Single-enzyme activated CRISPR-Cas12a nanodetection system based on dsDNA substrate and its application

Abstract

This invention proposes a single-enzyme activated CRISPR-Cas12a nanodetection system based on dsDNA substrate and its application. The detection system is designed with dsDNA containing a target strand (TS) and a non-target strand (NTS), and a non-complementary vesicular sequence is set on the non-target strand. When the UDG enzyme cleaves uracil, the resulting AP site locally amplifies this "vesicular" structure, thereby providing an energy-feasible "foothold" for crRNA invasion and dynamically "turning on" the switch. This achieves direct single-enzyme activation of UDG, fundamentally suppressing background signals. It enables high-sensitivity and high-accuracy detection of UDG and is suitable for live cell analysis and imaging, showing significant application prospects.

Description

Technical Field

[0001] This invention relates to the field of uracil-DNA glycosylation enzyme detection technology, specifically to a single-enzyme activated CRISPR-Cas12a nanodetection system based on dsDNA substrate and its application. Background Technology

[0002] Uracil-DNA glycosylase (UDG) is a key enzyme in the base excision repair (BER) pathway, responsible for recognizing and removing uracil residues in DNA to maintain genome stability. Abnormal UDG activity is closely associated with various diseases, including cervical cancer, ovarian cancer, and lymphoma. Therefore, developing highly sensitive and specific UDG detection methods is of significant clinical importance.

[0003] Existing methods for UDG detection mainly include mass spectrometry, radiolabeling, and gel electrophoresis, which suffer from problems such as complex operation, expensive equipment, and high radiation risks. While fluorescence and electrochemical methods have made progress in recent years, they mostly rely on multi-enzyme cascade reactions, requiring the assistance of APE1 / Endo IV, resulting in complex systems, high costs, and the inability to directly report UDG signals. More seriously, in diseases such as gastric cancer, the levels of UDG and APE1 are inconsistent at different stages of the disease; methods based on APE1 assistance cannot accurately reflect the biological activity of UDG. Furthermore, although the CRISPR-Cas12a system is widely used for molecular detection, its traditional activation mechanism relies on PAM sequences or pre-activated substrates, making it difficult to directly respond to UDG single-enzyme events.

[0004] Therefore, there is an urgent need to develop a UDG detection system that requires no auxiliary enzymes, is easy to operate, has high sensitivity, and is suitable for live cell imaging. Summary of the Invention

[0005] This invention proposes a single-enzyme activated CRISPR-Cas12a nanodetection system based on dsDNA substrate, which can achieve high-sensitivity detection of UDG by relying solely on a single UDG enzyme.

[0006] The technical solution of this invention is implemented as follows:

[0007] A first aspect of the present invention is to provide a single-enzyme activated CRISPR-Cas12a nanodetection system based on a dsDNA substrate, comprising a dsDNA substrate, a CRISPR-Cas12a ribonucleoprotein complex, and a fluorescent reporter probe; wherein the CRISPR-Cas12a ribonucleoprotein complex is assembled from Cas12a protein and crRNA; wherein the dsDNA substrate comprises a target strand and a non-target strand; wherein the target strand contains a complementary sequence paired with the crRNA; and wherein the non-target strand contains at least one U base and a vesicular sequence non-complementary to the target strand.

[0008] Furthermore, the non-target chain comprises at least two consecutive or non-consecutive bases U.

[0009] Furthermore, the size of the vesicular sequence is 4-10 nt; and / or, the vesicular sequence is located at the corresponding position of the complementary sequence paired with the crRNA, 2-10 bases away from the 3' end.

[0010] Furthermore, the nucleotide sequence of the target chain is shown in SEQ ID NO: 1; And / or, the non-target chain is selected from any one of the nucleotide sequences shown in SEQ ID NO: 2-6; And / or, the nucleotide sequence of the crRNA is shown in SEQ ID NO: 7; And / or, the nucleotide sequence of the fluorescent reporter probe is shown in SEQ ID NO: 8.

[0011] Furthermore, the CRISPR-Cas12a ribonucleoprotein complex is assembled using a Cas12a protein to crRNA molar ratio of 2:1; and / or, the dsDNA substrate is formed by annealing at a temperature of 1:2 molar ratio of target strand to non-target strand.

[0012] A second aspect of the present invention is to provide the application of the nanodetection system described in the first aspect in the preparation of uracil-DNA glycosylation enzyme detection products.

[0013] Furthermore, the detection products include reagent kits, test strips, or chips.

[0014] A third aspect of the present invention is to provide a uracil-DNA glycosylation enzyme detection kit comprising the nanodetection system described in the first aspect.

