Plantarum LP305 and application thereof in degrading nucleosides and uric acid
By regulating the NLRP6 inflammasome signaling axis and enriching beneficial bacteria through Lactobacillus plantarum LP305, the side effects of drugs for hyperuricemia have been resolved, achieving safe and effective uric acid degradation and kidney protection, restoring intestinal flora balance, and simultaneously inhibiting key enzymes in the uric acid synthesis pathway to reduce uric acid production.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-11
- Publication Date
- 2026-06-02
AI Technical Summary
Existing drug treatments for hyperuricemia have significant side effects, and dietary interventions have poor adherence rates. Furthermore, the application of Lactobacillus plantarum in degrading uric acid and nucleosides has not been fully explored.
A strain of Lactobacillus plantarum LP305 was provided, which reduced uric acid levels in hyperuricemic mice, improved kidney damage, enriched beneficial gut microbiota, and inhibited the activity of uric acid synthesis-related enzymes by regulating the NLRP6 inflammasome signaling axis.
It effectively reduces uric acid levels in hyperuricemic mice, improves kidney damage, restores intestinal flora balance, and simultaneously inhibits key enzymes in the uric acid synthesis pathway, thereby reducing uric acid production.
Smart Images

Figure CN122128160A_ABST
Abstract
Description
Technical Field
[0001] This application relates to the technical field of Lactobacillus plantarum, specifically to a strain of Lactobacillus plantarum LP305 and its application in the degradation of nucleosides and uric acid. Background Technology
[0002] Lactobacillus plantarum ( Lactiplantibacillus plantarum As a multifunctional lactic acid bacterium, *Lactobacillus plantarum* has seen continuous and in-depth research in the food, pharmaceutical, and environmental fields in recent years, with its application potential constantly expanding. It is widely used in the production of foods such as yogurt, kimchi, and fermented sausages, producing lactic acid and volatile flavor compounds (such as diacetyl and ethanol) through sugar metabolism, thus improving the texture and taste of the products. Recent research shows that its fermentation of fruit products can significantly increase the content of antioxidant components (such as polyphenols and flavonoids) and enhance anti-inflammatory activity, providing a new direction for the development of functional foods.
[0003] In addition, *Lactobacillus plantarum* regulates the balance of gut microbiota and alleviates intestinal diseases such as diarrhea and inflammatory bowel disease (IBD) by adhering to the intestinal epithelium, competing for nutrients, and secreting antibacterial substances. Its metabolites, short-chain fatty acids (such as butyrate), can enhance intestinal barrier function and reduce intestinal permeability.
[0004] Currently, the main clinical treatments for hyperuricemia are dietary intervention and drug therapy. However, dietary intervention presents significant challenges due to poor patient compliance. Drug therapy is the most commonly used treatment for hyperuricemia, offering advantages such as rapid onset of action and a short treatment period. However, drug therapy carries substantial side effects, easily causing allergic reactions and causing considerable damage to the patient's body.
[0005] Compared to traditional drug treatments, *Lactobacillus plantarum* is a probiotic strain approved by the Ministry of Health for use in food, making it safer and without adverse reactions. For example, CN117106674A discloses a specific *Lactobacillus plantarum* strain, OPB15, which can significantly reduce the levels of uric acid (UA), creatinine (Cr), and blood urea nitrogen (BUN) in the serum of hyperuricemic mice, and increase the excretion of creatinine (Cr) and urea nitrogen (BUN) in urine. However, it does not submit whether this strain can directly degrade uric acid and nucleosides. Summary of the Invention
[0006] This application provides a strain of *Lactobacillus plantarum* (… Lactiplantibacillus plantarum) The strain is *Lactobacillus plantarum* LP305, with accession number CGMCC NO.33425. This LP305 strain was deposited on January 15, 2025, at the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.
[0007] This application also provides a composition comprising at least one or more of live, dead, inactivated, and cultured Lactobacillus plantarum LP305 cells.
[0008] An agent for reducing the expression and / or secretion levels of IL-18 in kidney tissue and / or kidney cells, comprising at least one or a mixture of live, dead, inactivated, and cultured *Lactobacillus plantarum* LP305 as described above.
[0009] An enrichment of Enterobacteriaceae spp., Trichophytonceae-UCG-006 spp. and Xanthomonas spp., comprising at least one or a mixture of live, dead, inactivated and cultured Lactobacillus plantarum LP305 as described in claim 1.
[0010] An agent that indirectly reduces IL-18 levels in isolated kidney tissue by regulating the composition of the host gut microbiota comprises at least one or more of the following: live cells, dead cells, inactivated cells, and cultures of the *Lactobacillus plantarum* LP305 strain.
[0011] An agent that simultaneously inhibits adenosine deaminase, xanthine oxidase and phosphoribosyl pyrophosphate synthase comprises at least one or a mixture of live cells, dead cells, inactivated cells and cultures of *Lactobacillus plantarum* LP305.
[0012] A food fermentation agent comprising at least one or more of the following: live cells, dead cells, inactivated cells, and cultures of *Lactobacillus plantarum* LP305.
[0013] An in vitro research tool for inhibiting the activity of uric acid synthesis-related enzymes, comprising at least one or more of the following: live cells, dead cells, inactivated cells, and cultures of *Lactobacillus plantarum* LP305.
[0014] An enzyme inhibitor screening model strain comprises at least one or more of the following: live cells, dead cells, inactivated cells, and cultures of *Lactobacillus plantarum* LP305.
