Mycoplasma pneumoniae p1 protein binding protein, method for producing the same, and use thereof

Abstract

This application discloses a Mycoplasma pneumoniae P1 protein-binding protein, its preparation method, and its uses. The Mycoplasma pneumoniae P1 protein-binding protein includes an immunoglobulin single variable domain, wherein the immunoglobulin single variable domain comprises CDR1, CDR2, and CDR3 contained in VHH as shown in any one of SEQ ID NO: 1-8. The bivalent or multivalent nanobodies prepared using this Mycoplasma pneumoniae P1 protein-binding protein can effectively enhance their binding strength to antigens, providing a superior raw material for developing highly sensitive detection and diagnostic applications.

Description

Technical Field

[0001] This application relates to the field of biotechnology, specifically to Mycoplasma pneumoniae P1 protein-binding protein and its preparation method and uses, and further to Mycoplasma pneumoniae P1 protein-binding protein, nucleic acid molecule encoding it, recombinant expression vector containing the nucleic acid molecule, cell containing the nucleic acid molecule and / or recombinant expression vector, preparation method and uses thereof. Background Technology

[0002] Mycoplasma pneumoniae (MP) is a leading pathogen of community-acquired pneumonia, with an infection rate as high as 20.7%–38.9% in adult patients, ranking first among all pathogens. MP infection not only causes respiratory symptoms, but approximately 25% of cases can develop serious extrapulmonary complications such as meningitis and myocarditis, posing a particularly significant threat to children and adolescents. Therefore, developing highly sensitive and specific early diagnostic methods is crucial for achieving precision treatment and reducing the rate of severe illness and mortality. The key to achieving this goal lies in obtaining recognition molecules with high affinity for the Mycoplasma pneumoniae P1 protein (MPP1) antigen to construct high-performance diagnostic reagents.

[0003] Nanobodies (Nb) typically refer to single-domain antibody fragments derived from the variable region (VHH) of heavy chain antibodies from camels (such as camels and alpacas) or sharks. They have a small molecular weight (approximately 12-15 kDa, only one-tenth the size of traditional IgG antibodies) and possess characteristics such as high specificity, strong tissue penetration, excellent physicochemical stability (resistance to high temperatures, extreme pH levels, etc.), and ease of engineering modification. Compared to traditional IgG antibodies, nanobodies can more easily penetrate the respiratory mucosal barrier and are expected to effectively accumulate at the infection site in the early stages of Mycoplasma pneumoniae infection, making them ideal candidate molecules for constructing next-generation highly sensitive diagnostic probes.

[0004] Currently, mainstream antibody preparation technologies include immunoserological methods, hybridoma technology, and phage display technology, used to obtain polyclonal or monoclonal antibodies, respectively. Immunosera (polyclonal antibody preparation) directly obtains serum containing polyclonal antibodies through animal immunization; it is simple and low-cost, but suffers from significant batch-to-batch variability and a high risk of non-specific cross-reactions. Hybridoma technology, by fusing immune B cells with myeloma cells to construct hybridoma cell lines that stably secrete monoclonal antibodies, is considered the "gold standard" for monoclonal antibody preparation. However, this technology is cumbersome, time-consuming (usually 3-6 months), and costly in terms of manpower and resources. Phage display technology, based on genetic engineering principles, fuses antibody gene fragments with phage coat protein genes for expression, enriching high-affinity clones through multiple rounds of biological screening involving adsorption-elution-amplification. While avoiding animal cell culture, the traditional process still takes 2-3 months, and the large library size and background interference can lead to low screening efficiency.

[0005] Despite the significant advantages of nanobodies, their single-chain, monovalent structure may face challenges due to insufficient affinity in certain applications (such as detecting low-abundance targets). Furthermore, their relatively short in vivo serum half-life also limits their potential as therapeutic agents. Therefore, effective engineering modifications of screened nanobodies to enhance their affinity, specificity, sensitivity, and pharmacokinetic properties are crucial for fully exploring their application value in diagnostics, therapy, and detection.

[0006] In summary, to address the need for early and accurate diagnosis of Mycoplasma pneumoniae infection, it is urgent to overcome the problems of long preparation cycles, low efficiency, and high costs associated with existing antibodies, and to solve the affinity bottleneck that single-chain nanobodies may face in diagnostic applications. Summary of the Invention

[0007] Based on this, this application provides at least one Mycoplasma pneumoniae P1 protein-binding protein, its preparation method, and its uses.

[0008] In a first aspect of this application, a Mycoplasma pneumoniae P1 protein (MPP1) binding protein is provided, comprising an immunoglobulin single variable domain, wherein the immunoglobulin single variable domain comprises CDR1, CDR2 and CDR3 contained in VHH as shown in any one of SEQ ID NO: 1 to 8.

[0009] In a second aspect of this application, a nucleic acid molecule is provided that encodes the MPP1 binding protein as described in the first aspect.

[0010] In a third aspect of this application, a recombinant expression vector is provided, comprising the nucleic acid molecules as described in the second aspect.

[0011] In a fourth aspect of this application, a cell is provided that comprises at least one of the nucleic acid molecules as described in the second aspect and the recombinant expression vector as described in the third aspect.

[0012] In a fifth aspect of this application, a conjugate is provided comprising the MPP1 binding protein as described in the first aspect, conjugated to a diagnostic agent or imaging agent.

[0013] In a sixth aspect of this application, a composition is provided comprising the MPP1 binding protein of the first aspect, the nucleic acid molecule of the second aspect, the recombinant expression vector of the third aspect, the cell of the fourth aspect, or the conjugate of the fifth aspect.

[0014] In a seventh aspect of this application, the use of the MPP1 binding protein of the first aspect, the nucleic acid molecule of the second aspect, the recombinant expression vector of the third aspect, the cell of the fourth aspect, the conjugate of the fifth aspect, or the composition of the sixth aspect is provided, the use comprising:

[0015] i) Testing for Mycoplasma pneumoniae or MPP1 for non-diagnostic and non-treatment purposes;

[0016] ii) Prepare products for the diagnosis and / or auxiliary diagnosis of Mycoplasma pneumoniae infection;

[0017] iii) Prepare products for the detection of Mycoplasma pneumoniae or MPP1;

[0018] iv) Used for the isolation, enrichment and / or purification of Mycoplasma pneumoniae or MPP1;

[0019] v) Prepare products for the isolation, enrichment and / or purification of Mycoplasma pneumoniae or MPP1.

[0020] In an eighth aspect of this application, a kit for detecting MPP1 or Mycoplasma pneumoniae is provided, comprising at least one of the MPP1 binding protein described in the first aspect and the conjugate described in the fifth aspect.

[0021] In a ninth aspect of this application, a method for preparing the MPP1 binding protein as described in the first aspect is provided, the method comprising:

[0022] Culture the cells as described in the fourth aspect to prepare a culture;

[0023] MPP1 binding protein was isolated from the culture.

[0024] This application proposes to combine fluorescence-activated cell sorting (FACS) technology with phage display technology. This strategy utilizes FACS to directly construct phage display libraries from the B cell population of the immune host, which can significantly reduce the library size and increase the effective library capacity ratio of the target antibody. This greatly reduces the cycle of traditional phage screening to less than one month, and significantly improves the screening efficiency and success rate of high affinity nanobodies.

[0025] This application further proposes an innovative dimerization engineering technique for the highly specific, high-affinity single-chain VHH obtained through screening. By designing and constructing divalent or multivalent nanobodies, their binding strength to antigens (functional affinity) can be effectively enhanced, providing superior raw materials for developing highly sensitive detection and diagnostic applications (especially for low-abundance targets). The successful application of this engineering strategy also verifies its effectiveness and versatility in improving nanobody performance. Attached Figure Description

[0026] To more clearly illustrate the technical solutions in the embodiments and examples of this application, and to more completely understand this application and its beneficial effects, the drawings used in the description of the embodiments or examples will be briefly introduced below. Obviously, the drawings described below are merely some embodiments of this application. Those skilled in the art can obtain other drawings based on these drawings without creative effort. It should also be noted that the drawings are all drawn in a simplified form and are only used to conveniently and clearly assist in illustrating this application.

