Method for instantaneously transforming peony in vivo and application thereof
By injecting the genetic transformation vector into living plants during the early stage of peony flower bud differentiation, the problem of short research cycle in traditional transient overexpression studies has been solved, enabling a systematic exploration of the genetic regulatory mechanism of peony flower shape formation and providing a more reliable research method.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-30
- Publication Date
- 2026-06-02
AI Technical Summary
Existing technologies make it difficult to effectively intervene genetically in the process of peony flower formation. Traditional transient overexpression studies have too short a period to fully influence the key processes of flower development.
In the early stage of peony flower bud differentiation, a solution containing a genetic transformation vector was injected into the flower buds of living plants, and the injection was repeated multiple times. Overexpression or silencing vectors such as pCAMBIA2300 or TRV2 were used to ensure that the exogenous gene persists and is expressed during the development of flower organs.
This study enabled a systematic exploration of the genetic regulatory mechanism of peony flower shape formation, breaking the limitations of traditional research cycles and providing a more complete and reliable method for peony breeding and functional genomics research, obtaining overexpression materials under natural growth conditions.
Smart Images

Figure CN122128361A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant molecular breeding technology, specifically relating to a method for instantaneous transformation of peony in vivo and its application. Background Technology
[0002] Peony (Paeonia suffruticosa L.) is a precious woody flower unique to my country. The richness of its flower shape is a key factor determining its ornamental and economic value. Therefore, fully exploring the genetic basis of peony flower shape diversity and breeding new peony varieties with more novel and higher ornamental value is a major issue that urgently needs breakthroughs. Because the morphology, number, degree of variation, and arrangement of the sepals, petals, stamens, and pistils that make up the peony flower shape vary greatly, the phenotypic traits of the floral organs exhibit different degrees of variation. These rich variations significantly enhance the ornamental value of peonies. However, due to the long growth cycle of peonies, the diversity of flower shapes depends on the analysis of the genetic mechanisms of flower shape formation.
[0003] Previous studies on the genetic analysis of peony flower shape have mostly been conducted through transient infection during the bell stage. However, since peony flower bud differentiation is completed the previous year and flower organs are basically formed by the bell stage, intervention from this stage alone may not be enough to fully affect the key processes of flower shape development. Therefore, the biological significance of the obtained phenotypic changes needs to be further carefully evaluated. Summary of the Invention
[0004] The purpose of this invention is to provide a transient genetic transformation method based on the flower bud differentiation period of live field peony and its application. Using the method provided by the invention, peony materials overexpressing the target gene under natural growth conditions can be obtained, solving the technical problem of relying on in vitro peony materials for transient overexpression research. At the same time, it also breaks the problem of the short cycle of traditional transient overexpression research, providing an effective method for subsequent research on peony breeding resources and functional genomics.
[0005] The purpose of this invention is to provide a method for transient genetic transformation of peony in vivo, comprising the following steps: in the early stage of peony flower bud differentiation, injecting an infection solution containing a genetic transformation vector into the flower buds of a living peony plant, and repeating the injection multiple times, so that the exogenous gene can persist and be expressed during the development of the flower organs of the living peony plant.
[0006] As a preferred embodiment, the early stage of peony flower bud differentiation is the pre-formation stage of petal primordia.
[0007] As a preferred embodiment, the genetic transformation vector is an overexpression vector or a gene silencing vector.
[0008] As a preferred embodiment, the genetic transformation vector is a vector based on pCAMBIA2300 or TRV2.
[0009] As a preferred option, the following steps are included: Step 1: Construct a genetic transformation vector containing the target gene; Step 2: Introduce the genetic transformation vector constructed in Step 1 into Agrobacterium and culture to obtain Agrobacterium culture containing the vector; Step 3: Prepare the infection solution and resuspend the Agrobacterium tumefaciens culture from Step 2 in the infection solution until the OD600 is 0.6-0.8; Step 4: In the early stage of peony flower bud differentiation, inject the infection solution containing the genetic transformation vector obtained in step 3 into the flower buds of living plants, and repeat the injection multiple times.
