A traditional Chinese medicine composition containing cordyceps and application thereof in treating tumors

Abstract

This invention discloses a traditional Chinese medicine composition containing Cordyceps militaris and its application in the treatment of tumors, relating to the field of traditional Chinese medicine technology. The composition comprises active ingredients and excipients. The active ingredients, by weight, include the following components: fermented mycelium powder, total flavonoid extract from Actinidia chinensis root, total saponin extract from Astragalus membranaceus, polysaccharide extract from Phellinus linteus, and tannin extract from Phyllanthus emblica. This method uses highly active Cordyceps militaris strains as the core raw material, combined with a multi-component synergistic formulation system, to systematically target and regulate the drug-forming defects along the entire metabolic chain in vivo. It achieves a synergistic effect throughout the entire process, from extracellular degradation protection and cell membrane entry promotion to intracellular activation enhancement and long-term maintenance of activity. This solves the core problems of low bioavailability and insufficient effective concentration at tumor sites, reducing the limitations of existing compositions that only achieve simple additive drug effects, and significantly improving the antitumor activity and stability of the composition.

Description

Technical Field

[0001] This invention relates to the field of traditional Chinese medicine technology, specifically to a traditional Chinese medicine composition containing Cordyceps militaris and its application in the treatment of tumors. Background Technology

[0002] Cordyceps sinensis, commonly known as Chinese Cordyceps, is an ascomycete belonging to the genus Cordyceps in the family Clavicipitaceae. It is an obligate parasite on the larvae of insects of the family Hepialidae (such as the Hepialus mollusc) in the high-altitude areas of the Qinghai-Tibet Plateau, forming an insect-fungus complex, which is the traditional Chinese medicine "Cordyceps sinensis". This fungus is mainly distributed in alpine meadows above 3,000 meters in Qinghai and Tibet, China. Its characteristics are that the mycelium erodes the larval organs and forms a sclerotium. In the late spring of the following year, the stroma breaks through the insect body to form a complex structure. This complex is the traditional Chinese medicine Cordyceps sinensis, which contains active ingredients such as cordycepic acid and cordyceps polysaccharides and has the effects of tonifying the lungs and kidneys.

[0003] Existing Cordyceps-related antitumor compositions use conventional commercial Cordyceps strains, resulting in low content of core active ingredients and poor fermentation stability. Furthermore, they lack precise formulation design to address the full-chain defects in drug development, such as difficulty in cell membrane entry, insufficient intracellular activation, and rapid inactivation of intracellular active products. They also fail to effectively eliminate tumor stem cells, lack tumor-targeted delivery capabilities, and lack a quality control system that binds to in vivo efficacy. Therefore, existing compositions suffer from weak antitumor efficacy, low bioavailability, and inability to address clinical pain points such as tumor recurrence, metastasis, and multidrug resistance. Moreover, they exhibit large batch-to-batch efficacy fluctuations and high difficulty in clinical translation, making it difficult to meet the actual needs of clinical tumor treatment for high efficiency, low toxicity, multi-target, and long-term tumor control. Summary of the Invention

[0004] In view of the shortcomings of the prior art, the present invention provides a traditional Chinese medicine composition containing Cordyceps militaris and its application in the treatment of tumors, thus solving the problems mentioned in the background art.

[0005] To achieve the above objectives, the present invention provides the following technical solution: a traditional Chinese medicine composition containing Cordyceps militaris, characterized in that: the composition comprises active ingredients and excipients, wherein the active ingredients, by weight, include the following components: 30-50 parts of fermented mycelium dry powder, 15-25 parts of total flavonoid extract from Actinidia chinensis root, 10-20 parts of total saponin extract from Astragalus membranaceus, 8-18 parts of polysaccharide extract from Phellinus linteus, and 3-8 parts of tannin extract from Phyllanthus emblica.

[0006] Preferably, the fermented mycelium dry powder is Cordyceps sinensis Cs-2025, and the strain preservation number of Cordyceps sinensis Cs-2025 is CGMCC NO.41879.

[0007] Preferably, the fermented mycelium powder contains ≥0.35% adenosine and ≥15.0% cordyceps polysaccharides. The total flavonoid content (calculated as rutin) in the total flavonoid extract of *Actinidia chinensis* root is ≥50.0%; The total saponin content (calculated as astragaloside A) in the Astragalus membranaceus total saponin extract is ≥45.0%; The polysaccharide content (calculated as glucose) in the extract of Phellinus linteus is ≥60.0%; The total tannin content (calculated as gallic acid) in the tannin extract of Phyllanthus emblica is ≥65.0%.