[0027] Figure 1 This is an image showing the electrophoresis result of the MPP1 antigen in one embodiment of this application.

[0028] Figure 2 This is a diagram of the nucleic acid amplification of the VHH gene by primer PCR in one embodiment of this application.

[0029] Figure 3 This is an electrophoresis diagram of a linearized carrier in one embodiment of this application.

[0030] Figure 4 This is a purification diagram of the MPP1 nanobody in one embodiment of this application; where Lanes 1 to 8 are SDS-PAGE diagrams of the MPP1 nanobody.

[0031] Figure 5 This is a characterization of the affinity between the MPP1 antigen and the nanobody in one embodiment of this application.

[0032] Figure 6This is an electrophoresis diagram of PCR fragments in one embodiment of this application; wherein, A.1~4: electrophoresis diagrams of the amplification of fragment 1, Mpp1-12, Mpp1-2D10, Mpp1-5C12, and Mpp1-1A1, and B.1~4: electrophoresis diagrams of the amplification of fragment 2, Mpp1-12, Mpp1-2D10, Mpp1-5C12, and Mpp1-1A1.

[0033] Figure 7 This is an electrophoresis image of the linearized pMES4 carrier in one embodiment of this application.

[0034] Figure 8 This is a bacterial culture PCR electrophoresis image from one embodiment of this application; where 1 to 7 are positive clones.

[0035] Figure 9 The image shows an SDS-PAGE electrophoresis diagram of the dimerized nanoantibody in one embodiment of this application; 1 to 4 are SDS-PAGE electrophoresis diagrams of the dimerized antibodies Mpp1-12, Mpp1-2D10, Mpp1-5C12, and Mpp1-1A1, respectively.

[0036] Figure 10 This is a characterization of the affinity between the MPP1 antigen and the dimerized nanobody in one embodiment of this application; wherein A. VHH nanobody affinity characterization, and B. dimerized nanobody affinity characterization.

[0037] Figure 11 The flowchart below shows the preparation of nanobodies in one embodiment of this application: A. Alpaca immunization and phage display library construction, B. Phage display screening, C. Nanobodies verification and modification. Detailed Implementation

[0038] To facilitate understanding of this application, a more complete description will be provided below with reference to the accompanying drawings. Preferred embodiments of this application are shown in the drawings. However, this application can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of this application.

[0039] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0040] In this application, unless otherwise specified, "one or more" means any one of the listed items or any combination of the listed items. Similarly, "one or more" and other instances that otherwise indicate "one or more" shall be understood in the same way unless otherwise specified.

[0041] The terms “combinations thereof,” “any combination thereof,” and “any combination thereof” as used in this application include all suitable combinations of any two or more of the listed items.

[0042] In this application, the word "suitable" in "suitable combination", "suitable method", "any suitable method" etc., shall be defined as being able to implement the technical solution of this application, solve the technical problem of this application, and achieve the expected technical effect of this application.

[0043] In this application, terms such as "further," "even more," "particularly," "for example," "like," "example," and "exemplary" are used for descriptive purposes to indicate that different technical solutions preceding and following each other are related in terms of their coverage, but should not be construed as limiting the preceding technical solution or restricting the scope of protection of this application. In this application, unless otherwise specified, A (e.g., B) indicates that B is a non-limiting example of A, and it can be understood that A is not limited to B.

[0044] In this application, "optionally," "optionally," and "optional" mean that something is optional, that is, it refers to either "with" or "without" a parallel solution. If multiple "options" appear in a technical solution, unless otherwise specified and there are no contradictions or mutual constraints, each "option" is independent. Unless otherwise specified, the descriptions such as "optionally include" and "optionally contain" in this application, taking "optionally include" as an example, mean "may include or not include."

[0045] The terms “containing,” “comprising,” and “including” as used in this application are synonyms and are inclusive or open-ended, not excluding additional, uncited members or features. Members or features include, for example, materials or components, structures, elements, instruments, etc.; non-limiting examples of members or features include actions, conditions under which actions occur, timing, states, etc.

[0046] In this application, the technical features or solutions described in open-ended language include both closed-ended technical features or solutions consisting of the listed contents and open-ended technical features or solutions that include the listed contents.

[0047] In this application, the exemplary descriptions such as "in some implementations (or embodiments)" and "in one implementation (or embodiment)" may cover, but are not limited to, the following meanings: these solutions can be combined with other solutions in a suitable manner to form new technical solutions.

[0048] In this application, the terms "first aspect," "second aspect," "third aspect," "fourth aspect," etc., are used for descriptive purposes only and should not be construed as indicating or implying relative importance or quantity, nor should they be construed as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first," "second," "third," "fourth," etc., serve only a non-exhaustive enumeration purpose and should be understood not to constitute a closed limitation on quantity.

[0049] In this application, when numerical intervals (i.e., numerical ranges) are involved, unless otherwise specified, the distribution of selectable numerical values ​​within the numerical interval is considered continuous, and includes the two endpoints of the numerical interval (i.e., the minimum and maximum values), as well as every numerical value between these two endpoints. Unless otherwise specified, when a numerical interval refers only to integers within that numerical interval, it includes the two endpoint integers of the numerical range, as well as every integer between the two endpoints, which is equivalent to directly listing every integer. When multiple numerical ranges are provided to describe features or characteristics, these numerical ranges can be merged. In other words, unless otherwise specified, the numerical ranges disclosed herein should be understood to include any and all subranges included therein. The "numerical value" in the numerical interval can be any quantitative value, such as a number, percentage, ratio, etc. The term "numerical interval" can be broadly included to include numerical interval types such as percentage intervals, ratio intervals, and proportion intervals.

[0050] In this application, where the method flow involves multiple steps, unless otherwise explicitly stated herein, there is no strict order restriction on the execution of these steps; they can be executed in any order other than those described. Moreover, any step may include multiple sub-steps or multiple stages, which are not necessarily completed at the same time, but can be executed at different times, and their execution order is not necessarily sequential, but can be performed alternately or simultaneously with other steps or parts of the sub-steps or stages of other steps.

[0051] The binding protein provided in this application can specifically bind to Mycoplasma pneumoniae P1 protein (MPP1), hereinafter referred to as MPP1 binding protein. The MPP1 bound by the MPP1 binding protein includes proteins having the natural MPP1 sequence and its variants, including but not limited to variants containing at least one subunit that has been mutated, truncated, or fused with other domains, retaining the necessary antigenic epitopes for binding to the binding protein provided in this invention.

[0052] In this application, the technical term "binding protein" refers to a protein that binds to a specific antigen, and broadly refers to all proteins and protein fragments containing a complementarity-determining region (CDR). Binding proteins can be antibodies; the terms "antibody" and "full-length antibody" include both polyclonal and monoclonal antibodies. Furthermore, the term "antibody" includes both naturally occurring and non-naturally occurring antibodies, including, for example, chimeric, bifunctional, and humanized antibodies, as well as related synthetic isoforms. Non-naturally occurring antibodies are also referred to herein as "recombinant antibodies," and the term "antibody" is used interchangeably with "immunoglobulin."

[0053] One aspect of this application provides an MPP1 binding protein comprising an immunoglobulin single variable domain, wherein the immunoglobulin single variable domain comprises CDR1, CDR2 and CDR3 contained in VHH as shown in any one of SEQ ID NO: 1 to 8.

[0054] “VHH,” also known as heavy chain single-domain antibody, VHH domain, VHH antibody fragment, and VHH antibody, is a variable domain of an antigen-binding immunoglobulin called a “heavy chain antibody” (i.e., “antibody lacking a light chain”) (Hamers-Casterman C, Atarhouch T, Muyldermans S, Robinson G, Hamers C, Songa EB, Bendahman N, Hamers R.: “Naturally occurring antibodies devoid of light chains”; Nature 363, 446-448 (1993)). The term “VHH domain” is used to distinguish this variable domain from the heavy chain variable domain (referred to herein as the “VH domain”) present in conventional 4-chain antibodies and the light chain variable domain (referred herein as the “VL domain”) present in conventional 4-chain antibodies. The VHH domain specifically binds to epitopes without the need for other antigen-binding domains (unlike the VH or VL domains in conventional 4-chain antibodies, where the epitope is recognized by both the VL and VH domains). The VHH domain is a small, stable, and highly efficient antigen-recognition unit formed by a single immunoglobulin domain.