[0015] A fourth aspect of the present invention is to provide a uracil-DNA glycosylation enzyme live cell imaging detection system, comprising a dsDNA substrate, a fluorescent probe, a Cas12a expression vector, liposomes, and a fluorescent dye; wherein the dsDNA substrate and the fluorescent probe are the same as those in the nanodetection system described in the first aspect.

[0016] A fifth aspect of the present invention is to provide a method for detecting uracil-DNA glycosylation enzyme for non-diagnostic purposes, wherein the sample is detected using the nanodetection system described in the first aspect.

[0017] Furthermore, the sample is a cell lysate.

[0018] Compared with the prior art, the beneficial effects of the present invention are as follows: The detection system provided by this invention designs dsDNA containing a target strand (TS) and a non-target strand (NTS), and sets a non-complementary vesicular sequence on the non-target strand. When the UDG enzyme cleaves uracil, the resulting AP site locally amplifies this "vesicular" structure, thereby providing an energy-feasible "foothold" for crRNA invasion. It dynamically "turns on" the switch, realizing direct activation of UDG by a single enzyme, fundamentally suppressing background signals, and achieving high sensitivity and high accuracy detection of UDG.

[0019] The detection system provided by this invention has a direct signal and low background, and can be used to construct a cell imaging system to monitor the activity of UDG in cells in real time and perform fluorescence imaging. It is suitable for early tumor diagnosis, drug screening, DNA repair mechanism research, etc., and has significant application prospects. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1 This is a schematic diagram illustrating the structural composition and working principle of the nanosystem described in this invention.

[0022] Figure 2 The results show the UDG response verification and leakage assessment of the nanosystem designed in this embodiment of the invention.

[0023] Figure 3 This presents the performance results of the follicle structure optimization process for dsDNA using the fitted material in this embodiment of the invention.

[0024] Figure 4 This is the result of the nanosystem's ability to distinguish the presence or absence of UDG at different reaction temperatures and different RNP concentrations in the embodiments of the present invention.

[0025] Figure 5 This is the result of the influence of the number and location of different U sites on the detection limit in the embodiments of the present invention.

[0026] Figure 6 The results of the detection limit analysis of the system using NTS-UTU in this embodiment of the invention are shown.

[0027] Figure 7 The results of the nanosystem activity analysis on cell lysate UDG in this embodiment of the invention are shown.

[0028] Figure 8These are UDG fluorescence imaging images of cells in an embodiment of the present invention. Detailed Implementation

[0029] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0030] This invention provides a single-enzyme activated CRISPR-Cas12a nanosystem based on finely balanced dsDNA substrates for highly sensitive detection of UDG and live-cell imaging. The nanosystem comprises: (1) Finely balanced dsDNA substrate: formed by annealing one target strand (TS) and one non-target strand (NTS). Its design includes the following features: The target strand (TS) contains a complementary sequence that pairs with the crRNA;

[0031] The non-target chain (NTS) contains at least one U base and a "bubble-like" structure that is not complementary to the target chain (TS): a sequence that is not complementary to the TS is artificially designed on the NTS chain to form a single-chain "bubble". The size and position of this "bubble" are thermodynamically calculated and designed to keep it in a metastable state of "fine equilibrium".

[0032] (2) CRISPR-Cas12a ribonucleoprotein complex (RNP): It is assembled from Cas12a protein and crRNA and has trans-cleavage activity.

[0033] (3) Fluorescent reporter probe: FAM / BHQ labeled single-stranded DNA, used for signal output.

[0034] The working principle of the above-mentioned nanosystem in the UDG detection process is as follows: Figure 1 As shown, specifically: ① In the absence of UDG: dsDNA substrate is in a state of "fine equilibrium", with a stable structure, crRNA cannot invade, Cas12a remains inert, and the fluorescence signal is quenched; ② In the presence of UDG: UDG recognizes and cleaves uracil, generating abase-free sites (AP sites), disrupting substrate structural equilibrium, forming a "foothold" for crRNA invasion, lowering the energy barrier, triggering a strand displacement reaction between crRNA and substrate, activating Cas12a trans-cleavage activity, cleaving the fluorescent probe, and releasing a fluorescent signal. Using liposomes to load plasmids encoding Cas12a, dsDNA substrates, and probes, and transfecting cells, fluorescence imaging of intracellular UDG activity can be achieved.

[0035] In a preferred embodiment, the non-target strand (NTS) contains one, two, or three U bases. When it contains multiple U bases, they can be continuous or discontinuous, such as UUU, UTU, TUU, or UTT. For NTS strands containing U, AP sites are formed after UDG treatment.