[0010] As a preferred embodiment, the construction of the overexpression vector in step 1 includes: Step 11: Amplify the target gene to obtain the target gene fragment; Step 12: Ligate the target gene fragment obtained in Step 11 with a linearized overexpression vector to construct a recombinant overexpression vector; Step 13: Transform the recombinant overexpression vector from Step 12 into Agrobacterium competent cells.
[0011] As a preferred embodiment, the construction of the silencing vector in step 1 includes: Step 11: Amplify the silenced fragment of the target gene to obtain the silenced fragment; Step 12: Ligate the silenced fragment obtained in Step 11 with a linearized silenced vector to construct a recombinant silenced vector; Step 13: Transform the recombinant silenced vector from Step 12 into Agrobacterium competent cells.
[0012] As a preferred embodiment, step 3 specifically involves the following steps: Step 31: Inoculate the Agrobacterium tumefaciens culture containing the genetic transformation vector into liquid culture medium and culture until the OD600 is 0.6-0.8. Collect the bacterial cells by centrifugation. Step 32: Prepare an infection solution containing MES, MgCl2, AS, and a surfactant, with a pH of 5.6. Step 33: Resuspend the bacterial cells collected in Step 31 in the infection solution obtained in Step 32 until the OD600 is 0.6-0.8, and treat in the dark for 3-4 hours. For the silencing vector, before resuspending, mix the Agrobacterium tumefaciens culture containing the TRV2-target gene with the Agrobacterium tumefaciens culture containing the TRV1 helper vector in equal volumes.
[0013] As a preferred embodiment, in step 4, the number of injections of bacterial solution into the flower buds until the flower buds are thoroughly soaked is 3-7 times.
[0014] As a preferred option, the target of infection is a 5-10 year old 'Fengdan' peony or 'Huawang' peony.
[0015] The second objective of this invention is to provide a method for transient genetic transformation of peony in vivo for analyzing the molecular mechanism of peony flower morphogenesis and / or for peony molecular breeding.
[0016] The present invention has the following beneficial effects: This invention proposes continuous intervention starting in the early stages of flower bud differentiation to more systematically explore the genetic regulatory mechanisms of peony flower morphology formation. By performing continuous genetic manipulation throughout the flower bud differentiation process and detecting the presence of the exogenous expression vector during the following year's flowering period, the temporal feasibility and sustainability of this intervention strategy can be verified. If the exogenous vector is confirmed to remain stable during the flowering period, it proves that this method can cover the critical periods of floral organ development, thus providing a more complete and reliable research method for elucidating the molecular mechanisms of peony flower morphology formation. Using the method provided by this invention, peony materials overexpressing the target gene under natural growth conditions can be obtained, overcoming the technical difficulty of relying on in vitro peony materials for transient overexpression studies. It also overcomes the problem of the excessively short cycle in traditional transient overexpression studies, providing an effective method for subsequent research on peony breeding resources and functional genomics. Attached Figure Description
[0017] Figure 1 This is a schematic diagram of the injection of the inoculum into flower buds according to the present invention; Figure 2 A schematic diagram of the results of agarose gel electrophoresis detection of PCR amplification products: in Figure 2 -A represents the detection results of the PsbHLH120 gene overexpression vector. Figure 2 -B represents the detection result of the PsbHLH120 gene silencing expression vector.
[0018] Figure 3 Schematic diagram of the results of agarose gel electrophoresis of the obtained PCR products: 3-A is a schematic diagram showing the detection results of the PsbHLH120 gene overexpression vector. Figure 3 -B is a schematic diagram of the detection results of the PsbHLH120 gene silencing expression vector. Detailed Implementation
[0019] To make the technical means, creative features, objectives, and beneficial effects of this invention easier to understand, the invention will be further described below in conjunction with specific embodiments.
[0020] In addition, to better illustrate the present invention, numerous specific details are given in the following detailed embodiments. Those skilled in the art should understand that the present invention can be implemented even without certain specific details. In other embodiments, methods, means, equipment and steps well known to those skilled in the art are not described in detail in order to highlight the main points of the present invention.