[0055] Unless otherwise specified, the terms "heavy chain single-domain antibody," "VHH domain," "VHH," "VHH antibody fragment," "VHH antibody," and "nanobody" in this application are used interchangeably. In some embodiments, CDR1 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 9; CDR2 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 10; and CDR3 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 11.

[0056] In some embodiments, CDR1 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 12, CDR2 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 13, and CDR3 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 14.

[0057] In some embodiments, CDR1 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 15, CDR2 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 16, and CDR3 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 17.

[0058] In some embodiments, CDR1 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 18, CDR2 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 19, and CDR3 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 20.

[0059] In some embodiments, CDR1 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 21, CDR2 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 22, and CDR3 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 23.

[0060] In some embodiments, CDR1 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 24, CDR2 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 25, and CDR3 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 26.

[0061] In some embodiments, CDR1 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 27, CDR2 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 28, and CDR3 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 29.

[0062] In some embodiments, CDR1 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 30, CDR2 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 31, and CDR3 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 32.

[0063] The monoclonal antibody of this application may have the aforementioned CDRs, or a derived fragment having the aforementioned CDRs. The derived fragment is formed by replacing amino acids at no more than six sites relative to its corresponding CDR (“conservative modification” or “conservative substitution”), retaining the biological activity consistent with its corresponding complementarity-determining region. For example, the derivative fragment may replace one amino acid with another, or one amino acid with multiple amino acids (e.g., two), at sites 1, 2, 3, 4, 5, or 6 of its corresponding complementarity-determining region.

[0064] In the CDRs provided in this application, the derived fragments (conserved variants) refer to polypeptides formed by replacing one, two, or three amino acids with amino acids of similar or related properties compared to the amino acid sequence of the antibody in this application. These conserved variant polypeptides are preferably generated by amino acid substitutions according to Table A.

[0065] Table A

[0066]

[0067] "Conservative modification" or "conservative substitution" refers to the replacement of an amino acid in a protein with another amino acid having similar characteristics (e.g., charge, side chain size, hydrophobicity / hydrophilicity, main chain conformation, and rigidity), allowing for frequent alterations without changing the protein's biological activity. Those skilled in the art will recognize that, in general, the substitution of a single amino acid in a non-essential region of a polypeptide does not substantially alter its biological activity (see, for example, Watson et al. (1987), Molecular Biology of the Gene, The Benjamin / Cummings Pub. Co., p. 224, (4th edition)). Furthermore, substitutions of structurally or functionally similar amino acids are unlikely to disrupt biological activity.

[0068] The "identity" (sequence identity percentage (%)) of an amino acid or nucleic acid sequence is defined as the percentage of amino acid residues (or nucleotides) in the candidate sequence that are identical to those in the reference sequence after alignment (introducing vacancies where necessary to achieve the maximum number of identical amino acids or nucleic acids). In other words, the sequence identity percentage (%) of an amino acid sequence (or nucleic acid sequence) can be calculated by dividing the number of identical amino acid residues (or bases) relative to the reference sequence by the total number of amino acid residues (or bases) in the candidate or reference sequence (whichever is shorter). Conservative substitutions of amino acid residues may or may not be considered identical residues. For example, publicly available tools can be used, such as BLASTN, BLASTp (available on the website of the US National Center for Biotechnology Information (NCBI), see also Altschul SF et al., Journal of Molecular Biology 215:403-410 (1990); Stephen F. et al., Nucleic Acids Res., 25:3389-3402 (1997)), ClustalW2 (available on the website of the European Bioinformatics Institute, see also Higgins DG et al., Methods in Enzymology, 266:383-402 (1996); Larkin MA et al., Bioinformatics (Cambridge, UK), 23(21):2947-8 (2007)), and ALIGN or Megalign. The (DNASTAR) software is used to determine the percentage of identity between amino acid (or nucleic acid) sequences. Those skilled in the art can use the default parameters provided by the tool or customize the parameters appropriately according to the needs of the alignment, for example, by selecting a suitable algorithm.

[0069] Binding proteins can also be antigen-binding fragments containing part or all of the antibody CDR, lacking at least some amino acids present in the full-length antibody chain but still capable of specifically binding to antigens. Such fragments are biologically active because they bind to the target antigen and can compete with other antigen-binding molecules (including intact antibodies) for binding to a given epitope. These fragments are selected from, but are not limited to, F(ab')2, Fab', Fab, Fv (composed of VH and VL), ScFv (single-chain antibody with VH and VL linked by a linker peptide), dsFv (disulfide-stabilized Fv fragments), bispecific antibodies, nanobodies, and the smallest recognition unit of an antibody. In addition to the functional fragments mentioned above, any fragment with an extended half-life is also included.

[0070] In some embodiments, the MPP1 binding protein is monovalent, bivalent, or multivalent.

[0071] Methods for constructing divalent peptides are known in the art (e.g., US2003 / 0088074) and are also described below.

[0072] (1) Antigen preparation: The antigen is prepared by prokaryotic expression. This process involves multiple steps such as transformation, amplification, induction, expression, harvesting and purification of Escherichia coli.

[0073] (2) Alpaca immunity: By infecting alpacas, their immune system is induced to produce a specific immune response against the MPP1 antigen, including activating the immune response and promoting plasma cell differentiation and maturation, thereby producing antibodies.

[0074] (3) RNA Extraction: The microRNA extraction kit can rapidly and efficiently separate and purify intracellular RNA, and effectively remove DNA, proteins and other impurities, thus ensuring high purity and integrity of the extracted RNA. Compared with traditional methods that use chemical reagents such as chloroform or TRIzol to extract RNA, these kits are superior in terms of purity and integrity. High-purity RNA can be used as a template for cDNA synthesis, laying a solid foundation for subsequent DNA library construction.

[0075] (4) cDNA synthesis: The process of synthesizing cDNA using RNA as a template under the action of reverse transcriptase.

[0076] (5) Construction of Nanophage Display Library: A biolibrary constructed using phage display technology contains a large number of variable regions of nanobodies, capable of specifically recognizing and binding antigens. Nanobodies are small, highly stable, and easily cross the blood-brain barrier, playing an important role in the treatment of brain diseases. The construction process of this display library is flexible and efficient, allowing for the rapid generation and screening of various antibody variants. This method not only reduces costs but also shortens the research and development cycle, greatly facilitating new drug development and clinical treatment.

[0077] (6) Phage display and panning: The constructed nanophage library was introduced into TG1 competent cells via electroporation. After successful transformation, these phages displayed specific antibody fragments on the cell surface. A solid-phase screening method was used to bind the specific antibodies displayed on the phage surface to the target antigen. To improve the accuracy and specificity of the screening, 3-4 rounds of panning were required, each round including washing, elution, and phage amplification. In each round, unbound or weakly bound phages were continuously removed, ultimately obtaining high-affinity positive clones.

[0078] (7) Identification of positive clones and sequence extraction: The phage elution buffer from the second or third round of panning is used to inoculate phages, and single clones are selected for expression and verification of their affinity for the target antigen. The antigen-antibody complex is detected by ELISA to confirm their binding ability and affinity. After confirming its specificity, the phages of positive clones are amplified, and their DNA is extracted and Sanger sequencing is performed to obtain the gene sequence of the nanobody.

[0079] (8) Nanobody dimerization: Two homologous VHH genes are tandemly linked using a flexible linker peptide (such as (G4S)3) to construct a dual binding site. This utilizes affinity effects (synergistic binding) to enhance binding strength and neutralization capacity, while retaining the advantages of small molecular weight and stability. Divalent modification, by mimicking the tandem connection of natural VHH sequences, not only retains the small molecular weight advantage of nanobodies but also overcomes the bottleneck of monovalent binding strength, making it a core strategy for developing highly effective therapeutic antibodies.

[0080] (9) Antibody-antigen affinity assay: An important indicator for assessing the ability of an antibody to bind to its target (antigen), usually expressed as the dissociation constant (Kd). The lower the Kd value, the higher the affinity between the antibody and the antigen, and vice versa. The most commonly used affinity assay methods include enzyme-linked immunosorbent assay (ELISA), surface plasmon resonance (SPR), and biomembrane interferometer (BLI). These techniques can effectively monitor the kinetics and thermodynamic properties of antibody-antigen interactions.