[0015] The aforementioned Lactobacillus plantarum ( Lactiplantibacillus plantarum The use of LP305 in the preparation of formulations, wherein the use is selected from: Preparation of nucleoside degradation agents for the uric acid synthesis pathway, wherein the nucleoside degradation agent is at least one of in vitro degradation agents for inosine and in vitro degradation agents for guanosine; Prepare a uric acid-lowering preparation, wherein the uric acid-lowering preparation is at least one of an in vitro uric acid-lowering preparation and an in vivo uric acid-lowering preparation; Preparations of agents that reduce the expression and / or secretion levels of IL-18 in kidney tissue and / or kidney cells; Preparation of formulations enriched with Akkermansia spp., UCG-006 spp. of Trichophytonceae family and Xanthomonas spp. of the intestinal tract; Preparation of a formulation that indirectly reduces IL-18 levels in isolated kidney tissue by regulating the composition of the host gut microbiota; Prepare food additives that regulate renal IL-18 levels; Prepare ordinary food or food ingredients that have the function of regulating renal IL-18 levels; Preparation of food fermentation agents; Preparation of microbial agents for food ingredients; As a model strain for studying the regulation of the NLRP6-IL-18 axis; Screening and / or validation of renal IL-18 regulatory factors; As a quality-optimizing strain for fermented foods; As a tool bacteria for in vitro research on the inhibition of uric acid synthesis-related enzyme activity; As a model strain for screening enzyme inhibitors. Attached Figure Description
[0016] Figure 1 This is a plate graph showing the in vitro degradation of uric acid by the LP305 strain provided in the experimental example.
[0017] Figure 2 The graph shows the changes in body weight of mice in the blank control group (NC), model group (MOD), LP305 group, and ADC group during the experiment.
[0018] Figure 3 The graph shows the serum uric acid levels of mice in the blank control group (NC), model group (MOD), LP305 group, and ADC group provided in the experimental case.
[0019] Figure 4 This is a graph showing the statistical results of liver index in mice from the blank control group (NC), model group (MOD), LP305 group, and ADC group provided in the experimental case.
[0020] Figure 5 The graph shows the statistical results of the kidney index of mice in the blank control group (NC), model group (MOD), LP305 group and ADC group provided in the experimental case.
[0021] Figure 6 The graph shows the statistical results of serum creatinine levels in mice from the blank control group (NC), model group (MOD), LP305 group, and ADC group provided in the experimental case.
[0022] Figure 7 The graph shows the statistical results of blood urea nitrogen content in mice from the blank control group (NC), model group (MOD), LP305 group, and ADC group provided in the experimental case.
[0023] Figure 8 These are morphological images of kidney tissue sections from mice in the blank control group (NC), model group (MOD), LP305 group, and ADC group provided in the experimental case.
[0024] Figure 9 This is a graph showing the statistical results of the IL-18 content in the kidney tissue of mice in the blank control group (NC), model group (MOD), LP305 group, and ADC group provided in the experimental case.
[0025] Figure 10 The graph shows the statistical results of the gut microbiota α-diversity index (ACE index) of mice in the blank control group (NC), model group (MOD), LP305 group and ADC group provided in the experimental case.
[0026] Figure 11 The graph shows the statistical results of the α-diversity index (Shannon index) of the gut microbiota in mice in the blank control group (NC), model group (MOD), LP305 group, and ADC group provided in the experimental case.
[0027] Figure 12 The diagram shows the non-metric multidimensional scaling (NMDS) analysis of the gut microbiota β diversity of mice in the blank control group (NC), model group (MOD), LP305 group, and ADC group provided in the experimental case.
[0028] Figure 13 The graph shows the results of Lefse analysis of the gut microbiota at the genus level in mice from the blank control group (NC), model group (MOD), LP305 group, and ADC group provided in the experimental case.
[0029] Figure 14 This is a graph showing the statistical results of the relative expression levels of phosphoribosyl pyrophosphate synthase mRNA in the livers of mice in the blank control group (NC), model group (MOD), LP305 group, and ADC group provided in the experimental case.
[0030] Figure 15 This is a graph showing the statistical results of adenosine deaminase activity in the serum of mice in the blank control group (NC), model group (MOD), LP305 group, and ADC group provided in the experimental case.
[0031] Figure 16 This is a graph showing the statistical results of xanthine oxidase activity in the serum of mice in the blank control group (NC), model group (MOD), LP305 group, and ADC group provided in the experimental case.
[0032] Different letters in the figure represent statistically significant differences between groups (p < 0.05). Detailed Implementation
[0033] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application. Reagents not specifically described in detail herein are all conventional reagents and are commercially available; methods not specifically described in detail are all conventional experimental methods and can be learned from the prior art.
[0034] This application provides a strain of *Lactobacillus plantarum* (… Lactiplantibacillus plantarum The *Lactobacillus plantarum* LP305 strain, with accession number CGMCC NO.33425, was deposited on January 15, 2025, at the China General Microbiological Culture Collection Center (CGMCC), accession number CGMCC NO.33425, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. In some embodiments, the *Lactobacillus plantarum* strain according to this application may be an isolated bacterial strain.
[0035] The isolation process of this LP305 strain included: Infant fecal samples were serially diluted with 0.85% physiological saline under aseptic conditions. The diluted samples were then spread onto LBS agar plates and incubated at 37°C for 48-72 hours. Colony morphology was observed visually. Suspected single colonies were picked for microscopic examination, followed by preliminary screening and purification. The purified strains were incubated in MRS broth at 37°C for 8-12 hours. After centrifugation to remove the supernatant, the cultures were resuspended in sterile 30% glycerol aqueous solution and stored at -80°C.
[0036] The identification process for this LP305 strain included: The selected target strain was cultured in liquid medium, the bacterial cells were collected, genomic DNA was extracted, and PCR amplification was performed. The content and purity of the PCR amplification products were detected, and the qualified PCR amplification products were sequenced. Based on the sequencing and related molecular biological results, the obtained strain was identified as *Lactobacillus plantarum*, and the strain was named *Lactobacillus plantarum*. Lactiplantibacillus plantarum LP305 was consigned for preservation, and its preservation information is as follows: Accession number: CGMCC NO.33425 Classification and nomenclature: Lactobacillus plantarum Lactiplantibacillus plantarum Preservation Institution: China General Microbiological Culture Collection Center, China Microbiological Culture Collection Committee Address of the depository: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.