[0036] In a preferred embodiment, the vesicular structure is located at the corresponding position of the complementary sequence to the crRNA, 2-10 bases from the 3' end. The size of the vesicular sequence is 4-10 nt. The position and size of the vesicular sequence provide thermodynamic stability, and more importantly, provide space for the Toehold-mediated strand migration reaction of the crRNA, reducing the kinetic energy barrier of the reaction.

[0037] In a preferred embodiment, the dsDNA is constructed with a non-target strand (NTS) to target strand (TS) molar ratio of 2:1, and a stable dsDNA substrate is formed after annealing at elevated temperature.

[0038] In a preferred embodiment, when the nanosystem is applied to UDG detection, the concentration of the RNP is preferably 17-35 nM, the concentration of the fluorescent probe is preferably 200 nM, and the detection temperature is 25-45℃, preferably 37℃.

[0039] In a preferred embodiment, the nucleotide sequence of the target strand (TS) is shown in SEQ ID NO: 1; the non-target strand is selected from any one of the nucleotide sequences shown in SEQ ID NO: 2-6, preferably SEQ ID NO: 3; the nucleotide sequence of the crRNA is shown in SEQ ID NO: 7; and the nucleotide sequence of the fluorescent reporter probe is shown in SEQ ID NO: 8.

[0040] In the above embodiments, the nanosystem can achieve as low as 10 -7 With a detection limit on the order of U / mL, the detection sensitivity is significantly improved; and it also has a signal-to-background ratio of 1840 times.

[0041] This invention also provides a live-cell imaging system for UDG, comprising a dsDNA substrate, a fluorescent probe, a Cas12a expression vector, liposomes, and a fluorescent dye; wherein the dsDNA substrate and fluorescent probe are the dsDNA substrate and fluorescent probe in the aforementioned nanosystem. This imaging system enables real-time monitoring of UDG activity in cells and performs fluorescence imaging, making it suitable for early tumor diagnosis, drug screening, and research on DNA repair mechanisms.

[0042] In a preferred embodiment, the imaging system first constructs a CMV-Cas12a expression system using a DNA plasmid vector, prepares a dsDNA substrate, stabilizes it through temperature annealing, and then transfects cells with the CMV-Cas12a expression system and a fluorescent probe using a Lipo8000 liposome. Fluorescence levels are observed after transfection. The cell nuclei are then stained with a fluorescent dye to achieve spatiotemporal dynamic imaging of endogenous UDG.

[0043] Example

[0044] 1. Construction of a single-enzyme activated CRISPR-Cas12a nanosystem based on finely balanced dsDNA substrate

[0045] ①Preparation of finely balanced dsDNA substrates composed of NTS / TS In a 10 μL system, add 1 μL ThermoPol Buffer, 1 μL TS (5 μM), and NTS at different concentration gradients (5 μM, 2 / 3 / 4 / 5 μL, corresponding to 2 / 3 / 4 / 5x respectively). Make up any shortfall with ddH2O. After centrifuging the above solution, react at 95 °C for 3 minutes, then at 55 °C for 3 minutes, and finally allow to cool naturally to 37 °C to form a stable double-stranded structure.

[0046] ②Preparation of Cas12a RNP In a 50 μL system, add 5.5 μL NEB r2.1 Buffer, 4.3 μL crRNA (1 μM), and 8.6 μL Cas12a (1 μM). Make up the difference with ddH2O if necessary. Gently centrifuge and mix by pipetting, then incubate at 37°C for 30 min to assemble and form a stable Cas12a RNP.

[0047] ③ Finely balance the reaction of dsDNA substrate with UDG The UDG stock solution was diluted to different concentrations (50 U / ml, 5 U / ml, 0.5 U / ml, 0.05 U / ml, 5 x 10⁻⁶) using 1x ThermolPol Buffer. -3 U / ml, 5x10 -4 U / ml, 5x10 -5 U / ml, 5x10 -6 (U / ml). Add 1 μL of UDG to 10 μL of finely equilibrated dsDNA substrate and incubate at 37°C for 1 h. In this digestion system, the actual UDG concentration used in the reaction is 1 / 10 of the added concentration.

[0048] ④ On-machine testing In a 50 μL loading system, add 5 μL of NEB r2.1 Buffer, 10 μL of the reaction product from step ③, 2.5 / 5 / 7.5 μL of RNP from step ② (corresponding to 0.5 / 1 / 1.5x respectively), and 2 μL of fluorescent probe (5 μM). Make up any shortfall with ddH2O. After centrifugation and remixing, detect FAM fluorescence using a microplate reader (excitation wavelength 485 nm, emission wavelength 525 nm) at isothermal temperatures of 25℃ / 37℃ / 45℃ and analyze the real-time fluorescence curves.