[0081] In some embodiments, the MPP1 binding protein is single-specific, bispecific, or multispecific.

[0082] In some embodiments, the MPP1 binding protein is a heavy chain antibody; exemplarily, the heavy chain antibody also comprises IgG1 Fc.

[0083] The amino acid sequence and structure of the nanobody in this application may be considered—but not limited thereto—to contain four frame regions or “FRs,” referred to in the art and herein as “frame region 1” or “FR1”; “frame region 2” or “FR2”; “frame region 3” or “FR3”; and “frame region 4” or “FR4”, respectively; these frame regions are interrupted by three complementarity-determining regions or “CDRs,” referred to in the art as “complementarity-determining region 1” or “CDR1”; “complementarity-determining region 2” or “CDR2”; and “complementarity-determining region 3” or “CDR3”, respectively.

[0084] In some embodiments, the MPP1 binding protein is a nanobody; exemplaryly, the nanobody comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in any one of SEQ ID NO: 1-8.

[0085] As further described in this application, the total number of amino acid residues in a nanobody can be in the range of 120-150. However, it should be noted that there are no particular limitations on the length and / or size of the portions, fragments, analogs, or derivatives of nanobodies (as further described herein), provided that such portions, fragments, analogs, or derivatives meet the further requirements outlined herein and are also preferably suitable for the purposes described herein.

[0086] The amino acid residues of nanobodies are based on those given by Kabat et al. (“Sequence of protein of immunological interest”, US Public Health Services, NIH Bethesda, MD, Publication No. 91). H The domains are numbered using common identifiers, such as those used by Riechmann and Muyldermans, J. Immunol. Methods 231, 25-38 (1999) for V in camels. HH Domains. In this regard, it should be noted—as is discussed in this field regarding V—that... H Domain and for V HHAs is well known in domains—the total number of amino acid residues in each CDR can vary and may not correspond to the total number of amino acid residues indicated by the Kabat number. That is, one or more positions according to the Kabat number may not occupy the actual sequence, or the actual sequence may contain more amino acid residues than the Kabat number allows. This means that, generally, the Kabat number may or may not correspond to the actual number of amino acid residues in the actual sequence.

[0087] Unless otherwise specified, the terms "specific recognition," "selective binding," "selectively binding," and "specifically binding," or similar expressions used in this application, refer to the binding of a binding protein to an epitope on a pre-determined antigen. Typically, the binding protein binds at a rate of approximately less than 10... -5 M, for example, approximately less than 10 -5 M, 10 -6 M, 10 -7 M, 10 -8 M, 10 -9 M or 10 -10 Mutual binding (M) or lower KD values ​​are required. The KD value of an antibody can be determined using methods well-established in the art. Other standard assays for evaluating the binding ability of ligands, such as antibodies, to targets are known in the art, including, for example, ELISA, Western blotting, RIA, and flow cytometry. An epitope refers to a specific atomic group (e.g., sugar side chain, phosphoryl group, sulfonyl group) or amino acid on an antigen that binds to an antibody.

[0088] In this application, the terms "KD" and "K" are used interchangeably. D The terms "KD" and "KD" are used interchangeably and generally refer to the equilibrium dissociation constant. "KD" is the ratio of the dissociation rate constant (kdis, also known as "off-rate" (koff) or "kd") to the binding rate constant (kon, also known as "binding" (kon) or "ka"). The binding rate constant (kon), dissociation rate constant (kdis), and equilibrium dissociation constant (KD) can be used to represent the binding affinity of an antibody to an antigen. Methods for determining the binding and dissociation rate constants are well known in the art and include, but are not limited to, biomembrane interferometry (BLI), radioimmunoassay (RIA), equilibrium dialysis, surface plasmon resonance (SPR), fluorescence resonance energy transfer (FRET), co-immunoprecipitation (Co-IP), and protein chip technology. The affinity of a particular protein-protein interaction may vary depending on the conditions measured (e.g., salt concentration, pH).

[0089] Unless otherwise specified, the term "variable region" or "variable domain" in this application refers to the amino-terminal domain of the antibody's heavy or light chain that recognizes and binds to antigens. The composition and arrangement of the amino acids in this region determine the antibody's specificity in recognizing antigens. The heavy chain variable domain may be referred to as "VH." The light chain variable domain may be referred to as "VL." Variable domains contain antigen-binding sites. The variable regions of both the heavy and light chains consist of three complementarity-determining regions (CDRs) (also known as hypervariable regions) connected by four framework regions (FRs). The extent of the backbone region and CDRs has been precisely defined, for example, in Kabat (see Sequences of Proteins of Immunological Interest, E. Kabat et al.) and Chothia. Any CDR determination method well-known in the art, including combinations of methods, can identify CDRs of variable domains. CDRs in each chain are held together closely by FRs to form variable regions. Typically, the variable regions VL / VH of the heavy and light chains can be obtained by linking the following numbered CDRs with FRs in the following combination: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.

[0090] In some embodiments, the immunoglobulin single variable domain comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in any one of SEQ ID NO: 1-8.

[0091] In another aspect of this application, a nucleic acid molecule is provided that encodes the MPP1 binding protein as described above.

[0092] In some embodiments, the nucleic acid molecule is DNA.

[0093] Unless otherwise specified, the nucleic acid molecules in this application may be isolated nucleic acid molecules. The nucleic acid molecules in this application primarily refer to isolated nucleic acid molecules. "Isolated" means that the molecule is substantially free of other biomolecules, such as nucleic acids, proteins, lipids, carbohydrates, or other materials, such as cell debris and growth media. Generally, the term "isolated" is not intended to mean the complete absence of these materials or the absence of water, buffer solutions, or salts.

[0094] Another aspect of this application provides a recombinant expression vector comprising the nucleic acid molecules described above.

[0095] The term "vector," also known as a "nucleic acid construct," refers to a nucleic acid molecule capable of transporting another nucleic acid to which it is linked. One type of vector is the "plasmid," which is a circular double-stranded DNA loop in which an additional DNA segment can be linked. Another type of vector is a viral vector, in which an additional DNA segment can be linked to a viral genome. Some vectors are capable of autonomous replication in the host cells to which they are introduced (e.g., bacterial vectors with bacterial origins of replication and free mammalian vectors). Other vectors (e.g., non-attached mammalian vectors) can integrate into the host cell's genome after introduction into the host cell and thereby replicate along with the host genome. Furthermore, some vectors are capable of directing the expression of genes to which they are effectively linked. Such vectors are referred to in this application as "recombinant expression vectors" (or simply "expression vectors"). Typically, expression vectors useful in recombinant DNA technology are in the form of plasmids. However, other forms of expression vectors, such as viral vectors (e.g., replication-defective retroviruses, adenoviruses, and adeno-associated viruses), also serve equivalent functions.

[0096] In another aspect of this application, a conjugate is provided comprising the MPP1 binding protein as described above, conjugated to a diagnostic agent or imaging agent.

[0097] The conjugated portion may be, for example, one or more detectable tags or other signal-generating groups or portions, depending on the intended use of the labeled nanobody. Suitable tags and techniques for attaching, using, and detecting nanobodies are clear to those skilled in the art, and include, for example, fluorescent tags (e.g., fluorescein, isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, phthalaldehyde, and fluorescein amines) and, for example, fluorescein amines. 152 Fluorescent metals of Eu or other lanthanides), phosphorescent tags, chemiluminescent tags, or bioluminescent tags (e.g., lumina, isoluminol, thermoacridone ester, imidazole, acridine onion salts, oxalates, dioxane, or GFP and their analogues), radioactive isotopes (e.g., lumina, isoluminol, thermoacridone esters, imidazole, acridine onion salts, oxalates, dioxane, or GFP and their analogues), radioactive isotopes (e.g., lumina, isoluminol ... 3 H, 125 I, 32 P, 35 S, 14 C 51 Cr 36 Cl、 57 Co、 58 Co、 59 Fe, and 75 Se), metal, metal chelate, or metal cation (e.g., metal cation, e.g.) 99 mTc, 123 I, 111 In、 131 I, 97 Ru、 67Cu、 67 Ga, and 68 Ga or other metals or metal cations particularly suitable for in vivo, in vitro, or in situ diagnostics and imaging, such as... 157 Gd, 55 Mn, 162 Dy、 52 Cr, and 56 Fe), as well as chromophores and enzymes (such as malate dehydrogenase, staphylococcal nuclease, δ-V-steroid isomerase, yeast alcohol dehydrogenase, α-glycerol phosphate dehydrogenase, triose phosphate isomerase, biotin peroxidase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, β-galactosidase, ribonuclease, urease, catalase, glucose-VI-phosphate dehydrogenase, glucosylamylase, and acetylcholinesterase). Other suitable labels are clear to a technician, such as those including portions that can be detected using NMR or ESR spectroscopy.