[0037] Hyperuricemia (HUA) and the resulting kidney damage have become a prevalent metabolic disease worldwide. Long-term high uric acid can lead to the deposition of urate crystals in the kidneys, inducing abnormal activation of the NLRP6 inflammasome and excessive release of IL-18, which in turn causes kidney inflammation, renal tubular damage, and ultimately progresses to chronic kidney disease. Huang Keyan's research (Molecular immune mechanism of Lactobacillus plantarum regulating NLRP6 inflammasome activation, Jilin Agricultural University 2018 dissertation) found that Lactobacillus plantarum can induce the activation of the NLRP6 inflammasome, thereby inhibiting the secretion of IL-1β and enhancing the secretion of IL-18, and alleviating the DSS-induced inflammatory response of colitis.
[0038] IL-18 is a key pro-inflammatory cytokine, and its abnormal expression in kidney tissue is closely related to the local microinflammatory state; the NLRP6 inflammasome is a core molecular pathway regulating the maturation and secretion of IL-18.
[0039] Furthermore, the inventors of this application discovered that *Lactobacillus plantarum* exhibits significant tissue specificity and disease dependence in regulating the NLRP6 inflammasome IL-18 signaling axis. IL-18 is a protective cytokine in colitis and a pro-inflammatory damaging factor in the kidneys of hyperuricemic mice, suggesting that the pathophysiological function of IL-18 exhibits tissue heterogeneity. Huang Keyan discovered that *Lactobacillus plantarum* (… Lactobacillus plantarum NC8 can enhance IL-18 secretion in the gut to alleviate colitis by adaptively modulating the NLRP6 inflammasome.
[0040] The inventors of this application discovered through testing that the *Lactobacillus plantarum* LP305 provided in this application can not only reduce the levels of uric acid, blood urea nitrogen, and creatinine in hyperuricemia model mice, thus improving their health status, but also improve hyperuricemic kidney damage by reducing the level of IL-18 in the kidneys of hyperuricemia model mice, demonstrating the precise and targeted immunomodulatory properties of this strain.
[0041] These test cases specifically include: 1. In vitro test Prepare uric acid basal medium (0.2g uric acid, 1.71g disodium hydrogen phosphate dodecahydrate, 0.3g potassium dihydrogen phosphate, 0.05g sodium chloride, 0.05g magnesium sulfate heptahydrate, 0.001g calcium chloride, 1.2g agar). Subculture *Lactobacillus plantarum* LP305 strain three times, centrifuge at 8000 rpm for 5 min, discard the supernatant, wash the bacterial pellet with 2 mL of physiological saline, repeat twice. Resuspend the strain in 2 mL of physiological saline, and spot 10 μL onto the uric acid basal medium. Incubate at 37℃ for 48 h, observing for the formation of a clear zone. The presence of a clear zone around the strain indicates its ability to degrade uric acid.
[0042] like Figure 1As shown, Lactobacillus plantarum LP305 can utilize and decompose uric acid in vitro, producing a transparent zone on the plate with a diameter of 11±0.47 mm.
[0043] The strain was passaged three times and inoculated into L-MRS medium at a 3% (v / v) inoculum. All bacterial culture was collected into 50 mL centrifuge tubes, centrifuged at 8000 rpm for 5 min, the supernatant was discarded, and the bacterial pellet was washed with 5 mL PBS, repeated twice. The strain was resuspended in 5 mL of 0.6 mM inosine and 0.6 mM guanosine, respectively, and anaerobically cultured at 37 °C for 1 h. 900 μL of culture was transferred to 100 μL of perchloric acid (0.1 mol / L), vortexed, and centrifuged at 4000 x g for 10 min. The supernatant was collected and filtered through a 0.22 μm filter into a liquid chromatography vial. The mobile phase was 20 mM potassium dihydrogen phosphate:methanol 96:4, UV wavelength 254 nm, column temperature 25 °C, isocratic elution for 20 min. Results were quantified using the external standard method.
[0044] The results showed that Lactobacillus plantarum LP305 had a 100% degradation rate of inosine and a 100% degradation rate of guanosine.
[0045] 2. In vivo testing (1) Sources of biological materials Six-week-old male C57BL / 6J mice (18-20g) were purchased from Spifort (Beijing) Biotechnology Co., Ltd. and housed in the animal facility of Hubei Provincial Center for Disease Control and Prevention. Animal experiment ethics number: Safety Evaluation Center Animal (Fu) No. 202410369.
[0046] (2) Establishing a hyperuricemia model and conducting grouped intervention trials Male C57BL / 6J mice were housed in an environment with a room temperature of 25°C±2°C, humidity of 50%±5%, and a 12-hour light-dark cycle. After a 7-day acclimatization period, the mice were randomly divided into four groups (n=10 / group): NC group, MOD group, LP305 group, and ADC group. Hyperuricemia was induced in the MOD, LP305, and ADC groups by suspending potassium oxonate in 0.5% sodium carboxymethyl cellulose solution and adenine in physiological saline. Mice were administered 0.2 mL of adenine (50 mg / kg) by gavage and 0.2 mL of potassium oxonate solution (250 mg / kg) by intraperitoneal injection daily. Mice in the NC group were administered the same volume of physiological saline by gavage and the same volume of 0.5% sodium carboxymethyl cellulose solution by intraperitoneal injection. Mice in the LP305 group were treated with adenine and potassium oxonate for 4 hours, followed by administration of 0.2 mL of potassium oxonate solution containing 1×10⁻⁶ mg / kg of potassium oxonate. 10 Mice in the ADC group were given physiological saline containing CFU / mL Lactobacillus plantarum LP305. Mice in the NC group were given 0.2 mL of physiological saline containing 5 mg / kg allopurinol. Mice in the NC group and MOD group were given the same volume of physiological saline.
[0047] (3) Detection of body weight, uric acid, blood urea nitrogen and creatinine levels in each group of mice Mice were weighed every 3 days, and orbital blood was collected every 7 days to measure uric acid levels. The experiment lasted for 14 days. After 14 days, the mice were weighed and euthanized.
[0048] like Figure 2 As shown, the body weight of mice in the MOD and ADC groups gradually decreased, showing a significant difference compared to the NC group. After intervention with *Lactobacillus plantarum* LP305, the body weight of mice gradually recovered, significantly increasing compared to the MOD group. This indicates that *Lactobacillus plantarum* LP305 can effectively improve the health status of mice with hyperuricemia.