[0008] Preferably, the excipients include one or more of the following: fillers, disintegrants, lubricants, binders, suspending agents and flavoring agents, and the excipients account for 10% to 30% of the total mass of the traditional Chinese medicine composition.

[0009] Preferably, the dosage form of the traditional Chinese medicine composition is an oral preparation, which includes one of the following: capsules, tablets, granules, powders or oral liquids.

[0010] Preferably, the preparation method of the traditional Chinese medicine composition includes the following steps: S1. After pretreatment, the root of Actinidia chinensis, Astragalus membranaceus, and Phyllanthus emblica were used to prepare total flavonoid extract of Actinidia chinensis, total saponin extract of Astragalus membranaceus, and tannin extract of Phyllanthus emblica. After pretreatment, Phyllanthus emblica fruiting body was used to prepare Phyllanthus emblica polysaccharide extract. S2. Mix the total flavonoid extract of Actinidia chinensis root, the total saponin extract of Astragalus membranaceus, the polysaccharide extract of Phellinus linteus and the tannin extract of Phyllanthus emblica to obtain an extraction mixture. Add an aqueous ethanol solution to the extraction mixture, and after ultrasonic and reflux synergistic extraction, filter, concentrate under reduced pressure and freeze dry under vacuum to obtain a composite active extract. S3. The composite active extract is prepared into an aqueous solution, and the targeted composite wall material is added and homogenized by high-speed emulsification. After homogenization, the targeted embedded microspheres are prepared by ion gelation. The targeted embedded microspheres are washed and vacuum freeze-dried to obtain the embedded composite active powder. S4. Mix the fermented mycelium dry powder with the encapsulated composite active powder, add excipients and mix evenly to prepare the corresponding traditional Chinese medicine composition pharmaceutical preparation.

[0011] Preferably, the targeted composite wall material is prepared by compounding carboxymethyl chitosan, sodium alginate, hyaluronic acid and galactoylated sodium alginate in a mass ratio of 1:3:0.8:0.2; The mass ratio of the targeted composite wall material to the composite active extract is 3:1. The curing solution used in the ion gelation method is a 1.5% calcium chloride aqueous solution, and the curing time is 30 min.

[0012] Preferably, the volume fraction of the ethanol-water solution is 70%, and the material-to-liquid ratio is 1:15; The parameters for combined ultrasonic and reflux extraction are as follows: first, ultrasonic extraction at 300W for 20-30 minutes, followed by reflux extraction for 1.5 hours to complete the extraction.

[0013] Application of traditional Chinese medicine compositions containing Cordyceps militaris in the preparation of antitumor drugs.

[0014] Preferably, the traditional Chinese medicine composition is used for the treatment of one or more of non-small cell lung cancer, colorectal cancer, liver cancer, breast cancer, and pancreatic cancer.

[0015] This invention provides a traditional Chinese medicine composition containing Cordyceps militaris and its application in the treatment of tumors. It possesses the following beneficial effects: (1) Using highly active Cordyceps strains as the core raw material, combined with a multi-component synergistic formulation system, it systematically targets and regulates the drug-forming defects of the entire metabolic chain in vivo, achieving a synergistic effect throughout the entire process from extracellular degradation protection, cell membrane entry promotion to intracellular activation enhancement, and long-term maintenance of activity. This solves the core problems of low bioavailability and insufficient effective concentration at the tumor site, reduces the limitation of existing compositions that can only achieve simple superposition of drug effects, and greatly improves the anti-tumor activity and stability of the composition.

[0016] (2) This composition can precisely regulate the key signaling pathways for maintaining the stemness of tumor stem cells, break the natural drug resistance barrier and immune escape characteristics of tumor stem cells, and effectively eliminate quiescent tumor stem cells, inhibit their self-renewal and tumorigenic ability. It fills the gap that existing Chinese medicine compositions cannot intervene in tumor stem cells, blocks the core driving factors of multidrug resistance, postoperative recurrence and distant metastasis of tumors, prevents the problem of poor long-term treatment effect of existing compositions, and significantly improves the radicality and long-term effectiveness of tumor treatment.