[0098] In another aspect of this application, compositions are provided comprising the MPP1 binding protein as described above, the nucleic acid molecule as described above, the recombinant expression vector as described above, the cell as described above, or the conjugate as described above.

[0099] Another aspect of this application provides the use of the MPP1 binding protein as described above, the nucleic acid molecule as described above, the recombinant expression vector as described above, the cell as described above, the conjugate as described above, or the composition as described above.

[0100] Exemplary uses include, but are not limited to, non-diagnostic and therapeutic detection of Mycoplasma pneumoniae or MPP1, diagnostic and therapeutic detection of Mycoplasma pneumoniae or MPP1, preparation of products for the diagnosis and / or auxiliary diagnosis of Mycoplasma pneumoniae infection, preparation of products for the detection of Mycoplasma pneumoniae or MPP1, preparation of products for the isolation, enrichment and / or purification of Mycoplasma pneumoniae or MPP1, and preparation of products for the isolation, enrichment and / or purification of Mycoplasma pneumoniae or MPP1.

[0101] In some embodiments, the Mycoplasma pneumoniae infection includes Mycoplasma pneumoniae pneumonia.

[0102] In some embodiments, the detection of Mycoplasma pneumoniae or MPP1 (e.g., for non-diagnostic and therapeutic purposes or for diagnostic and therapeutic purposes) includes contacting the MPP1 binding protein and / or conjugate as described above with the sample to be tested.

[0103] Another aspect of this application provides a kit for detecting MPP1 or Mycoplasma pneumoniae, comprising at least one of the MPP1 binding protein and conjugates as described above.

[0104] Another aspect of this application provides a method for preparing the MPP1 binding protein as described above, the method comprising:

[0105] Culture the cells as described above to prepare a culture;

[0106] MPP1 binding protein was isolated from the culture.

[0107] The following are some examples.

[0108] The embodiments of this application will be described in detail below with reference to examples. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of this application. For experimental methods in the following embodiments where conditions are not specified, reference should be made to the guidelines given in this application, or to experimental manuals or conventional conditions in the art, or to the conditions recommended by the manufacturer, or to experimental methods known in the art.

[0109] Example 1

[0110] 1. Preparation of MPP1 protein

[0111] 1) The DNA sequence encoding the viral antigen (Q00013) was inserted into the pET28a vector using molecular cloning technology, and the six consecutive histidine (his) residues of the vector were used as affinity purification tags.

[0112] 2) Transform the recombinant MPP1 plasmid into the Escherichia coli BL21(DE3) expression system, pick single colonies and inoculate them into 25 mL of LB medium, and incubate overnight at 37 °C.

[0113] 3) The next day, transfer the culture to 1.5L of LB medium for scale-up culture. When the bacterial culture OD... 600 When the concentration reaches 0.8, add IPTG inducer to a final concentration of 0.4 mM and continue incubation overnight at 16 °C. Collect the cell pellet by centrifugation at 8000 rpm for 10 min and remove the supernatant.

[0114] 4) Resuspend the cell pellet in 50 mL of 1 × PBS buffer and sonicate at 260 W for 30 min.

[0115] 5) Centrifuge at 8000-10000 rpm for 10 min and collect the supernatant. Filter the supernatant through a 0.45 μm filter membrane and incubate the filtered supernatant with an equilibrated nickel affinity chromatography column to bind the target protein.

[0116] 6) Optimize the use of different concentrations of imidazole elution buffer to remove non-specifically bound proteins and improve the purity of the target protein. For example, use 3-5 column volumes of 20 mM imidazole elution buffer to remove weakly bound proteins; then use 3-5 column volumes of 50 mM imidazole elution buffer for further washing to remove proteins with moderate affinity. Use incrementally increasing concentrations of imidazole elution buffer to obtain the best protein elution effect, such as using 3-5 column volumes of 100 mM, 150 mM, 200 mM, and 250 mM, respectively, and collect the eluent to concentrate and enrich the protein.

[0117] 7) Concentrate the target protein eluted at 250 mM using a 50 kDa ultrafiltration tube, centrifuge at 8000 rpm for 15-30 min, and measure the protein concentration.

[0118] 8) See electrophoresis results. Figure 1 The size was consistent with expectations. The measured concentration was approximately 1 mg / mL, and the sample was aliquoted and stored at -80 °C.

[0119] 2. Alpaca Immunization

[0120] 1) The purified MPP1 antigen was emulsified with Freund's adjuvant at a 1:1 ratio and used to immunize different sites under the neck of alpacas. A multi-site, multiple-immunization strategy was adopted, with immunizations performed every two weeks for a total of four immunizations.

[0121] 2) Within one week after the fourth immunization, 200 mL of peripheral blood was collected from the alpaca. Peripheral blood mononuclear cells (PBMCs) were separated by Ficoll density gradient centrifugation. After washing with 3-5 volumes of 1×PBS buffer, the cell pellet was collected by centrifugation at 2000 rpm for 5 min. The cell pellet was resuspended in 3 mL of 1×PBS buffer, and cell counting was performed. The total count was 2.1 × 10^ 8 Each cell.

[0122] 3) Antigen-specific labeling of B cells: MPP1 antigen was labeled with 488 fluorescein molecules and incubated with PBMC cells on ice in the dark for 30 min. The cells were washed twice with PBS to prepare flow cytometry samples. Unstained cells were used as a negative control. Positive cells were collected by excitation with a 488 nm laser. The sorted positive cells were centrifuged at 1200 rpm for 5 min to collect the precipitate.

[0123] 4) RNA extraction and cDNA reverse transcription

[0124] 10 mL of Lysis buffer was added to PBMC cells, vortexed to mix, and placed on ice for lysis for 5 min. The cells were then centrifuged at 12000 rpm for 5 min. The supernatant was collected and added to an RNA extraction column for RNA adsorption and elution to obtain total RNA, with a concentration of approximately 800-1200 ng / μL. RNA integrity was verified using a nucleic acid gel. 3-5 μg of RNA was reverse transcribed into cDNA using the SuperScript II reverse transcriptase kit (Invitrogen™, Cat#18064014). The reaction system is shown in Tables 1 and 2.

[0125] Table 1 Reverse transcription reaction system 1

[0126]

[0127] Table 2 Reverse transcription reaction system 2

[0128]

[0129] For reverse transcription reaction system 1 in Table 1, after thorough mixing, incubate at 72°C for 3 min and place on ice. For reverse transcription reaction system 2 in Table 2, after thorough mixing, incubate at 25°C for 5 min, then react at 42°C for 60 min; followed by reacting at 50°C for 30 min; finally, terminate the reaction at 70°C for 10 min. After the reaction is complete, store at 4°C. The synthesized cDNA can be stored at -20°C for subsequent experiments.

[0130] 5) VHH antibody gene acquisition

[0131] Specific primers were designed, and the VHH antibody gene was amplified by two rounds of nested PCR to obtain the VHH band (approximately 400 bp). See [link to documentation]. Figure 2 The target band was recovered by gel extraction, and the integrity and purity of the VHH antibody library were detected by nucleic acid electrophoresis. The concentration of the VHH library was determined by a Qubit 4 fluorescence quantitative PCR instrument.

[0132] The VHH antibody PCR reaction system is shown in Table 3, and the PCR procedure is shown in Table 4.