[0021] In view of the difficulties in genetic transformation of peonies and the fact that previous transient infection methods are not suitable for the study of peony flower shape, the peony live plant infection method provided in this invention is not only suitable for the study of peony flower shape, but also for the study of the function of related genes in current year branches and leaves.
[0022] It should be noted that this invention applies to a transient overexpression infection method using live peony plants in the field. The specific implementation method is illustrated using peony as an example of the plant material used in this invention. Unless otherwise specified, the implementation method of this invention can also be used for plants with similar growth characteristics to peony.
[0023] The target gene in this embodiment is PsbHLH120 (SEQ ID NO:1, full length 777bp), whose sequence number in the 'Luoshen Xiaochun' peony genome is psuG00000396, and whose mRNA sequence number in the 'Fengdan' peony genome is Pos.gene40500.mRNA, and the PsbHLH120 gene sequences corresponding to the two sequence numbers are completely identical; its specific silencing fragment is SEQ ID NO:2 (length 300bp), selected from the coding region sequence of the target gene. It should be noted that the infection targets in this embodiment are also applicable to 'Huawang' peony.
[0024] This invention provides a transient genetic transformation method based on the flower bud differentiation period of live field peony, comprising the following steps: Step 1, construction of the pCAMBIA2300-target gene overexpression vector. Step (11): Design specific primers with restriction sites according to the target gene sequence (the target gene in this example is PsbHLH120, with a full length of 777bp, as shown in SEQ ID NO:1). Use the successfully cloned plasmid as a template and perform PCR amplification using TransStart® FastPfu DNA Polymerase (TransGen Biotech, Beijing).
[0025] Step (12): After PCR amplification, perform 1% agarose gel electrophoresis and then recover the fragments. Cut the gel to extract the fragments that match the expected size (approximately 750 bp). Use a microcolumn concentrated DNA gel recovery kit (Zhuangmeng Biotechnology, Beijing) to recover the target fragments.
[0026] Step (13), preparation and extraction of overexpression vector plasmids: In this embodiment, the alkaline lysis-column chromatography technique was used to prepare plant expression vector plasmids on a large scale. The operation process strictly followed the Plasmid Mini Kit technical specifications of Tiangen Biotech (Beijing) Co., Ltd.
[0027] Step (14) Enzyme digestion of empty vector plasmid: Based on the vector and target gene sequence, a suitable restriction endonuclease is found. In this example, KpnI restriction endonuclease (NEB, USA) is used to digest the empty vector plasmid. After digestion, the digestion product is electrophoresed with a 1% agarose gel to check if the target band is correct. The target product is then recovered according to the method described in step (12).
[0028] Step (15) Ligation of the recovered product to the overexpression vector: The gene recovery product fragment obtained in step (12) was ligated to the linearized vector recovered in step (14) using the OK Clon DNA Ligation Kit II. The reaction solution was prepared on ice and the reaction conditions were 50℃ for 10-15 min and then cooled at 4℃.
[0029] Step (16): Transform Agrobacterium GV3101 competent cells with the overexpression vector: ① Take 30-50 μL of Agrobacterium GV3101 competent cells, thaw them in your palm, and immediately place them in an ice box. ② Add 2-4 μL of the plasmid DNA obtained in step (15) to the competent cells, mix well, and perform the following treatments in sequence: ice bath for 5 min, liquid nitrogen flash freeze for 5 min, 37℃ water bath for 5 min, and ice bath for 5 min.
[0030] Step 2: Construction of TRV2-target gene silencing vector Step (21), amplification of TRV2 target gene: Based on the target gene sequence (in this example, the target gene is PsbHLH120, and the length of the silenced gene sequence fragment is 300bp, as shown in SEQ ID NO:2), specific primers with restriction enzyme sites were designed. Using the target cDNA of 'Fengdan' as a template, PCR amplification was performed using TransStart® FastPfu DNA Polymerase (TransGen Biotech, Beijing). The reaction system and reaction procedure are the same as described in step (11).
[0031] Step (22): Perform agarose gel electrophoresis on the PCR amplification product of step (21), cut out the gel band containing the 300bp target fragment, and recover it according to the method in step (12).