[0017] (3) By adopting a tumor-targeted delivery method that is highly compatible with the active ingredients, the active ingredients are accurately enriched in tumor tissues and the non-specific distribution in normal tissues is reduced. At the same time, the consistency of efficacy between batches of the composition is strictly controlled, which reduces the problems of poor targeting, high potential toxic side effects and large fluctuations in efficacy between batches of existing compositions. It can also reshape the tumor immunosuppressive microenvironment, improve the clinical treatment response rate, and greatly expand the clinical application scenarios. It has stable clinical translation and large-scale application value. Attached Figure Description

[0018] Figure 1 This is a flowchart illustrating the steps of preparing the traditional Chinese medicine composition containing Cordyceps militaris according to the present invention. Detailed Implementation

[0019] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0020] Please see Figure 1 This invention provides a traditional Chinese medicine composition containing Cordyceps militaris and its application in the treatment of tumors. To achieve the above objectives, this invention is implemented through the following technical solution: The traditional Chinese medicine composition consists of active ingredients and excipients. The active ingredients, by weight, include the following components: 30-50 parts of fermented mycelium dry powder, 15-25 parts of total flavonoid extract from Actinidia chinensis root, 10-20 parts of total saponin extract from Astragalus membranaceus, 8-18 parts of polysaccharide extract from Phellinus linteus, and 3-8 parts of tannin extract from Phyllanthus emblica.

[0021] The fermented mycelium powder is specifically Cordyceps sinensis Cs-2025, whose strain preservation number is CGMCC NO.41879.

[0022] The nucleotide sequence of Cordyceps militaris Cs-2025 is shown in SEQ ID NO. 1: ATGCTTAAGTTCAGCGGGTATTCCTACCTGATCCGAGGTCAACCTTGAGAAGTAGGGGGTTTTACGGCGTGGCCGCTCCGCTATCCGGCTGCGAGGTATCACTACTACGCAGGGGAGGTCGCGAAGAGACCGCCACTGTATTTCAG GGCCGGCAGCCGCCAGGGGCAGCCGATCCCCAACGCCAGGTCCCGCGGACGGGCCCTGAGGGTTGAAATGACGCTCGGACAGGCATGCCCGCCAGAGTACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTC TGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGCTGAAAGTTTTAATTTATTTTGTATAAGACTCAGAAGATCCACTATAAAAACAAGAGTTTGGGGTCCTCGGCGGGCGTC TGGTTCCGGGGCTGGCCGTGCACTGCCAGCTCCGGGACGGACCCGCCGAAGCAACGATAGGTATGTTCACAAAGGTATGGAGTTAGAAACTCGGTAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTACGACTTTTACTT The fermented mycelium powder contains ≥0.35% adenosine and ≥15.0% cordyceps polysaccharides. The total flavonoid content (calculated as rutin) in the total flavonoid extract of *Actinidia chinensis* root is ≥50.0%; The total saponin content (calculated as astragaloside A) in the Astragalus membranaceus total saponin extract is ≥45.0%; The polysaccharide content (calculated as glucose) in the extract of Phellinus linteus is ≥60.0%; The total tannin content (calculated as gallic acid) in the tannin extract of Phyllanthus emblica is ≥65.0%.

[0023] The excipients include one or more of the following: fillers, disintegrants, lubricants, binders, suspending agents, and flavoring agents. The excipients account for 10% to 30% of the total mass of the traditional Chinese medicine composition.

[0024] The dosage form of the traditional Chinese medicine composition is an oral preparation, which includes one of the following: capsules, tablets, granules, powders, or oral liquids.

[0025] The preparation method of the traditional Chinese medicine composition includes the following steps: S1. After pretreatment, the root of Actinidia chinensis, Astragalus membranaceus, and Phyllanthus emblica were used to prepare total flavonoid extract of Actinidia chinensis, total saponin extract of Astragalus membranaceus, and tannin extract of Phyllanthus emblica. After pretreatment, Phyllanthus emblica fruiting body was used to prepare Phyllanthus emblica polysaccharide extract. S2. Mix the total flavonoid extract of Actinidia chinensis root, the total saponin extract of Astragalus membranaceus, the polysaccharide extract of Phellinus linteus and the tannin extract of Phyllanthus emblica to obtain an extraction mixture. Add an aqueous ethanol solution to the extraction mixture, and after ultrasonic and reflux synergistic extraction, filter, concentrate under reduced pressure and freeze dry under vacuum to obtain a composite active extract. S3. The composite active extract is prepared into an aqueous solution, and the targeted composite wall material is added and homogenized by high-speed emulsification. After homogenization, the targeted embedded microspheres are prepared by ion gelation. The targeted embedded microspheres are washed and vacuum freeze-dried to obtain the embedded composite active powder. S4. Mix the fermented mycelium dry powder with the encapsulated composite active powder, add excipients and mix evenly to prepare the corresponding traditional Chinese medicine composition pharmaceutical preparation.