[0049] 2. Selection of dsDNA substrates and system performance

[0050] In this embodiment, the nanosystem was constructed and tested according to the sequence shown in Table 1, and its performance was verified.

[0051] Table 1: name Sequence (5'-3') SEQ ID NO TS GCAGCTATGCTCACCACTATACCACCAACGCTCAAACCCATAAATATGTTATCCTTCCAC 1 NTS-U GTGGAAGGATAACATAUUUATGCTCTCTCTCTGGTTTGAGCGT 2 NTS-UTU GTGGAAGGATAACATAUTUATGCTCTCTCTCTGGTTTGAGCGT 3 NTS-TTU GTGGAAGGATAACATATTUATGCTCTCTCTCTGGTTTGAGCGT 4 NTS-TUU GTGGAAGGATAACATATUUATGCTCTCTCTCTGGTTTGAGCGT 5 NTS-UTT GTGGAAGGATAACATAUTTATGCTCTCTCTCTGGTTTGAGCGT 6 crRNA UAAUUUCUACUAAGUGUAGAUUAUACAUA UUUAUGGGUUUG 7 fluorescent probe FAM-TTATTATT-BHQ 8 NTS-10nt simulator <![CDATA[GTGGAAGGATAACATAAAAATGGG CTCTCTCTCT TTTGAGCGT]]> 9 NTS-8nt simulator <![CDATA[GTGGAAGGATAACATAAAAATGGG CTCTCTCT TTTGAGCGT]]> 10 NTS-6nt simulator <![CDATA[GTGGAAGGATAACATAAAAATGGG CTCTCT TTTGAGCGT]]> 11 NTS-4nt simulator <![CDATA[GTGGAAGGATAACATAAAAATGGG CTCT TTTGAGCGT]]> 12 NTS-position 2 <![CDATA[GTGGAAGGATA ACATATTTATGGGTT CTCTCTCTCT TG AGCGT]]> 13 NTS-position 6 <![CDATA[GTGGAAGGATA ACATATTTATG CTCTCTCTCT GGTTTG AGCGT]]> 14 NTS-position 8 <![CDATA[GTGGAAGGATA ACATATTTA CTCTCTCTCT TGGGTTTG AGCGT]]> 15 NTS-position 10 <![CDATA[GTGGAAGGATA ACATATT CTCTCTCTCT TATGGGTTTG AGCGT]]> 16

[0052] Note: If the sequence provided in the sequence list is inconsistent with Table 1, Table 1 shall prevail.

[0053] In Table 1, TS represents the target strand of dsDNA, which can pair complementaryly with crRNA. NTS represents the non-target strand of dsDNA, and any one of NTS-U, NTS-UTU, NTS-TTU, NTS-TUU, and NTS-UTT represents a non-target strand with different forms of U base distribution.

[0054] The NTS-4 / 6 / 8 / 10nt simulator simulates the mismatch structure formed after UDG processing. Different nt numbers refer to the length of the original mismatch structure (the underlined parts of the sequences in Table 1 represent the corresponding nt numbers). NTS-position 2 / 6 / 8 / 10 is used to optimize the position of the bubble structure, reflecting its relative position. For position 2, the bubble is set at the second base of the 3' region related to crRNA. Position 6 / 8 / 10 indicates that the bubble position has been moved relative to the 5' region (the underlined parts of the sequences in Table 1 represent the crRNA region, and the bolded parts represent the bubble structure sequence; the distance relative to the 3' end can be seen as the number of bases underlined on the right).

[0055] 1) System UDG response verification

[0056] A stable dsDNA substrate was formed by annealing an NTS-U to TS ratio of 2:1 (final system concentration 100 nM) after annealing. After treatment with UDG (enzyme digestion system concentration 5 x 10⁻³ U / ml), it was reacted with 1x RNP (final system concentration 17.2 nM) and a 200 nM fluorescent probe at 37°C. The fluorescence curve formed in the FAM channel was detected using a microplate reader. Figure 2As shown, Figure 2 a shows a schematic diagram of UDG treatment of dsDNA substrate. Figure 2 b is used to compare the system's responsiveness to UDG and leakage. The combination of NTS-U / TS can effectively distinguish the presence or absence of UDG, with a discrimination of approximately 56.03. Figure 2 c. The system's ability to distinguish between the presence and absence of UDG was analyzed when NTS and TS were mixed in different ratios. The NTS concentration was adjusted to 2x, 3x, 4x, and 5x (final system concentration 1x, 100nM). The system showed the best distinguishability when NTS was 2x, reaching 56.03.