[0032] Step (23), the preparation and extraction of the silencing vector plasmid, are the same as described in step (13).
[0033] Step (24): Enzyme digestion of empty vector plasmid: Based on the TRV2 vector and the target gene sequence, select KpnⅠ and EcoRⅠ restriction endonucleases (NEB, USA) to perform double digestion of the empty vector plasmid. The specific operations of enzyme digestion and product recovery are the same as described in step (14).
[0034] Step (25) ligating the recovered product into the silent expression vector: the silent fragment recovered in step (22) is ligated into the linearized TRV2 vector recovered in step (24). The specific operation steps are the same as those described in step (15).
[0035] Step (26): Transform Agrobacterium GV3101 competent cells with the silence expression vector: The specific operation steps are the same as those described in step (16).
[0036] Step 3: Homologous transient transformation of the target gene in live peony plants in the field Step (31), Plant material: 5-10 year old 'Fengdan' is used as material during the early stage of petal primordium formation (the early stage of petal primordium formation is the time point after the formation of bract and sepal primordium); Step (32), bacterial culture preparation: Inoculate 300 μL of empty bacterial culture pCAMBIA2300, TRV2, TRV1 and Agrobacterium culture containing 35S::PsbHLH120 and TRV2-PsbHLH120, which were identified as positive, into 30 mL of Agrobacterium culture containing 50 mg·L⁻¹. -1 Kan and 20 mg·L -1 OD was expanded in Rif's LB liquid medium at 28 °C in a constant temperature shaking incubator at 200 rpm. 600 The concentration was 0.6-0.8. The activated Agrobacterium bacterial solution was centrifuged at 6000 rpm for 1 min. The above five bacterial solutions were used for different experimental treatment groups.
[0037] Step (33), Preparation of inoculum: Take 10 mL of 1 M 2-morpholinoethanesulfonic acid (MES), 10 mL of 1 M MgCl2·6H2O, and 4 mL of 1 M acetosyringone (AS), add ddH2O to make up to 1 L, adjust the pH to 5.6 with 5% KOH aqueous solution, add 1 mL of surfactant L-77 (Silwet L-77), mix well and set aside; Step (34), Infecting flower buds: After resuspending and washing the bacterial precipitate obtained in step (32) twice with the infection solution obtained in step (33), the bacterial cells are then resuspended with the infection solution to OD. 600 It is 0.6-0.8.
[0038] Experimental Groups: 1. Overexpression control group: pCAMBIA2300 bacterial suspension after resuspension.
[0039] 2. Overexpression experimental group: 35S::PsbHLH120 bacterial suspension after resuspension.
[0040] 3. Silent blank control group: a 1:1 mixture of resuspended TRV2 empty vector and TRV1 resuspended bacterial solution.
[0041] 4. Silent experimental group: a 1:1 mixture of resuspended TRV2-PsbHLH120 and TRV1 resuspended bacterial solution.
[0042] The mixing method involves mixing TRV1 with equal volumes of TRV2-PsbHLH120 and TRV2 bacterial solution, and then treating in the dark for 3-4 hours.
[0043] Inject the bacterial solution into the flower buds using a 5 mL disposable sterile syringe until the buds are thoroughly soaked (refer to...). Figure 1 As shown in the image, the petals are injected every 7-10 days for a total of 5 injections. After the peak blooming period the following year, the petals are mixed and sampled for DNA and RNA extraction.
[0044] Step 4: Extraction of total DNA from petals during the full bloom period after homologous transient transformation of peony: Total DNA was extracted from the petals of different varieties of 'Fengdan' and 'Huawang' during their full bloom period using a DNA extraction kit (AG Aikerui Biotechnology, Hunan). The specific steps are as follows: Step (41): Weigh 0.3-0.5g of the plant sample obtained in step three and grind it with liquid nitrogen. Then, quickly add 500 μL of lysis buffer to the ground sample powder. Mix with 10 μL of RNase A (10 mg / ml) and shake well.
[0045] Step (42): Place the centrifuge tube in a 56°C water bath and heat for 10 minutes (during heating, it can be taken out and inverted to mix).