[0026] Preparation method of fermented mycelium dry powder: Mother culture medium preparation Preparation of PSA medium: 200g potato (peeled), 18g agar, 20g sucrose, 1000mL distilled water, pH 6.0; Wash, peel and cut the potato into pieces, add 1200mL water, simmer for 20 minutes, filter through 6 layers of gauze to obtain the juice, add distilled water to 1000mL, add agar and sucrose, and after fully dissolving, adjust the pH to 6.0, autoclave at 121℃ for 30 minutes, remove and pour into sterile test tubes while hot to make a slant, cool and solidify, and place in a constant temperature of 25℃ for 2 days for blank culture. Check for no contamination before use.

[0027] Mother species isolation and purification Wild fresh Cordyceps sinensis from Nagqu region of Qinghai-Tibet Plateau was selected as the isolation source. The surface of the junction between the stroma and the insect body of Cordyceps sinensis was rubbed with 75% alcohol three times for 50 seconds each time, rinsed with sterile water four times, and placed in a covered sterile Petri dish. Use sterile filter paper to absorb residual moisture from the surface, use sterile tweezers to tear open the body wall from the sterile part of the back of the front of the insect, use a sterile inoculation needle to pick up several pieces of white sclerotia tissue from the insect, inoculate them onto PSA medium slant, place them in a constant temperature incubator at 24±2℃, control the environmental humidity at 30%-80%, observe the colony growth status regularly and discard samples contaminated by other bacteria in a timely manner. After 4 days of culture, white, fluffy mycelia grew on the tissue block. Vigorous white mycelia at their tips were selected and transplanted into blank PSA slant tubes. Purification and culture were continued for another 10 days under the same conditions to obtain a stable pure culture mother culture. This strain was named *Ophiocordycepsqingensis* Cs-2025 and has been deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO. 41879 and a deposit date of April 2, 2025. The purified slant mother culture was transferred to sterile cryopreservation tubes and stored long-term in a freezer below -20°C or in liquid nitrogen.

[0028] Preparation of primary seed liquid Liquid seed culture medium formulation: 36g peptone, 72g yeast extract, 144g sucrose, 3g magnesium sulfate, 6g potassium dihydrogen phosphate, 6000mL distilled water, adjusted to pH 6.5; after preparation, autoclave at 121℃ for 30 minutes, then cool to below 27℃ for later use. Inoculation and culture: Under aseptic conditions, use an inoculation loop to pick up approximately 1cm of the preserved Cs-2025 mother culture slant. 2 The mycelial blocks were inoculated into liquid seed culture medium and placed in a rotary shaker at 25℃ and 180r / min for 3 days. Microscopic examination showed that the mycelial morphology was normal and there was no contamination by other microorganisms, which is the first-grade seed liquid.

[0029] Secondary seed expansion culture Under aseptic conditions, the primary seed culture was inoculated at an inoculation rate of 8%–10% into six 3000mL Erlenmeyer flasks (each flask contained 1000mL of sterilized liquid seed culture medium), with 50mL of primary seed culture added to each flask. The Erlenmeyer flasks were then placed in a rotary shaker and cultured at a temperature of 20–28℃ and a shaking speed of 180 rpm for 48 hours. The secondary seed culture was obtained when the mycelial concentration met the standard and there was no contamination by other microorganisms, as determined by microscopic examination.

[0030] Fermentation culture and mycelium harvest After the secondary seed culture is qualified, inoculate 10% of the culture into the sterilized fermentation medium. The fermentation medium formula is the same as that of the seed medium. The fermentation conditions are: tank temperature 25℃, aeration rate 1:0.8vvm, tank pressure 0.05MPa, stirring speed 150r / min, and fermentation culture for 120 hours. Once the fermentation broth is thick, the mycelium content meets the standard, the pH value of the fermentation broth is stable at around 6.0, and no contamination is observed under a microscope, the fermentation is terminated. The fermentation broth is centrifuged at 2000 rpm for 20 minutes, the supernatant is discarded, the mycelium precipitate is collected, the mycelium is rinsed 3 times with sterile deionized water, and the water is drained to obtain wet mycelium.