[0133] Table 3 Reaction System

[0134]

[0135] Table 4 Reaction System Conditions

[0136]

[0137] See the diagram of the nucleic acid amplification of the VHH gene by primer PCR. Figure 2, where 1-6 represent different primer combinations for PCR amplification of the VHH antibody gene.

[0138] 6) Enzyme digestion of the phage vector: The phage vector pMES4 was double-digested using NcoI and Eco91I restriction endonucleases (e.g., Figure 3 (As shown). Electrophoretic gel recovery was then performed to prepare a linear support (4460 bp) with a concentration of approximately 100 ng / μL.

[0139] Table 5 Reaction solution system for NcoI and Eco91I enzyme digestion

[0140]

[0141] 7) Homologous recombination reaction: Using homologous recombination technology, the linear vector pMES4 and the VHH library fragment were mixed at a molar ratio of 1:4, with a total DNA amount of 1 μg. Homologous recombination was performed using 2 × SeamLess Mix (Biomed, Cat#CL117-01) at 50℃ for 30 min. Finally, the ligation product was recovered using a standard PCR product recovery kit (Tiangen, Cat#DP204), and the concentration was measured to be approximately 50 ng / μL.

[0142] Table 6 Connection Reaction System

[0143]

[0144] 3. Screening of MPP1 nanobodies

[0145] Steps for phage screening

[0146] 1) Dilute the homologous recombination ligation product with sterile water to 40 ng / μL, and electroporate 5 μL of ligation product per competent cell for a total of 4 TG1 cells.

[0147] 2) Before electroporation, preheat 10 mL of SOC medium at 37°C and prepare 8 x 150 mm anodes. 2 2YT-GA plates (containing 2% glucose and 100 μg / mL ampicillin) and four 90 mm agar plates. 2 2YT-GA plates were used. Simultaneously, 0.1 cm electroporation cups and ligation products were pre-cooled on ice, and four TG1 competent cells were thawed on ice.

[0148] 3) Transfer TG1 cells to an electroporation cuvette, add 5 μL of ligation product and electroporate. The electroporation parameters are set as follows: voltage 1.8 kV, pulse duration 10 μF, and impedance 600 Ω.

[0149] 4) After electroporation, TG1 cells were transferred to SOC medium and incubated at 37°C and 250 rpm for 1 hour. Subsequently, after centrifugation at 5000 rpm for 1 min, the supernatant was discarded, and the cell pellet was resuspended in 1 mL of medium. 1 μL of the bacterial culture was serially diluted 10-fold to a final volume. -1 10 -2 10 -3 10 -4 10 -5 and 10 -6 10 -3 10 -4 10 -5 and 10 -6 Take 100 μL of each grade of bacterial suspension and spread it to a depth of 90 mm. 2 The volume was determined on 2YT-GA plates. 1 mL of culture medium was added to the remaining bacterial culture, and then 250 μL was spread onto 150 mm thick plates. 2 2YT-GA plates. Place the plates in an incubator at 37°C and incubate upside down overnight.

[0150] 5) On the second day, from 90mm 2 Ten colonies were picked from a 2YT-GA plate, transferred to 2YT-A medium, and sequenced to detect sequence diversity. The final actual library volume was 2 x 10^6. 8 A phage display bacterial library.

[0151] 6) Collect 150 mm of 2YT-Amp medium. 2 All colonies on the 2YT-GA plate were measured, and OD was measured. 600 value.

[0152] 7) Add 5 OD of bacterial culture to 50 mL of 2YT-GA medium and incubate at 37℃ and 250 rpm until OD reaches 0.5. 600 ≈0.6. Then, add approximately 6 x 10⁻⁶. 11 PFU M13K07 helper phage particles (bacteria to helper phage particles ratio of 1:10 to 1:20) were incubated at 37°C and 250 rpm for 30 min and then transferred to 50 mL centrifuge tubes.

[0153] 8) After centrifuging at 5000 rpm for 8 min, remove the supernatant, resuspend the cells in 50 mL of 2YT-Amp-Kan-IPTG (Amp 100 μg / mL, Kan 50 μg / mL, 1 mM IPTG) medium in a 250 mL culture flask, and express the cells overnight at 28 °C and 250 rpm.

[0154] 9) On day 3, the expressed phage particles were collected using PEG / NaCl precipitation technology, and 1 μL was serially diluted and used to infect TG1 cells to detect their titer.

[0155] Panning: Following solid-phase panning techniques, the amplified phage particles underwent three rounds of panning. The concentrations of Mycoplasma pneumoniae P1 protein (MPP1) binding protein used in each round were set to 15 μg / mL, 7.5 μg / mL, and 3 μg / mL, respectively. The amount of phage particles added in each round was approximately 1 x 10^6 12 pfu.

[0156] 10) During the screening process, MPP1 protein was diluted to the screening concentration using coating buffer and added to the microplate at 100 μL / well (10 wells per round of coating, and 2 negative control wells were prepared with PBS added). The plate was coated overnight at 4°C to ensure full binding.

[0157] 11) The next day, seal with 5% PBSM (skimmed milk powder) for 2 hours, approximately 1 x 10^ 12 Pfu phage was diluted to 1.2 mL with PBSM and added to an ELISA plate at a rate of 100 μL / well. The plate was incubated at 37°C for 1 h to specifically capture the phage.

[0158] 12) After incubation, discard the unbound phage liquid, wash with 0.05% PBST (10 washes in the first round, 15 washes in the second round, and 20 washes in the third round), pat dry, add 100 μL of 0.2 M glycine (pH 2.5) elution buffer to each well, incubate at room temperature for 10 min, collect the elution buffer into a 1.5 mL centrifuge tube, and immediately add 1 M Tris-HCl (pH 9.0) for neutralization.

[0159] 13) At the same time, prepare OD 600 Fresh TG1 cells with a titer of approximately 0.6. 10 μL of elution buffer was serially diluted 10-fold to infect TG1 cells. For each dilution, 5 μL of the bacterial culture was added to a 2YT-GA plate to determine the elution titer.

[0160] 14) In addition, 900 μL of elution buffer was used to inoculate 5 mL of TG1 cells and spread to a depth of 150 mm. 2 Place the 2YT-GA plates on an incubator at 37°C and invert them overnight.

[0161] 15) On the second day, repeat the phage amplification steps to carry out the next round of phage amplification and expression.

[0162] 4. Identification of positive clones and sequence extraction

[0163] 1) The second and third rounds of elution buffer were serially diluted and used to infect TG1 cells, which were then plated onto 2YT-GA plates. The next day, single clones were selected from the plates and transferred to 250 μL of 2YT-Amp medium (using a 96-well deep-well plate). After incubation at 37°C and 250 rpm for 3 hours, 50 μL of the bacterial culture was collected and stored for subsequent experiments.

[0164] 2) Add approximately 3 x 10^ mg of the solution to 200 μL of bacterial culture. 9 The M13K07 helper phage of PFU was incubated at 37°C and 250 rpm for 30 min to promote the adsorption and infection of the helper phage.

[0165] 3) Subsequently, antibiotics (kanamycin) were added to the bacterial culture to a final concentration of 50 μg / mL, and IPTG was added to a final concentration of 1 mM. The culture flasks were then incubated overnight at 28°C and 250 rpm to express the recombinant phage.

[0166] 4) On the third day, the supernatant of the expressed phage was collected by centrifugation at 4000 rpm for 10 min and single-clone identification was performed using the ELISA method.

[0167] 5) Select OD from the experimental group 450 For samples with an OD value greater than 0.5, the negative control's OD value should also be confirmed. 450 A negative result was obtained to ensure that the selected phage could specifically bind to the MPP1 protein. Subsequently, next-generation sequencing was used for sequencing and antibody sequence analysis.

[0168] 5. Nanobody expression and purification:

[0169] 1) Plasmid transformation: Add 1 μL (300 ng / μL) of the positive clone plasmid to E. coli competent cells BL21(DE3), incubate on ice for 30 min, heat shock at 42℃ for 90 s, then place on ice for 2-3 min. Add 1 mL of antibiotic-free 2YT liquid medium, incubate at 37℃ with shaking at 200 rpm for 1 h, centrifuge at 200 rpm for 5 min, discard the supernatant, resuspend the cells in 200 μL of antibiotic-free 2YT medium, and plate 100 μL onto a culture plate containing ampicillin antibiotics. Incubate at 37℃ upside down for 16-18 h.