[0049] like Figure 3 As shown, on day 7 of the experiment, the serum uric acid level in the MOD group mice was significantly higher than that in the NC group, while LP305 intervention significantly reduced the serum uric acid level in the mice. On day 14 of the experiment, the serum uric acid level in the MOD group mice was still significantly different from that in the NC group, and LP305 was still able to reduce the serum uric acid level. These results indicate that *Lactobacillus plantarum* LP305 can effectively reduce the serum uric acid level in mice with hyperuricemia.
[0050] (4) Lactobacillus plantarum LP305 improves kidney damage caused by hyperuricemia. After the experiment, liver and kidney tissues were collected from mice in each group, and liver and kidney indices were measured. Liver index (%) = (liver weight / mouse body weight) × 100%. Kidney index (%) = (kidney weight / mouse body weight) × 100%.
[0051] like Figure 4 and Figure 5 As shown, the liver and kidney indices in the MOD and ADC groups were significantly higher than those in the NC group, indicating lesions such as liver and kidney enlargement. The kidney index in the LP305 group was significantly lower, with no significant difference from the NC group.
[0052] After the experiment, blood was collected from each group of mice to test the blood urea nitrogen and creatinine levels.
[0053] like Figure 6 and Figure 7 As shown, with increasing experimental time, the creatinine and blood urea nitrogen levels in the MOD and ADC groups were significantly higher than those in the NC group. However, after LP305 intervention, the creatinine and blood urea nitrogen levels significantly decreased, showing no significant difference from the NC group. Creatinine and blood urea nitrogen are indicators for evaluating kidney function. Elevated levels of creatinine and blood urea nitrogen in the blood indicate renal insufficiency, potentially leading to kidney failure, nephritis, acute tubular necrosis, or other lesions. This demonstrates that the *Lactobacillus plantarum* LP305 provided in this application, after intervention in hyperuricemic mice, improves kidney damage caused by hyperuricemia.
[0054] (5) Lactobacillus plantarum LP305 improves kidney inflammation and oxidative stress caused by hyperuricemia. After the experiment, kidney tissues from mice in each group were collected, HE sections were prepared, and photographs were taken under an optical microscope.
[0055] like Figure 8 As shown, the renal tubules and glomeruli of mice in the NC group had clear morphology and no obvious lesions. In the MOD group, the glomeruli were atrophied, the renal tubules were enlarged, and the renal interstitium was filled with inflammatory cells. The renal pathological condition of the LP305 group was much improved compared with the MOD group, with normal glomerular and tubular morphology and reduced inflammatory cells in the renal interstitium. However, the renal pathological condition of the ADC group was not significantly improved compared with the MOD group.
[0056] After the experiment, kidney tissues from mice in each group were collected, kidney tissue homogenates were prepared, and the IL-18 content was detected.
[0057] like Figure 9 As shown, compared with the NC group, the MOD group mice had significantly higher levels of IL-18 in their kidneys, indicating that high uric acid led to inflammatory responses and stress damage in the kidneys. However, IL-18 levels significantly decreased after LP305 intervention.
[0058] In the kidneys of hyperuricemic mice, IL-18 is a pro-inflammatory damaging factor, suggesting that the pathophysiological function of IL-18 has tissue heterogeneity. The Lactobacillus plantarum LP305 strain provided in this application can reduce IL-18 levels in the kidneys to improve kidney damage in hyperuricemic mice, demonstrating the precise and targeted immunomodulatory characteristics of this strain.
[0059] (6) Lactobacillus plantarum LP305 improves intestinal flora disorder caused by hyperuricemia. After the experiment, cecal tissues of mice in each group were collected, and 16S rRNA amplicon sequencing was performed on the contents of the cecal tissues. The abundance of the mouse gut microbiota at the α-diversity, β-diversity, phylum level and genus level was analyzed.
[0060] like Figure 10 and Figure 11 The α-diversity analysis results showed that, compared with the NC group, the ACE and Shannon indices of the MOD group mice were significantly decreased, indicating that hyperuricemia leads to a decrease in the richness and diversity of the gut microbiota. After LP305 intervention, the ACE index increased slightly, but not significantly, while the Shannon index increased significantly, indicating that LP305 can improve the diversity of the gut microbiota.
[0061] like Figure 12The β-diversity analysis results of the mouse gut microbiota showed that the MOD group and the NC group were far apart on the NMDS map, and the Stress value was less than 0.2, indicating that the community composition of the MOD group and the NC group was different. Meanwhile, the LP305 group largely overlapped with the NC group and had no overlap with the MOD group, indicating that the gut microbiota composition of the LP305 group was similar to that of the NC group. The α- and β-diversity analyses showed that *Lactobacillus plantarum* LP305 provided in this application can alleviate the damage to the intestinal microecology caused by hyperuricemia in mice.
[0062] like Figure 13 The analysis of changes in the gut microbiota composition at the genus level in each group of mice showed that the MOD group was enriched with *Eurotella* and *Bacillus zurichae*, while the LP305 group was enriched with *Ackermania*, *UCG-006* (Trichophyton family), *Xanthomonas*, and *Lactobacillus plantarum*. Related studies have shown that during inflammation, the abundance of *Eurotella* and *Bacillus zurichae* significantly increases, while the abundance of *Ackermania*, *UCG-006*, and *Lactobacillus plantarum* significantly decreases. This indicates that *Lactobacillus plantarum* LP305 provided in this application can promote an increase in the abundance of beneficial bacteria and reduce the abundance of harmful bacteria in the gut.
[0063] The test results above show that *Lactobacillus plantarum* LP305 strain can specifically reduce the level of IL-18 in the kidneys of hyperuricemic mice, thus reducing kidney damage caused by hyperuricemia. Furthermore, this *Lactobacillus plantarum* LP305 strain can specifically enrich intestinal flora including *Ackermania*, *UCG-006* (family Trichophytonceae), and *Xanthomonas*, reversing the intestinal flora imbalance caused by hyperuricemia.