[0031] Drying and grinding The collected wet mycelium was placed in a low-temperature vacuum drying oven at 40℃ and dried until the moisture content was ≤5.0% to obtain Cs-2025 fermented mycelium dry product. The dry product was put into an ultra-micro pulverizer and pulverized to 200-300 mesh. After sieving, the dry powder of Cordyceps militaris Cs-2025 fermented mycelium was obtained. The test results showed that the adenosine content of the dry powder was ≥0.35% and the Cordyceps polysaccharide content was ≥15.0%, which met the quality standards for medicinal raw materials.

[0032] Preparation of solid culture medium Solid culture medium formula: 200g millet, 10g sucrose, 250mg magnesium sulfate, 500mg potassium dihydrogen phosphate, 500mL distilled water, pH 6.5. Millet can be replaced with rice, oats, wheat or other grains, and sucrose can be replaced with glucose, maltose or other soluble carbon sources.

[0033] Culture medium preparation: Dissolve all ingredients except millet in distilled water, adjust the pH to 6.5, heat to boiling, add millet, continue heating and stirring constantly, stop heating when the material becomes a uniform solid porridge, divide evenly into 10 500mL wide-mouth bottles, seal with double-layer kraft paper, place in an autoclave, sterilize at 121℃ for 20 minutes, remove and cool to below 27℃ for later use.

[0034] Inoculation and Culture Under aseptic conditions, open the culture bottle and use an inoculation loop to pick up the mycelium from the slant of Cs-2025 mother culture and inoculate it evenly onto the surface of the solid culture medium. Then, seal the bottle opening as before. After inoculation, place the culture bottle in a well-ventilated aseptic culture room at 25°C and 45% relative humidity for 45 days. Stop the culture when the mycelium has fully grown on the culture medium, is uniformly white to pale yellow, and is free from contamination by other microorganisms.

[0035] Drying and grinding All the grown solid culture was taken out, stirred thoroughly, and immediately placed in a 70℃ forced-air drying oven to dry until the moisture content was ≤8.0%. After being taken out and cooled to room temperature, it was crushed by a pulverizer and passed through a 100-mesh sieve to obtain Cs-2025 solid culture dry powder, i.e. fermented mycelium dry powder.

[0036] The targeted composite wall material is made by compounding carboxymethyl chitosan, sodium alginate, hyaluronic acid and galactoylated sodium alginate in a mass ratio of 1:3:0.8:0.2. The mass ratio of the targeted composite wall material to the composite active extract is 3:1. The curing solution used in the ion gelation method is a 1.5% calcium chloride aqueous solution, and the curing time is 30 min.

[0037] The volume fraction of the ethanol-water solution is 70%, and the solid-liquid ratio is 1:15; The parameters for combined ultrasonic and reflux extraction are as follows: first, ultrasonic extraction at 300W for 20-30 minutes, followed by reflux extraction for 1.5 hours to complete the extraction.

[0038] The application of traditional Chinese medicine compositions containing Cordyceps militaris in the preparation of antitumor drugs, and the application of the traditional Chinese medicine compositions in the treatment of one or more of non-small cell lung cancer, colorectal cancer, liver cancer, breast cancer and pancreatic cancer.

[0039] Example 1 The traditional Chinese medicine composition containing Cordyceps militaris contains the following active ingredients by weight: 40 parts of fermented mycelium dry powder of Cordyceps militaris Cs-2025, 20 parts of total flavonoid extract from Actinidia chinensis root, 15 parts of total saponin extract from Astragalus membranaceus, 12 parts of polysaccharide extract from Phellinus linteus, and 5 parts of tannin extract from Phyllanthus emblica. The excipients are 10 parts pregelatinized starch, 3 parts crospovidone, and 0.5 parts magnesium stearate, accounting for 13.2% of the total mass of the composition. The dosage form is hard capsule.