[0046] Step (43): Add 62.5 μL of Buffer PA (1 / 8 of the volume of the lysis buffer added in step (41), mix thoroughly, place on ice for 5 minutes, and centrifuge at 12000 rpm at room temperature for 5 minutes. Take the supernatant, add an equal volume of BufferBS-2 Ver.2, and mix thoroughly.
[0047] Step (44): Transfer all of the above solution to a Plant DNA Mini Column, let stand at room temperature for 1 minute, then centrifuge at 12000 rpm at room temperature for 1 minute and discard the filtrate.
[0048] Step (45): Add 500 μL of Buffer WA to the Plant DNA Mini Column, centrifuge at 12000 rpm at room temperature for 1 minute, and discard the filtrate.
[0049] Step (46): Add 750 μL of Buffer WB to the Plant DNA Mini Column, centrifuge at 12000 rpm at room temperature for 1 minute, and discard the filtrate.
[0050] Step (47), repeat step (46) once.
[0051] Step (48): Place the Plant DNA Mini Column on a new 2 mL Collection Tube, centrifuge at 12000 rpm at room temperature for 2 minutes, and discard the filtrate.
[0052] Step (49): Place the Plant DNA Mini Column on a new 1.5 mL centrifuge tube, add 50 μL of sterile water to the center of the Plant DNA Mini Column membrane, let it stand at room temperature for 2 minutes, then centrifuge at 12000 rpm for 2 minutes to elute the DNA solution, and store at -20℃ for later use.
[0053] Step 5: Perform PCR amplification using DNA as a template. Using the total DNA from peony petals obtained in step four as a template, the gene fragment of the target expression vector was amplified using a high-fidelity enzyme (TAKARA). The forward primer sequence for the empty overexpression vector (pCAMBIA2300) was TTTGGAGAGGACAGGGTA, and the reverse primer sequence was TGTAAAACGACGGCCAGT; the forward primer sequence for the silencing vector (TRV2) was TTCACTGGGAGATGATACGC, and the reverse primer sequence was TTGCCTTTGTAACCATCATCAC. The reaction program was as follows: denaturation at 98℃ for 3 min; 34 cycles (98℃ denaturation for 10 s, 55℃ annealing for 5 s, 72℃ extension for 10 s); final extension at 72℃ for 3 min; and final incubation at 4℃. The reaction system is as follows: Table 1 PCR amplification system Step 6: 1% (w / v) agarose gel electrophoresis detection The PCR amplification products obtained in step five above were detected by agarose gel electrophoresis. The detection results are as follows: Figure 2 As shown. Figure 2 This is the result of overexpression and silencing vector amplification of the target gene PsbHLH120 at the DNA level. Figure 2DNA was extracted from the flowers of two varieties, and PCR amplification was performed using universal primers for the pCAMBIA2300-PsbHLH120 overexpression vector and the TRV2-PsbHLH120 silencing vector, respectively. The results were then subjected to agarose gel electrophoresis. Figure 2 -A is the pCAMBIA2300-PsbHLH120 overexpression vector. Figure 2 -B is the TRV2- PsbHLH120 silencing vector; DL 5000 is a 5000bp marker, DL 2000 is a 2000bp marker; 1 represents 'Fengdan' peony, 2 represents 'Huawang' peony. Figure 2 -A indicates the target band position is approximately 770bp. Figure 2 -B indicates that the target band is located at approximately 350 bp, which is consistent with the actual gene sequence, indicating that the exogenous gene still exists in the plant.
[0054] Step 7: Total RNA extraction from peony petals at full bloom after homologous transient transformation: Total RNA was extracted from the petals of various peony varieties, including 'Fengdan' and 'Huawang', using an RNA extraction kit (AG, Hunan). The specific steps are as follows: Step (71): Transfer an appropriate amount of fresh or -80℃ frozen plant tissue sample to a mortar pre-cooled with liquid nitrogen, and grind the plant tissue with a pestle (liquid nitrogen needs to be added to the mortar continuously during the grinding process) until it is ground into powder (without obvious visible particles; insufficient grinding will affect the amount of sample collected).