[0064] In one possible mechanism, *Lactobacillus plantarum* LP305 protects the kidneys of hyperuricemic mice by tissue-specifically regulating the NLRP6-IL-18 axis. In hyperuricemia, the NLRP6 inflammasome in kidney tissue is abnormally activated, binding to the adaptor protein ASC and activating Caspase-1, leading to excessive IL-18 secretion and causing kidney inflammation and tubular damage. This *Lactobacillus plantarum* can specifically sense the renal pathological microenvironment, inhibit the activation of the NLRP6-ASC-Caspase-1 pathway, and reduce renal IL-18 levels, while not affecting the normal activation of the NLRP6 inflammasome in intestinal tissue or the physiological protective function of IL-18.
[0065] Under one possible mechanism, *Lactobacillus plantarum* LP305 specifically enriches beneficial bacteria to regulate the gut-kidney axis. After entering the intestine, in addition to significant self-enrichment, *Lactobacillus plantarum* specifically promotes the proliferation of three functional bacterial groups: *Ackermania*, *UCG-006* (family Trichophyceae), and *Xanthomonas*. Those skilled in the art know that *Ackermania* reduces the entry of uremic toxins into the bloodstream by degrading the mucus layer and repairing the intestinal barrier, while directly lowering serum uric acid levels and inhibiting Toll-like receptor 4-mediated inflammatory responses in the kidneys. *UCG-006* (family Trichophyceae) assists in the breakdown of uric acid precursors, enhancing intestinal uric acid excretion efficiency and reducing uric acid transport to the kidneys. *Xanthomonas* produces large amounts of short-chain fatty acids (SCFAs), which are transported to the kidneys via peripheral circulation, reducing renal tubular oxidative stress damage and inhibiting inflammatory cell infiltration. Simultaneously, SCFAs can restore gut microbiota balance, further strengthening the protective effect of the gut-kidney axis.
[0066] Based on this, the embodiments provide an agent for reducing the expression and / or secretion levels of IL-18 in kidney tissue and / or renal cells, the agent comprising at least one or more mixtures of live, dead, inactivated, and cultured *Lactobacillus plantarum* LP305. The embodiments also provide the use of this LP305 strain in the preparation of an agent for reducing the expression and / or secretion levels of IL-18 in kidney tissue and / or renal cells.
[0067] Based on this, the examples provide the use of strain LP305 in preparing formulations enriched in *Ackermania*, *UCG-006* (family Trichophytonceae), and *Xanthomonas*. This strain shows extremely high application potential. The examples also provide a formulation enriched in *Ackermania*, *UCG-006* (family Trichophytonceae), and *Xanthomonas*, comprising at least one or more mixtures of live, dead, inactivated, and cultured *Lactobacillus plantarum* LP305.
[0068] Based on this, the embodiments provide the use of *Lactobacillus plantarum* LP305 strain in the preparation of formulations that indirectly reduce IL-18 levels in isolated kidney tissue by modulating the composition of the host gut microbiota. The embodiments also provide a formulation that indirectly reduces IL-18 levels in isolated kidney tissue by modulating the composition of the host gut microbiota, comprising at least one or more mixtures of live cells, dead cells, inactivated cells, and cultures of *Lactobacillus plantarum* LP305 strain.
[0069] Based on this, the embodiments provide a food additive with the function of regulating renal IL-18 levels, comprising at least one or more mixtures of live cells, dead cells, inactivated cells, and cultures of *Lactobacillus plantarum* LP305. Ingestion of this food additive reduces basal renal IL-18 levels. The embodiments also provide the use of *Lactobacillus plantarum* LP305 strain in the preparation of a food additive that reduces basal renal IL-18 levels.
[0070] Based on this, the embodiments provide a common food or food ingredient with the function of regulating renal IL-18 levels, comprising at least one or more mixtures of live, dead, inactivated, and cultured *Lactobacillus plantarum* LP305. The common food or food ingredient includes fermented milk, solid beverages, probiotic powder, fermented fruit and vegetable products, etc., and does not have health care or disease treatment effects; specifically, it lowers basal IL-18 levels. The embodiments also include the use of *Lactobacillus plantarum* LP305 strain in the preparation of common food or food ingredient with the function of regulating renal IL-18 levels.
[0071] Based on this, the examples provide the use of *Lactobacillus plantarum* LP305 strain as a model strain in studies of NLRP6-IL-18 axis regulation. For example, the use of *Lactobacillus plantarum* LP305 as a model strain in in vitro and / or ex vivo experiments to study the mechanism by which NLRP6 inflammasome regulates IL-18 secretion.
[0072] Based on this, the embodiments provide the use of *Lactobacillus plantarum* LP305 strain in screening and / or validating renal IL-18 regulatory factors. For example, the use of *Lactobacillus plantarum* LP305 in screening or validating active substances, strains, or compositions that can regulate renal IL-18 levels.
[0073] PRPS (phospribose-pyrophosphate synthase) is a key enzyme in the first step of the de novo and salvage pathways of purine synthesis. Increased PRPS activity promotes the synthesis of nucleic acids and purine bases, leading to increased uric acid production. ADA (adenosine deaminase) and XOD (xanthine oxidase) are important metabolic enzymes in the uric acid production pathway. ADA deaminates adenosine to inosine, which is further converted to hypoxanthine. XOD catalyzes the conversion of hypoxanthine to xanthine, which is then further catalyzed to uric acid. Increased ADA and XOD activity leads to increased uric acid production, while decreased ADA and XOD activity reduces uric acid production. Furthermore, the in vivo experiments described above also tested the effects of the *Lactobacillus plantarum* LP305 strain provided in this application on the three enzymes PRPS, ADA, and XOD.