[0040] Preparation method of traditional Chinese medicine composition: S1. After cleaning, slicing, and drying the medicinal materials of *Actinidia chinensis* root, *Astragalus membranaceus*, and *Phyllanthus emblica*, the total flavonoid extract of *Actinidia chinensis* root, the total saponin extract of *Astragalus membranaceus*, and the tannin extract of *Phyllanthus emblica* were prepared using the D101 macroporous adsorption resin purification process. After cleaning, pulverizing, and drying the fruiting body of *Phellinus linteus*, the polysaccharide extract of *Phellinus linteus* was prepared using the water extraction and alcohol precipitation-Sevage method to remove protein. S2. Mix the four extracts from S1 evenly to obtain an extraction mixture. Add 70% ethanol aqueous solution (by volume) to the extraction mixture at a material-to-liquid ratio of 1:15. First, extract with ultrasonic power at 300W for 25 minutes, then reflux for 1.5 hours. Filter the extract through a 300-mesh filter cloth. Concentrate the filtrate under reduced pressure until there is no alcohol odor. Freeze dry under vacuum to obtain a composite active extract. S3. Dissolve the composite active extract in deionized water to prepare a 15% (w / w) aqueous solution. Add the targeted composite wall material (carboxymethyl chitosan, sodium alginate, hyaluronic acid, and galactoside-modified sodium alginate in a mass ratio of 1:3:0.8:0.2). The mass ratio of the targeted composite wall material to the composite active extract is 3:1. Emulsify and homogenize at 12000 r / min for 15 min. Then, add the mixture dropwise to a 1.5% (w / w) calcium chloride aqueous solution and solidify for 30 min to prepare targeted embedded microspheres. After washing the microspheres three times with deionized water, freeze-dry them under vacuum to obtain the embedded composite active powder. S4. After mixing the fermented mycelium dry powder and the encapsulated composite active powder evenly, add the excipients, place them in a three-dimensional motion mixer and mix for 30 minutes. After mixing evenly, fill the mixture with a hard capsule filling machine to prepare hard capsules with a content of 0.35g per capsule.

[0041] Example 2 The traditional Chinese medicine composition containing Cordyceps militaris contains the following active ingredients by weight: 30 parts of fermented mycelium dry powder of Cordyceps militaris Cs-2025, 15 parts of total flavonoid extract from Actinidia chinensis root, 10 parts of total saponin extract from Astragalus membranaceus, 8 parts of polysaccharide extract from Phellinus linteus, and 3 parts of tannin extract from Phyllanthus emblica. The excipients are 8 parts microcrystalline cellulose, 2 parts sodium carboxymethyl starch, and 0.3 parts magnesium stearate, accounting for 12.1% of the total mass of the composition. The dosage form is hard capsule.

[0042] Preparation method of traditional Chinese medicine composition: The difference is that the ultrasonic extraction time of S2 is 20 min, and the other steps are the same as in Example 1.

[0043] Example 3 The traditional Chinese medicine composition containing Cordyceps militaris contains the following active ingredients by weight: 50 parts of fermented mycelium dry powder of Cordyceps militaris Cs-2025, 25 parts of total flavonoid extract from Actinidia chinensis root, 20 parts of total saponin extract from Astragalus membranaceus, 18 parts of polysaccharide extract from Phellinus linteus, and 8 parts of tannin extract from Phyllanthus emblica. The excipients are 15 parts dextrin, 5 parts sucrose, and 0.5 parts sodium citrate, accounting for 15.2% of the total mass of the composition. The dosage form is hard capsules.

[0044] Preparation method of traditional Chinese medicine composition: The difference is that the ultrasonic extraction time of S2 is 30 min, and the remaining steps are the same as in Example 1.

[0045] Comparative Example 1: The active ingredient did not contain amla tannin extract, and the remaining components, preparation method, and dosage form were the same as in Example 1; Comparative Example 2: The active ingredients did not include total flavonoid extract from Actinidia chinensis root; the remaining components, preparation method, and dosage form were the same as in Example 1. Comparative Example 3: In step S3, no targeted composite wall material was used; only sodium alginate was used as the wall material. The remaining components, preparation methods, and dosage forms were the same as in Example 1. Comparative Example 4: Common commercial Cordyceps militaris fermentation mycelium dry powder (adenosine content 0.18%, Cordyceps polysaccharide content 8.5%) was used to replace Cs-2025 mycelium dry powder, and the remaining components, preparation methods, and dosage forms were the same as in Example 1; Comparative Example 5: The active ingredients in parts by weight are 20 parts of Cs-2025 mycelial dry powder, 10 parts of total flavonoid extract from Actinidia chinensis root, 5 parts of total saponin extract from Astragalus membranaceus, 5 parts of polysaccharide extract from Phellinus linteus, and 2 parts of tannin extract from Phyllanthus emblica. None of these are within the scope of protection of claim 1. The other preparation methods and dosage forms are the same as in Example 1. Comparative Example 6: In step S2, ultrasonic-reflux synergistic extraction was not used; conventional reflux extraction was used for 1.5 hours. The remaining components, preparation methods, and dosage forms were the same as in Example 1. Comparative Example 7: Single Cs-2025 fermentation mycelium dry powder, without other active components, was prepared into hard capsules of the same specifications as in Example 1.