[0170] 2) Shaking inoculum: Pick a single clone and inoculate it into 5 mL of 2YT medium containing ampicillin resistance. Incubate at 37°C and 200 rpm with shaking for 4-5 hours. When OD... 600 When the value reaches 0.6-0.8, inoculate into 200mL of 2YT / Amp medium at a ratio of 1:50.

[0171] 3) Inducing antibody expression: When the OD of E. coli... 600When the growth rate reaches 0.4-0.6 (logarithmic growth phase), cool the culture system to 16℃, add IPTG to a final concentration of 0.4-1.0 mM, and induce at 16℃ and 200 rpm for 16-18 h.

[0172] 4) Cell collection and lysis: Collect cells by centrifugation at 8000 rpm and 4℃ for 5-10 min. Resuspend cells in 10 mL shock solution and lyse at 4℃ for 2 h with shaking. Add an equal volume of 30% sucrose solution, vortex to mix, and continue shaking at 4℃ for 2 h. Centrifuge at 8000 rpm and 4℃ for 20 min and collect the supernatant.

[0173] 5) Nanobody purification: Equilibrate the nickel ion affinity chromatography column with 5 column volumes of deionized water and binding buffer. After loading the supernatant onto the column, elute sequentially with elution buffers containing 20 mM, 50 mM, and 100 mM imidazole, and finally elute the target protein with 250 mM imidazole.

[0174] 6) SDS-PAGE characterizes antibody purity and size: such as Figure 4 The nanobody shown is approximately 15 kDa in size and has a purity of ≥90%, consistent with the expected results, indicating successful expression and purification of the nanobody.

[0175] 6. Nanobody affinity characterization:

[0176] Using a surface plasmon resonance (SPR) instrument, multi-cycle kinetic assays (starting at 2 μM with 2-fold serial dilutions, for a total of 6 concentrations) were performed to characterize the binding ability of VHH antibody to the antigen. Preliminary antibody affinity assay data can be found in [link to relevant documentation]. Figure 5 See Table 7-1.

[0177] Table 7-1. Affinity detection results of MPP1 nanobodies

[0178]

[0179] Table 7-2. Amino acid sequences of CDR1, CDR2 and CDR3 of MPP1 nanobodies

[0180]

[0181] Table 7-3. Amino acid sequence of VHH in MPP1 nanobody

[0182]

[0183] 7. Construction of nanobody dimer plasmids

[0184] 1) Design specific primers to amplify nanobody fragments

[0185] F1:TACTCGCGGCCCAGGCCATGGCCCAGGTGCAGCTCG (SEQ ID NO: 33),

[0186] R1:CCAGAGCCACCTCCGCCTGAACCGCCTCCACCTGAGGAGACGGTGACC (SEQ ID NO: 34),

[0187] F2:CGGAGGTGGcTCTGGCGGTGGCGGATCGCAGGTGCAGCTCGTGGAG (SEQ ID NO: 35),

[0188] R2:GTGGTGTGAGGAGACGGTGACCTGGGTCCCCTG (SEQ ID NO: 36).

[0189] 2) PCR (Polymerase Chain Reaction) is a technique for selectively and rapidly amplifying specific DNA fragments in vitro. Its core principle is to simulate the semi-conservative replication process of DNA through temperature-controlled cyclic reactions. This technique is widely used in gene detection, molecular cloning, and pathogen diagnosis. The reaction system and conditions are shown in Tables 8 and 9, respectively.

[0190] Table 8. PCR reaction system

[0191]

[0192] Table 9. PCR reaction conditions

[0193]

[0194] 3) DNA gel electrophoresis is a separation technique based on molecular charge and molecular sieving effects. DNA molecules of different sizes carry a negative charge in an alkaline buffer and migrate towards the anode under an applied electric field. PCR products are mixed with bromophenol blue loading buffer and electrophoresed at a constant voltage of 120-150 V for 30 minutes. Fluorescently labeled DNA bands are observed using a UV imaging system (see [link to article]). Figure 6 ).

[0195] 4) DNA gel cutting and purification

[0196] DNA fragments were separated by agarose gel electrophoresis, the target bands were located by a UV imaging system, and the gel block of the target area was quickly excised.

[0197] 4.1) Add 1-1.5 times the volume of Binding Buffer, heat in a 55 ℃ water bath until the gel is completely dissolved, add 650-700 μL to each HiBind DNA column, mix thoroughly and let stand at room temperature for 2-3 min to allow the DNA to fully bind to HiBind.

[0198] 4.2) Centrifuge at 10,000 rpm for 1 min, discard the filtrate, put the column back into the collection tube, add 300 μL Binding Buffer, centrifuge at 10,000 rpm for 1 min, and discard the filtrate;

[0199] 4.3) Reassemble the column into the collection tube, add 700 μL of SPW Wash Buffer, centrifuge at 10,000 rpm for 1 min, and discard the filtrate (repeat this step once).

[0200] 4.4) Reassemble the column into the collection tube, centrifuge at 13000 rpm for 3 min to thoroughly dry the column matrix. Allow to stand at room temperature for 3-5 min to evaporate any remaining moisture.

[0201] 4.5) Load the column into a clean 1.5 mL centrifuge tube, add 30-50 μL of preheated 55 °C Elution Buffer to the column, and let it stand at room temperature for 2 min. Centrifuge at 13000 rpm for 2 min to elute the DNA.

[0202] 4.6) The concentrations were determined using Nanodrop: the recovered concentrations of fragment 1 (Mpp1-12, Mpp1-2D10, Mpp1-5C12, and Mpp1-1A1) were 59, 91, 73, and 55 ng / μL, respectively; the recovered concentrations of fragment 2 (Mpp1-12, Mpp1-2D10, Mpp1-5C12, and Mpp1-1A1) were 94, 63, 79, and 100 ng / μL, respectively.

[0203] 5) pMES4 vector digestion

[0204] 5.1) The phage vector pMES4 was double-digested with NcoI and Eco91I restriction endonucleases and the linear vector (4839 bp) was prepared by gel recovery.

[0205] The enzyme digestion system is shown in Table 10 below.

[0206] Table 10. Enzyme digestion reaction system

[0207]

[0208] 5.2) DNA Nucleic Acid Gel Electrophoresis: The enzyme digestion products are mixed with bromophenol blue loading buffer, and electrophoresis is performed at a constant voltage of 120-150 V for 30 min. The fluorescently labeled DNA bands are observed using a UV imaging system. Figure 7 As shown.

[0209] The digested vector was recovered by gel extraction, and the concentration was determined by Nanodrop. The concentration of pMES4 vector was 130 ng / μL.

[0210] 6) Connection

[0211] Homologous recombination ligation was performed between the pMES4 linear vector and the target fragment (biomed, 2 × SeamLess Mix, Cat#CL117-01). The ligation system is shown in Table 11. The reaction was carried out at 50 °C for 15 min, and the reaction was then placed on ice.

[0212] Table 11. Homologous recombination linkage reaction system

[0213]

[0214] 7) Transformation of Escherichia coli

[0215] 7.1) Add the ligation product to the Top10 competent cells of E. coli clones, place on ice for 30 min, heat shock at 42°C for 90 s, and then place on ice;

[0216] 7.2) Add 1 mL of antibiotic-free LB medium, incubate at 37℃ and 200 rpm for 1 h, centrifuge at 2500 rpm for 5 min, discard the supernatant, add 200 μL of antibiotic-free LB medium, and mix well.

[0217] 7.3) Take 100 μL and spread it on an ampicillin-resistant culture plate, invert it and place it in a 37°C incubator overnight.

[0218] 7.4) The following day, select a single clone and incubate it in 1 mL of ampicillin-resistant medium for 4-5 hours. Perform colony PCR identification and send the clones for sequencing and analysis. See [link to relevant documentation]. Figure 8 The positive clones were then subjected to further sequencing verification.