[0074] The testing process specifically includes: Blood samples were collected from mice in the MOD, NC, ADC, and LP305 groups, and the activities of three enzymes, PRPS, ADA, and XOD, were detected. ADA and XOD activities were detected using a colorimetric method. The PRPS activity detection procedure is as follows: Total RNA was extracted from the livers of mice in each group and reverse transcribed into cDNA. PCR was performed using the cDNA as a template. Primer pairs used to amplify the phosphoribosyl pyrophosphate synthase (PRPS) target gene are shown in SEQ ID NO.1 (AAGTTTAGCAACCAGGAGACC) and SEQ ID NO.2 (CCCGAATCCACTGAAGAA), while primer pairs used to amplify the reference gene GAPDH are shown in SEQ ID NO.3 (TGAGGCCGGTGCTGAGTATGT) and SEQ ID NO.4 (CAGTCTTCTGGGTGGCAGTGAT). The PCR amplification conditions were as follows: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 40 s, annealing at 53.0, 52.0, and 60.0℃ for 45 s, extension at 72℃ for 1 min, 35 cycles, and a final extension at 72℃ for 5 min. The products were separated by 1.5% agarose gel electrophoresis, and gel imaging was performed. Density analysis of each band was conducted using analytical software, and the ratio of the target mRNA to GAPDH was calculated. Based on 2... -ΔΔCt The relative expression level of the mRNA to be tested can be obtained by this method.
[0075] PRPS are the primary key enzymes in de novo purine synthesis and salvage synthesis. For example... Figure 14 As shown, the relative expression level of PRPS mRNA in the liver of mice in the model group was significantly upregulated compared with that in the blank control group, demonstrating that the initiation pathway of purine synthesis is abnormally activated in hyperuricemia, fundamentally promoting uric acid production. After LP305 intervention, the relative expression level of PRPS mRNA in the liver of mice was significantly reduced compared with the model group, returning to the level of the blank control group, demonstrating that LP305 can inhibit PRPS synthesis at the gene expression level in vivo, blocking the initiation step of purine synthesis and reducing the production of purine substances from the source.
[0076] like Figure 15 As shown, serum ADA enzyme activity in the model group mice was significantly higher than that in the blank control group, demonstrating that in hyperuricemia, the upstream adenosine to inosine conversion process of uric acid synthesis is abnormally activated, leading to increased purine precursor production. After LP305 intervention, serum ADA enzyme activity in mice was significantly lower than that in the model group and approached the level of the blank control group, proving that LP305 can effectively inhibit the catalytic activity of ADA in vivo and block the key upstream conversion step of purine metabolism.
[0077] like Figure 16As shown, serum XOD activity in the model group mice was significantly higher than that in the blank control group, indicating that in hyperuricemia, the downstream synthesis processes of hypoxanthine to xanthine and xanthine to uric acid are overactivated, leading to a significant increase in uric acid production. After LP305 intervention, serum XOD activity in mice was significantly lower than that in the model group (MOD), with an inhibitory effect comparable to or even better than that of the clinical drug allopurinol, demonstrating that LP305 can target and inhibit the key rate-limiting enzyme downstream of uric acid synthesis in vivo, directly reducing uric acid production.
[0078] Uric acid synthesis is a continuous process from adenosine (upstream), purine precursor (initiation), hypoxanthine / xanthine (midstream) and uric acid (downstream). Currently, probiotics can only inhibit 1-2 of these targets, while LP305 simultaneously inhibits upstream ADA, initiation PRPS, and downstream XOD, covering the entire chain of key nodes from purine metabolism to uric acid synthesis, achieving "full-chain blocking" of uric acid synthesis from the source to the end.
[0079] Based on this, embodiments of this application provide a formulation that simultaneously inhibits adenosine deaminase, xanthine oxidase, and phosphoribosyl pyrophosphate synthase, comprising at least one or more mixtures of live, dead, inactivated, and cultured *Lactobacillus plantarum* LP305 cells. The embodiments also provide the use of *Lactobacillus plantarum* LP305 strain in the preparation of a formulation that simultaneously inhibits adenosine deaminase, xanthine oxidase, and phosphoribosyl pyrophosphate synthase.
[0080] Based on this, embodiments of this application also provide the use of *Lactobacillus plantarum* LP305 strain in the preparation of food starter cultures. As a functional food fermentation strain, it is applied to the production of foods such as yogurt, fermented milk, fermented grains, and kimchi. Utilizing its enzyme-inhibiting properties, it is used to develop low-purine metabolic burden fermented foods. These applications only emphasize the inhibitory effect of the strain on purine metabolism-related enzymes and do not claim any uric acid-lowering or health-promoting effects. The embodiments also provide a food starter culture comprising at least one or more of live, dead, inactivated, and cultured *Lactobacillus plantarum* LP305 cells.
[0081] Based on this, this application also provides the use of *Lactobacillus plantarum* LP305 strain in the preparation of microbial agents for food ingredients. It is prepared into freeze-dried microbial powder, inactivated microbial powder, etc., and added as a food ingredient to processed foods such as biscuits, cereal bars, and beverages, labeled "Contains *Lactobacillus plantarum* LP305 with ADA / XOD / PRPS enzyme inhibitory activity." This only reflects the functional characteristics of the strain and does not involve any health efficacy claims. Therefore, the embodiments also provide a microbial agent comprising at least one or more mixtures of live cells, dead cells, inactivated cells, and cultures of *Lactobacillus plantarum* LP305.
[0082] Based on this, this application also provides a quality-optimizing strain for fermented foods, comprising at least one or more of the following: live cells, dead cells, inactivated cells, and cultures of *Lactobacillus plantarum* LP305. By utilizing its metabolic characteristics and enzyme inhibition capabilities, the nutritional composition of fermented foods is optimized, for example, by reducing the formation of purines during fermentation.
[0083] Based on this, this application also provides an in vitro research tool strain for inhibiting the activity of uric acid synthesis-related enzymes, comprising at least one or more mixtures of live, dead, inactivated, and cultured *Lactobacillus plantarum* LP305 cells. This strain serves as a model strain for "simultaneous inhibition of ADA / XOD / PRPS multiple targets" in laboratory studies, used for fundamental research on purine metabolism pathways, enzyme inhibition mechanisms, and the interaction between probiotics and metabolic enzymes. Furthermore, this LP305 strain can be derived into a "standard strain for detecting multi-enzyme inhibitory activity," providing a control benchmark for screening the enzyme inhibitory activity of similar probiotics.