[0046] Test case Using the MTT assay, human non-small cell lung cancer A549 cells, cisplatin-resistant A549 / DDP cells, human colorectal cancer HCT116 cells, and 5-fluorouracil-resistant HCT116 / 5-FU cells in logarithmic growth phase were collected and divided into groups of 5 × 10⁻⁶ cells. 3 Cells / well were seeded in a 96-well plate. After 48 h of culture, the absorbance at 490 nm was measured and the half-maximal inhibitory concentration (IC50) of cell proliferation was calculated. The lower the IC50 value, the stronger the antitumor activity. Table 1 shows the in vitro inhibitory activity against tumor cell proliferation. ; As shown in Table 1, Examples 1-3 all exhibited strong inhibitory effects on the proliferation of wild-type and chemotherapy-resistant tumor cells, with IC50 values ​​significantly lower than all comparative examples. The inhibitory activity against drug-resistant tumor cells was more than 7 times that of Comparative Example 7 (single mycelium), demonstrating that the drug formulation, strain selection, extraction process, and encapsulation process of this traditional Chinese medicine composition formed a complete synergistic effect, which can significantly reverse multidrug resistance in tumors. Comparative Examples 1 and 2 showed a decrease of over 80% in inhibitory activity against drug-resistant tumor cells due to the absence of active components, demonstrating that total flavonoids from Actinidia chinensis root and tannin extract from Phyllanthus emblica are the core components for reversing drug resistance and enhancing tumor-suppressing activity. Comparative Examples 3, 4, and 6 showed a significant decrease in antitumor activity due to changes in encapsulation process, bacterial strain, and extraction process, demonstrating that the preparation process parameters determine the efficacy level of the traditional Chinese medicine composition. A549-derived tumor stem cells (A549-CSCs) were enriched using a serum-free suspension culture method, and the CD44+ / CD133+ cell ratio was verified to be ≥90% by flow cytometry. A549-CSCs were then cultured at a ratio of 1×10⁻⁶ cells / year. 3 Tumor microspheres were seeded per well in an ultra-low adsorption 96-well plate, and 1 mg / mL of the test sample was added. After 7 days of culture, the number of tumor microspheres was counted under a microscope, and the microsphere formation inhibition rate was calculated. At the same time, the IC50 of the composition on the proliferation of A549-CSC was detected by the MTT assay. Table 2 shows the inhibitory effect on lung cancer tumor stem cells. ; As shown in Table 2, Examples 1-3 can significantly inhibit the proliferation of tumor stem cells, disrupt their self-renewal capacity, and the inhibition rate of tumor microsphere formation all exceed 80%. The comparative example 1, which lacked the extract of Phyllanthus emblica tannins, and the comparative example 7, which consisted of a single mycelium, showed no significant inhibitory effect on tumor stem cells, proving that the drug prepared by this traditional Chinese medicine composition can effectively eliminate tumor stem cells and block tumor recurrence and chemotherapy resistance. Table 3 shows the efficacy and safety of antitumor drugs in nude mice. ; As shown in Table 3, the in vivo tumor inhibition rate of Examples 1-3 against cisplatin-resistant non-small cell lung cancer all exceeded 80%, with Example 1 achieving a tumor inhibition rate of 56.65%, which was superior to the clinical chemotherapy drug cisplatin and significantly superior to all comparative examples, demonstrating that the traditional Chinese medicine composition has a very strong in vivo therapeutic effect on drug-resistant tumors. The spleen and thymus indices of mice in the cisplatin group decreased significantly, and severe immunosuppression and liver and kidney damage occurred. In contrast, the immune organ indices of tumor-bearing mice in Examples 1-3 were significantly improved, with no liver or kidney toxicity. This demonstrates that the traditional Chinese medicine composition can improve the body's immune function while effectively inhibiting tumors, and its safety is significantly better than that of chemotherapy drugs. In all comparative studies, the tumor inhibition rate decreased significantly due to the absence or alteration of components or processes, demonstrating that the various technical characteristics of the herbal composition, including the bacterial strain, formulation, and preparation process, are interdependent and synergistic.

[0047] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention.

Claims

1. A traditional Chinese medicine composition containing Cordyceps militaris, characterized in that: The traditional Chinese medicine composition consists of active ingredients and excipients. The active ingredients, by weight, include the following components: 30-50 parts of fermented mycelium dry powder, 15-25 parts of total flavonoid extract from Actinidia chinensis root, 10-20 parts of total saponin extract from Astragalus membranaceus, 8-18 parts of polysaccharide extract from Phellinus linteus, and 3-8 parts of tannin extract from Phyllanthus emblica.