[0055] Step (72): Transfer the powdered sample to a 1.5 mL centrifuge tube (RNasefree) containing 600 μL Buffer QPLS, and immediately vortex at high speed for 1 min to fully lyse and mix the sample.
[0056] Step (73): Centrifuge at 12000 rpm at room temperature for 2 min, and immediately proceed with the subsequent purification steps.
[0057] Step (74): Carefully aspirate the supernatant and transfer it to a gDNAEraser Mini Column. Centrifuge at 12,000 rpm at room temperature for 1 min and discard the filtrate.
[0058] Step (75): Discard the gDNAEraser Mini Column, accurately measure the volume of the filtrate obtained in step (74), transfer it to a new 1.5 mL centrifuge tube (RNase free), and discard the filtrate.
[0059] Step (76): Add 0.5 times the volume of anhydrous ethanol to the above filtrate, and mix thoroughly by pipetting. If obvious viscous substances or precipitates appear, pipette several times to disperse the precipitate.
[0060] Step (77): Immediately transfer the above mixture to a Quick Plant RNA Mini Column, centrifuge at 12,000 rpm at room temperature for 30 seconds, and discard the filtrate.
[0061] Step (78): Add 500 μL of Buffer QWA to the above Quick Plant RNA Mini Column, centrifuge at 12000 rpm at room temperature for 30 sec, and discard the filtrate.
[0062] Step (79): Add 700 μL of Buffer QWB to the above Quick Plant RNA Mini Column, centrifuge at 12000 rpm at room temperature for 30 sec, and discard the filtrate.
[0063] Step (710): Add 700 μL of BufferQWB to the Quick Plant RNA Mini Column again, centrifuge at 12000 rpm at room temperature for 30 sec, and discard the filtrate.
[0064] Step (711): Place the above Quick Plant RNA Mini Column onto a new 2.0 mL Collection Tube, centrifuge at 12000 rpm at room temperature for 2 min, and discard the filtrate.
[0065] Place the above-mentioned Quick Plant RNA Mini Column onto a new RNase-free Tube, add 50 μL to 200 μL of RNase-free Water to the center of the adsorption column membrane, and then centrifuge at 12000 rpm at room temperature for 2 min to elute the RNA. The obtained RNA solution can be used directly for subsequent detection or stored at -80℃.
[0066] Step 8: Perform reverse transcription on the RNA obtained in Step 7. The specific steps are as follows: Step (81): Using the total RNA extracted in step seven as a template, synthesize the first strand of cDNA using a reverse transcription kit (Aikerui Biotechnology, Hunan). Prepare the reaction solution according to Table 2 below, mix well, and place in a PCR instrument. The reaction program is 42℃ for 2 min, followed by cooling at 4℃.
[0067] Step (82): Prepare the reaction solution for the second step according to Table 3 below, mix it well and place it in a PCR gene amplification instrument. The reaction conditions are 37℃ for 15 min, 85℃ for 5 s, and 4℃ cooling.
[0068] Table 2 Genomic DNA Removal Reactions Table 3 Reverse Transcription System Step 9: Perform PCR amplification using the cDNA obtained in Step 8 as a template. The specific operation steps are the same as in step five, the only difference being that the template is replaced with the cDNA obtained in step eight.
[0069] Step 10: 1% agarose gel electrophoresis detection: The PCR products obtained in step nine were detected by agarose gel electrophoresis. The results are as follows: Figure 3 As shown. Among them. Figure 3 -A represents the detection results of the PsbHLH120 gene overexpression vector. Figure 3 -B represents the detection result of the PsbHLH120 gene silencing expression vector.
[0070] Figure 3 These are the results of overexpression and silencing vector amplification of the target gene PsbHLH120 at the RNA level. Among them: 3-A is the pCAMBIA2300-PsbHLH120 overexpression vector, and 3-B is the TRV2-PsbHLH120 silencing vector; DL 5000 is a 5000bp marker, and DL 2000 is a 2000bp marker; in the figure, 1 is 'Fengdan' peony and 2 is 'Huawang' peony.