[0084] Based on this, this application also provides an enzyme inhibitor screening model strain comprising at least one or more of the following: live cells, dead cells, inactivated cells, and cultures of *Lactobacillus plantarum* LP305. This strain is used to construct a high-throughput screening model strain for "ADA / XOD / PRPS triple enzyme inhibitory activity," assisting in the screening and activity verification of strains, natural products, or compounds with enzyme inhibition potential in the food and microbiology fields, such as screening prebiotics and plant extracts that can synergistically enhance enzyme inhibition effects.
[0085] The formulations, reagents, common food ingredients, common foods, food additives, model strains, food fermentation agents, microbial agents, quality-optimizing strains, in vitro research tool strains, and enzyme inhibitor screening model strains provided in the examples, wherein the concentration of at least one or more mixtures of live cells, dead cells, inactivated cells, and cultures is 10. 3 Up to 10 17 Within the range of colony-forming units per gram or per milliliter (CFU / g or CFU / mL), for example, in 10 5 -10 17 Within the range of CFU / g or CFU / mL, for example, in the range of 10 6 -10 17 Within the range of CFU / g or CFU / mL, for example, in the range of 10 7 -10 17 Within the range of CFU / g or CFU / mL, for example, in the range of 10 8 -10 17 Within the range of CFU / g or CFU / mL, for example, in the range of 10 9 -10 17 Within the range of CFU / g or CFU / mL, for example, in the range of 1010 -10 17 Within the range of CFU / g or CFU / mL, for example, in the range of 10 11 -10 16 Within the range of CFU / g or CFU / mL, for example, in the range of 10 12 -10 16 Within the range of CFU / g or CFU / mL, for example, in the range of 10 13 -10 16 Within the range of CFU / g or CFU / mL, for example, in the range of 10 7 -10 16 Within the range of CFU / g or CFU / mL, for example, in the range of 10 8 -10 15 Within the range of CFU / g or CFU / mL, for example, in the range of 10 9 -10 15 Within the range of CFU / g or CFU / mL, for example, in the range of 10 10 -10 15 Within the range of CFU / g or CFU / mL, for example, in the range of 10 11 -10 15 Within the range of CFU / g or CFU / mL, for example, in the range of 10 12 -10 15 Within the range of CFU / g or CFU / mL.
[0086] In the formulations, reagents, common food ingredients, common foods, food additives, model strains, food fermentation agents, microbial agents, quality-optimizing strains, in vitro research tool strains, and enzyme inhibitor screening model strains provided in the examples, *Lactobacillus plantarum* LP305 is used as an active ingredient in at least one or more mixtures of live cells, dead cells, inactivated cells, and cultures. The concentration of this active ingredient is from 0.0001% (w / w) to 99% (w / w).
[0087] The formulations, reagents, common food ingredients, common foods, food additives, model strains, food fermentation agents, microbial agents, quality-optimizing strains, in vitro research tool strains, and enzyme inhibitor screening model strains provided in the examples contain *Lactobacillus plantarum* LP305 as an active ingredient, as well as excipients for forming the formulation.
[0088] In the context of this application, *Lactobacillus plantarum* LP305 as defined herein can be provided in the composition according to this application in the form of live cells, dead cells, inactivated cells, and cultures of at least one or more. Live cells refer to live *Lactobacillus plantarum* bacteria with intact cell structure, capable of normal metabolism and reproduction, for example, cultured in a culture medium (such as MRS medium), centrifuged, washed to retain viability, and typically preserved in lyophilized form (such as lyophilized bacterial powder). Dead cells refer to cells that have died naturally or lost activity through physical / chemical treatment (such as high temperature, ultraviolet light), and whose cell structure may be intact or partially destroyed. Inactivated cells specifically refer to cells that have been killed by controlled methods (such as heat inactivation, formaldehyde treatment, high pressure treatment) but retain cell surface structures (such as cell walls, capsules). Inactivated cells emphasize "structural preservation," while dead cells may suffer structural damage due to the treatment method.
[0089] The formulations, reagents, common food ingredients, common foods, food additives, model strains, food fermentation agents, microbial agents, quality-optimizing strains, in vitro research tool strains, and enzyme inhibitor screening model strains provided in the examples may be provided in solid, liquid, viscous, emulsion, or dry form.
[0090] The formulations, reagents, common food ingredients, common foods, food additives, model strains, food fermentation agents, microbial agents, quality-optimizing strains, in vitro research tool strains, and enzyme inhibitor screening model strains provided in the examples can be preferably formulated into pastes, soft gelatin capsules, hard gelatin capsules, powders, talc, granules, beads, lozenges, effervescent tablets, rhomboid lozenges, oral lozenges, chewable tablets, sublingual tablets, oils, liquids, solutions, tinctures, emulsions, concentrates, sprays, mists, drinking ampoules, gels, tablets, and coated pills.
[0091] The formulations, reagents, common food ingredients, common foods, food additives, model strains, food fermentation agents, microbial agents, quality-optimizing strains, in vitro research tool strains, and enzyme inhibitor screening model strains provided in the examples can be in the form of pills, powders, capsules, tablets, granules, film-coated formulations, creams, ointments, gels, lotions, foams, suppositories, sachets, or sugar-coated pills.
[0092] The term "culture" as used herein includes a bacterial suspension of *Lactobacillus plantarum* LP305, and may also include nutrient-providing components (e.g., solid or liquid culture media, or feeder cells or bacteria). In some embodiments, the nutrient-providing components are selected from proteins, carbohydrates, fats, prebiotics, enzymes, vitamins, immunomodulators, milk substitutes, minerals, amino acids, or any combination thereof.
[0093] In some embodiments, the culture also includes a cell-free culture filtrate of Lactobacillus plantarum LP305.
[0094] In some embodiments, the culture may also contain a prebiotic composition of at least one or more prebiotics.