2. The traditional Chinese medicine composition containing Cordyceps militaris according to claim 1, characterized in that: The fermented mycelium powder is specifically Cordyceps sinensis Cs-2025, whose strain preservation number is CGMCC NO.41879.

3. The traditional Chinese medicine composition containing Cordyceps militaris according to claim 1, characterized in that: The fermented mycelium powder contains ≥0.35% adenosine and ≥15.0% cordyceps polysaccharides. The total flavonoid content (calculated as rutin) in the total flavonoid extract of *Actinidia chinensis* root is ≥50.0%; The total saponin content (calculated as astragaloside A) in the Astragalus membranaceus total saponin extract is ≥45.0%; The polysaccharide content (calculated as glucose) in the extract of Phellinus linteus is ≥60.0%; The total tannin content (calculated as gallic acid) in the tannin extract of Phyllanthus emblica is ≥65.0%.

4. The traditional Chinese medicine composition containing Cordyceps militaris according to claim 1, characterized in that: The auxiliary materials include: One or more of fillers, disintegrants, lubricants, binders, suspending agents, and flavoring agents are included in the traditional Chinese medicine composition, and the excipients account for 10% to 30% of the total mass of the composition.

5. The traditional Chinese medicine composition containing Cordyceps militaris according to claim 1, characterized in that: The dosage form of the traditional Chinese medicine composition is an oral preparation, which includes one of the following: capsules, tablets, granules, powders, or oral liquids.

6. The traditional Chinese medicine composition containing Cordyceps militaris according to claim 1, characterized in that: The preparation method of the traditional Chinese medicine composition includes the following steps: S1. After pretreatment, the root of Actinidia chinensis, Astragalus membranaceus, and Phyllanthus emblica were used to prepare total flavonoid extract of Actinidia chinensis, total saponin extract of Astragalus membranaceus, and tannin extract of Phyllanthus emblica. After pretreatment, Phyllanthus emblica fruiting body was used to prepare Phyllanthus emblica polysaccharide extract. S2. Mix the total flavonoid extract of Actinidia chinensis root, the total saponin extract of Astragalus membranaceus, the polysaccharide extract of Phellinus linteus and the tannin extract of Phyllanthus emblica to obtain an extraction mixture. Add an aqueous ethanol solution to the extraction mixture, and after ultrasonic and reflux synergistic extraction, filter, concentrate under reduced pressure and freeze dry under vacuum to obtain a composite active extract. S3. The composite active extract is prepared into an aqueous solution, and the targeted composite wall material is added and homogenized by high-speed emulsification. After homogenization, the targeted embedded microspheres are prepared by ion gelation. The targeted embedded microspheres are washed and vacuum freeze-dried to obtain the embedded composite active powder. S4. Mix the fermented mycelium dry powder with the encapsulated composite active powder, add excipients and mix evenly to prepare the corresponding traditional Chinese medicine composition pharmaceutical preparation.

7. A traditional Chinese medicine composition containing Cordyceps militaris according to claim 6, characterized in that: The targeted composite wall material is made by compounding carboxymethyl chitosan, sodium alginate, hyaluronic acid and galactoylated sodium alginate in a mass ratio of 1:3:0.8:0.2; The mass ratio of the targeted composite wall material to the composite active extract is 3:

1. The curing solution used in the ion gelation method is a 1.5% calcium chloride aqueous solution, and the curing time is 30 min.

8. A traditional Chinese medicine composition containing Cordyceps militaris according to claim 6, characterized in that: The volume fraction of the ethanol-water solution is 70%, and the solid-liquid ratio is 1:15; The parameters for combined ultrasonic and reflux extraction are as follows: first, ultrasonic extraction at 300W for 20-30 minutes, followed by reflux extraction for 1.5 hours to complete the extraction.

9. The use of the traditional Chinese medicine composition containing Cordyceps militaris according to any one of claims 1-8 in the preparation of antitumor drugs.

10. The application of a traditional Chinese medicine composition containing Cordyceps militaris according to claim 9 in the treatment of tumors, characterized in that: The Chinese herbal composition is used to treat one or more of the following cancers: non-small cell lung cancer, colorectal cancer, liver cancer, breast cancer, bladder cancer, and pancreatic cancer.

Images