ ID NO.
1.
10. The method according to claim 8, characterized in that, The sequence of the truncated crRNA is shown in any one of SEQ ID NO.2-6.