[0095] In this article, "prebiotic" refers to the component that promotes the production of LP305 strain. Prebiotics can refer to chemical products that induce the growth and / or activity of symbiotic microorganisms (such as bacteria and fungi) that contribute to the health of the host. Prebiotics can be indigestible carbohydrates that pass through the upper gastrointestinal tract undigested and stimulate the growth and / or activity of beneficial bacteria that colonize the gut or skin microbiota.
[0096] Some oligosaccharides used as prebiotics are fructooligosaccharides (FOS), xylooligosaccharides (XOS), polydextrose, pectin, galactooligosaccharides (GOS), or human milk oligosaccharides (HMOs). In addition, disaccharides such as lactulose or some monosaccharides such as lactose or tagatose can also be used as prebiotics.
[0097] In one embodiment of this application, at least one prebiotic compound may be included in the composition of this application. In a very broad concept, prebiotics are all compounds that can be metabolized by probiotics.
[0098] Preferably, prebiotics are indigestible or poorly digestible by mammals. Therefore, after being ingested by mammals, indigestible prebiotics can pass through the small intestine and enter the large intestine to stimulate the growth of probiotics in that compartment. Thus, prebiotics can serve as a food source for probiotics. It is believed that prebiotics (many of which are poorly digestible carbohydrates) promote the growth of probiotics. Prebiotics are naturally found in, for example, cabbage, onions, whole grains, bananas, garlic, honey, leeks, artichokes, fortified foods and beverages, and dietary supplements. Prebiotics are well known in the art, and there are no particular limitations on prebiotics themselves when used in this application.
[0099] In one embodiment, at least one prebiotic is selected from the following compounds and compositions: indigestible carbohydrates, β-glucan, mannooligosaccharides, inulin, fructooligosaccharides, human milk oligosaccharides (HMO), galactooligosaccharides (GOS), lactulose, lactulose oligosaccharides, galactotriose, fructooligosaccharides (FOS), cellobiose, cellodextrin, cyclodextrin, maltitol, lactitol, glycosilsucrose, betaine, vitamin E, or variants thereof (wherein variants are selected from α, β, γ, δ tocopherols, tocotrienols, and tocomonenophenols). Optionally, mannooligosaccharides and / or inulin may be preferred. HMOs may include lact-N-tetrasaccharide, lact-N-fucopentose, lact-N-triose, 3'-sialyllactose, lact-N-neofucopentose, sialic acid, L-fucose, 2-fucosyllactose, 6'-sialyllactose, lact-N-neotetrasaccharide, and 3-fucosyllactose.
[0100] The above are merely preferred embodiments of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in the present invention should be included within the scope of protection of the present invention.
Claims
1. A strain of *Lactobacillus plantarum* ( Lactiplantibacillus plantarum This is Lactobacillus plantarum LP305 with accession number CGMCCNO.33425.
2. A composition comprising at least one or more of the following: live cells, dead cells, inactivated cells, and cultures of *Lactobacillus plantarum* LP305 as described in claim 1.
3. An agent for reducing the expression and / or secretion levels of IL-18 in kidney tissue and / or kidney cells, comprising at least one or a mixture of live, dead, inactivated, and cultured *Lactobacillus plantarum* LP305 as described in claim 1.
4. A preparation for enriching Enterobacteriaceae, UCG-006, and Xanthomonas, comprising at least one or more of the following: live cells, dead cells, inactivated cells, and cultures of Lactobacillus plantarum LP305 as described in claim 1.
5. A preparation that indirectly reduces the IL-18 level in isolated kidney tissue by regulating the composition of the host gut microbiota, comprising at least one or a mixture of live cells, dead cells, inactivated cells, and cultures of the *Lactobacillus plantarum* LP305 strain as described in claim 1.
6. An agent that simultaneously inhibits adenosine deaminase, xanthine oxidase and phosphoribosyl pyrophosphate synthase, comprising at least one or a mixture of live, dead, inactivated and cultured *Lactobacillus plantarum* LP305 as described in claim 1.
7. A food fermentation agent comprising at least one or more of the following: live cells, dead cells, inactivated cells, and cultures of *Lactobacillus plantarum* LP305 as described in claim 1.
8. An in vitro research tool bacterium for inhibiting the activity of uric acid synthesis-related enzymes, comprising at least one or a mixture of live cells, dead cells, inactivated cells, and cultures of *Lactobacillus plantarum* LP305 as described in claim 1.
9. A model strain for screening enzyme inhibitors, comprising at least one or more of the following: live cells, dead cells, inactivated cells, and cultures of *Lactobacillus plantarum* LP305 as described in claim 1.
10. The *Lactobacillus plantarum* as described in claim 1 ( Lactiplantibacillus plantarum Use in the preparation of formulations, wherein the use is selected from: Preparation of nucleoside degradation agents for the uric acid synthesis pathway, wherein the nucleoside degradation agent is at least one of in vitro degradation agents for inosine and in vitro degradation agents for guanosine; Prepare a uric acid-lowering preparation, wherein the uric acid-lowering preparation is at least one of an in vitro uric acid-lowering preparation and an in vivo uric acid-lowering preparation; Preparations of agents that reduce the expression and / or secretion levels of IL-18 in kidney tissue and / or kidney cells; Preparation of formulations enriched with Akkermansia spp., UCG-006 spp. of Trichophytonceae family and Xanthomonas spp. of the intestinal tract; Preparation of a formulation that indirectly reduces IL-18 levels in isolated kidney tissue by regulating the composition of the host gut microbiota; Prepare food additives that regulate renal IL-18 levels; Prepare ordinary food or food ingredients that have the function of regulating renal IL-18 levels; Preparation of food fermentation agents; Preparation of microbial agents for food ingredients; As a model strain for studying the regulation of the NLRP6-IL-18 axis; Screening and / or validation of renal IL-18 regulatory factors; As a quality-optimizing strain for fermented foods; As a tool bacteria for in vitro research on the inhibition of uric acid synthesis-related enzyme activity; As a model strain for screening enzyme inhibitors.
Citation Information
Patent Citations
Lactobacillus plantarum OPB15 capable of reducing uric acid and repairing micro-ecological balance of female private parts and application of lactobacillus plantarum OPB15
CN117106674A