[0071] Figure 3 RNA was extracted from the flowers of two varieties, and then PCR amplification was performed using universal primers for the pCAMBIA2300-PsbHLH120 overexpression vector and the TRV2-PsbHLH120 silencing vector, respectively, followed by agarose gel electrophoresis. Figure 3 -A indicates the target band position is approximately 770bp. Figure 3 -B indicates that the target band is located at approximately 350 bp, which is consistent with the actual gene sequence, indicating that the exogenous gene still exists in the plant and has transcriptional activity.
[0072] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-disclosed technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes, and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.
Claims
1. A method for transient genetic transformation of peony in vivo, characterized in that: Includes the following steps: In the early stage of peony flower bud differentiation, a solution containing a genetic transformation vector is injected into the flower buds of living peony plants, and the injection is repeated multiple times to ensure that the exogenous gene can persist and be expressed during the development of the flower organs of the living peony plants.
2. The method for transient genetic transformation of peony in vivo according to claim 1, characterized in that: The early stage of peony flower bud differentiation is the pre-formation stage of petal primordia.
3. The method for transient genetic transformation of peony in vivo according to claim 1, characterized in that: The genetic transformation vector is an overexpression vector or a gene silencing vector.
4. The method for transient genetic transformation of peony in vivo according to claim 1, characterized in that: The genetic transformation vector is a vector based on pCAMBIA2300 or TRV2.
5. The method for transient genetic transformation of peony in vivo according to claim 1, characterized in that: Includes the following steps: Step 1: Construct a genetic transformation vector containing the target gene; Step 2: Introduce the genetic transformation vector constructed in Step 1 into Agrobacterium and culture to obtain Agrobacterium culture containing the vector; Step 3: Prepare the infection solution and resuspend the Agrobacterium tumefaciens culture from Step 2 in the infection solution until the OD600 is 0.6-0.8; Step 4: In the early stage of peony flower bud differentiation, inject the infection solution containing the genetic transformation vector obtained in step 3 into the flower buds of living plants, and repeat the injection multiple times.
6. The method for transient genetic transformation of peony in vivo according to claim 5, characterized in that: The construction of the overexpression vector in step 1 includes: Step 11: Amplify the target gene to obtain the target gene fragment; Step 12: Ligate the target gene fragment obtained in Step 11 with a linearized overexpression vector to construct a recombinant overexpression vector; Step 13: Transform the recombinant overexpression vector from Step 12 into Agrobacterium competent cells.
7. The method for transient genetic transformation of peony in vivo according to claim 5, characterized in that: The construction of the silencing vector in step 1 includes: Step 11: Amplify the silenced fragment of the target gene to obtain the silenced fragment; Step 12: Ligate the silenced fragment obtained in Step 11 with a linearized silenced vector to construct a recombinant silenced vector; Step 13: Transform the recombinant silenced vector from Step 12 into Agrobacterium competent cells.
8. The method for transient genetic transformation of peony in vivo according to claim 5, characterized in that: The specific steps of step 3 are as follows: Step 31: Inoculate the Agrobacterium tumefaciens culture containing the genetic transformation vector into liquid culture medium and culture until the OD600 is 0.6-0.
8. Collect the bacterial cells by centrifugation. Step 32: Prepare an infection solution containing MES, MgCl2, AS, and a surfactant, with a pH of 5.
6. Step 33: Resuspend the bacterial cells collected in Step 31 in the infection solution obtained in Step 32 until the OD600 is 0.6-0.8, and treat in the dark for 3-4 hours. For the silencing vector, before resuspending, mix the Agrobacterium tumefaciens culture containing the TRV2-target gene with the Agrobacterium tumefaciens culture containing the TRV1 helper vector in equal volumes.
9. The method for transient genetic transformation of peony in vivo according to claim 5, characterized in that: In step 4, the bacterial solution is injected into the flower buds 3-7 times until the buds are fully saturated.
10. The method for transient genetic transformation of peony in vivo according to claim 5, characterized in that: The target species for infection are 5-10 year old 'Fengdan' or 'Huawang' peonies.
11. The application of the peony in vivo transient genetic transformation method according to any one of claims 1-10 in analyzing the molecular mechanism of peony flower morphogenesis and / or peony molecular breeding.