[0219] 8. Dimerization expression and purification of nanobodies

[0220] 1) Plasmid transformation: Add 1 μL (400 ng / μL) of recombinant plasmid to BL21(DE3) competent cells, place on ice for 30 min, heat shock in a 42℃ water bath for 90 s, then place on ice for 2-3 min. Add 1 mL of antibiotic-free 2YT medium, incubate at 37℃ and 200 rpm for 1 h, centrifuge at 2500 rpm for 5 min, remove the supernatant, add 200 μL of antibiotic-free 2YT medium, mix well, and take 100 μL to spread on a culture plate containing ampicillin resistance, and incubate upside down at 37℃ for 16-18 h.

[0221] 2) Shaking culture: Pick a single clone of bacteria and inoculate it into 5 mL of 2YT medium containing ampicillin resistance and culture for 4-5 h, then inoculate it into 200 mL of 2YT / Amp medium at a 1:50 ratio.

[0222] 3) Induced expression: When the OD of E. coli... 600 When the concentration reaches 0.4-0.6, cool the culture medium to 16℃, add IPTG to a final concentration of 0.4-1.0 mM, and induce at 16℃ and 200 rpm for 16-18 h.

[0223] 4) Cell collection and lysis: Collect cells by centrifugation at 8000 rpm and 4 ℃ for 5-10 min. Resuspend in 10 mL shock solution and lyse at 4 ℃ with shaking for 2 h; add an equal volume of 30% sucrose solution, vortex to mix, and continue shaking at 4 ℃ for 2 h, then collect the supernatant by centrifugation at 8000 rpm for 20 min.

[0224] 5) Nanobody purification: Equilibrate the nickel column with 5 column volumes of deionized water and binding buffer. After loading the supernatant onto the column, elute the impurities with a gradient of elution buffers containing 20 mM, 50 mM, and 100 mM imidazole. Finally, elute the target protein with 250 mM imidazole.

[0225] 6) Concentration and SDS-PAGE Verification: The eluent was concentrated using a 10 kDa ultrafiltration tube and then replaced with PBS buffer at pH 7.4. The protein concentration was determined to be approximately 1 mg / mL using Nanodrop. Purity and dimer molecular weight were verified by 12% SDS-PAGE electrophoresis. Figure 9 As shown.

[0226] 9. Antibody affinity detection:

[0227] Using a surface plasmon resonance (SPR) instrument, multi-cycle kinetic assays (starting at 2 μM with 2-fold serial dilutions, for a total of 6 concentrations) were performed to characterize the binding ability of VHH antibody to the antigen, and preliminary screening of antibody affinity assay data was conducted. (See [link to relevant documentation]). Figure 10 And Table 12.

[0228] Table 12. Comparison of affinity data for different forms of nanobodies

[0229]

[0230] Conclusion: The binding constant ka of the bivalent nanobodies was approximately 5 times higher than that of the monovalent nanobodies, indicating that bivalent modification significantly enhanced the antibody-antigen binding rate. However, the kd value of the bivalent nanobodies did not change significantly, and there was no significant enhancement in antigen-antibody stability. Comprehensive analysis showed that the significant increase in ka value resulted in an affinity constant KD (KD = kd / ka) lower than that of the corresponding monovalent VHH antibody. This suggests that bivalent modification can improve overall affinity through a synergistic binding effect, but the degree of synergistic effect is limited.

[0231] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0232] The embodiments described above are merely illustrative of several implementation methods of this application, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this application, and these all fall within the protection scope of this application. Therefore, the protection scope of this patent application should be determined by the appended claims, and the specification and drawings can be used to interpret the content of the claims.

Claims

1. A Mycoplasma pneumoniae P1 protein (MPP1) binding protein, characterized in that, It includes an immunoglobulin single variable domain, wherein the immunoglobulin single variable domain comprises CDR1, CDR2 and CDR3 contained in VHH as shown in any one of SEQ ID NO: 1 to 8.

2. The MPP1 binding protein as described in claim 1, characterized in that, The CDR1, CDR2, and CDR3 are encoded according to Kabat, and: (1) The CDR1 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 9; the CDR2 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 10; and the CDR3 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO:

11. (2) The CDR1 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 12, the CDR2 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 13, and the CDR3 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 14; (3) The CDR1 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 15, the CDR2 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 16, and the CDR3 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 17; (4) The CDR1 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 18, the CDR2 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 19, and the CDR3 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 20; (5) The CDR1 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 21, the CDR2 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 22, and the CDR3 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 23; (6) The CDR1 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 24; the CDR2 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 25; and the CDR3 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO:

26. (7) The CDR1 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 27; the CDR2 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 28; and the CDR3 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 29; or (8) The CDR1 comprises an amino acid sequence having at least 85%, at least 90%, at least 95% or 100% identity with the amino acid sequence shown in SEQ ID NO: 30, the CDR2 comprises an amino acid sequence having at least 85%, at least 90%, at least 95% or 100% identity with the amino acid sequence shown in SEQ ID NO: 31, and the CDR3 comprises an amino acid sequence having at least 85%, at least 90%, at least 95% or 100% identity with the amino acid sequence shown in SEQ ID NO:

32.

3. The MPP1 binding protein as described in claim 1 or 2, characterized in that, The immunoglobulin single variable domain comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity with the amino acid sequence shown in any one of SEQ ID NO: 1-8.

4. The MPP1 binding protein according to any one of claims 1 to 3, characterized in that, The MPP1 binding protein meets one or more of the following conditions: 1) The MPP1 binding protein is monovalent, bivalent, or multivalent; 2) The MPP1 binding protein is single-specific, dual-specific, or multi-specific; 3) The MPP1 binding protein is a heavy chain antibody; optionally, the heavy chain antibody further comprises IgG1 Fc; and, 4) The MPP1 binding protein is a nanobody; optionally, the nanobody comprises an amino acid sequence having at least 85%, at least 90%, at least 95% or 100% identity with the amino acid sequence shown in any one of SEQ ID NO: 1 to 8.

5. A nucleic acid molecule, characterized in that, It encodes the MPP1-binding protein as described in any one of claims 1 to 4; Optionally, the nucleic acid molecule is DNA.

6. A recombinant expression vector, characterized in that, It comprises the nucleic acid molecule as described in claim 5; Optionally, the recombinant expression vector is a prokaryotic expression vector or a eukaryotic expression vector.

7. A cell, characterized in that, It comprises at least one of the nucleic acid molecule as described in claim 5 and the recombinant expression vector as described in claim 6; Optionally, the cell is a prokaryotic cell or a eukaryotic cell, such as a mammalian cell.

8. A conjugate, characterized in that, It contains the MPP1 binding protein as described in any one of claims 1 to 4, which is conjugated to a diagnostic agent or imaging agent.

9. A composition comprising the MPP1 binding protein of any one of claims 1 to 4, the nucleic acid molecule of claim 5, the recombinant expression vector of claim 6, the cell of claim 7, or the conjugate of claim 8.

10. The use of the MPP1 binding protein according to any one of claims 1 to 4, the nucleic acid molecule according to claim 5, the recombinant expression vector according to claim 6, the cell according to claim 7, the conjugate according to claim 8, or the composition according to claim 9, characterized in that, The uses include: i) Testing for Mycoplasma pneumoniae or MPP1 for non-diagnostic and non-treatment purposes; ii) Prepare products for the diagnosis and / or auxiliary diagnosis of Mycoplasma pneumoniae infection; iii) Prepare products for the detection of Mycoplasma pneumoniae or MPP1; iv) Used for the isolation, enrichment and / or purification of Mycoplasma pneumoniae or MPP1; v) Prepare products for the isolation, enrichment and / or purification of Mycoplasma pneumoniae or MPP1; Optionally, the Mycoplasma pneumoniae infection includes Mycoplasma pneumoniae pneumonia; Optionally, use i) includes contacting the MPP1 binding protein as described in any one of claims 1 to 4, and / or the conjugate as described in claim 8, with the sample to be tested.

11. A kit for detecting MPP1 or Mycoplasma pneumoniae, characterized in that, It comprises at least one of the MPP1 binding protein according to any one of claims 1 to 4 and the conjugate according to claim 8.

12. A method for preparing the MPP1 binding protein as described in any one of claims 1 to 4, characterized in that, The method includes: Cultures are prepared by culturing the cells as described in claim 7; MPP1 binding protein was isolated from the culture.

Images