[0057] 2) Selection of the size and location of NTS bubble structures

[0058] The vesicle structure of finely balanced dsDNA was optimized using a fitted material. The final NTS concentration was fixed at 200 nM and the final TS concentration at 100 nM. The dsDNA substrate was prepared in advance according to the protocol and digested with UDG (5 x 10⁻⁶ enzyme concentration). -3 After treatment with U / ml, the FAM channel was reacted with 1x RNP (final concentration 17.2 nM) and fluorescent probe (final concentration 200 nM) at 37 °C. The fluorescence curve formed by the FAM channel was detected by a microplate reader and the rise rate of the curve was evaluated. (a) The NTS-4 / 6 / 8 / 10nt simulator was used to analyze the effect of different bubble structure sizes on the reaction rate. Figure 3 (a) Results showed that selecting the sequence corresponding to the NTS-10nt simulator yielded the fastest fluorescence rise rate, and the reaction rate was optimal when the bubble structure was 10nt. (b) NTS-positions 2 / 6 / 8 / 10 were used respectively, and the effects of different bubble positions on the leakage rate were analyzed. Figure 3 Results b show that selecting the bubble structure location corresponding to NTS-position 6 yields the lowest leakage. Notably, Figure 3 As can be seen in b, the effect of the shift of the bubble structure position towards 5' on the leakage efficiency shows a trend of first decreasing and then increasing, rather than a regular gradual increase or decrease.

[0059] 3) The system's ability to distinguish the presence or absence of UDG at different reaction temperatures and RNP concentrations.

[0060] ① Fix NTS to 200 nM and TS to 100 nM. Prepare dsDNA substrate in advance according to the operating protocol, and then process it using UDG (5 x 10⁻⁶ m³ / h). -3 After treatment with U / ml, the FAM channel fluorescence curves were detected and evaluated using an ELISA reader under reaction conditions of 25 / 37 / 45℃ with 2x RNP (17.2nM) and 200nM fluorescent probes, respectively. The curves were also evaluated. Figure 4The results showed that the optimal resolution of 62.25 could be obtained at a reaction temperature of 37℃.

[0061] ② Compare the effects of 0.5 / 1 / 1.5x RNP concentrations on system discrimination, fixing NTS at 200 nM and TS at 100 nM. Prepare dsDNA substrates in advance according to the protocol, and then process them using UDG (5 x 10⁻⁶). -3 After treatment with U / ml, the FAM channel fluorescence curve was detected using a microplate reader at 37℃ and then reacted with 0.5x / 1x (final concentration 17.2uM) / 1.5x RNP concentration and 200nM fluorescent probe at 37℃. The rise rate of the curve was evaluated. Figure 4 As shown in b. The results show that the discrimination index was best at an RNP concentration of 2x, reaching 236.58.

[0062] 4) The effect of the number and location of different U sites modified in the non-target strand (NTS) on the detection limit.

[0063] Different NTS (NTS-U, NTS-UTU, NTS-TTU, NTS-TUU, NTS-UTT) and TS combinations from Table 1 were selected, and the effects of the number and location of different U sites on the detection limit were examined. Results are as follows: Figure 5 As shown. Figure 5 a corresponds to NTS-U, and the system can distinguish 5x10 -6 U / ml and blank group; Figure 5 b corresponds to NTS-TTU, and the system can distinguish 5x10. -4 U / ml and blank group; Figure 5 c corresponds to NTS-TUU, and the system can distinguish 5x10. -5 U / ml and blank group; Figure 5 d corresponds to NTS-UTU, and the system can distinguish 5x10 -7 U / ml and blank group; Figure 5 e corresponds to NTS-UTT, and the system can distinguish 5x10. -5 U / ml and blank group.

[0064] 5) Detection limit analysis

[0065] NTS-UTU was selected as the non-target strand to form dsDNA with TS for detection limit analysis. NTS-UTU was fixed at 200 nM and TS at 100 nM. The dsDNA substrate was prepared in advance according to the protocol, treated with gradient concentrations of UDG, and then reacted with 1x RNP (17.2 nM) and a 200 nM fluorescent probe at 37°C. The fluorescence curve formed in the FAM channel was detected using a microplate reader, and the rate of rise of the curve was evaluated. The validation results are as follows: Figure 6 As shown. Figure 6Figure a shows the fluorescence curves of the system when detecting different concentrations of UDG. Figure 6 b shows the difference in the rate of rise of fluorescence curves among different concentration groups. This clearly demonstrates that the system can analyze 5x10⁻⁵ cells / mL. -7 U / ml UDG.

[0066] 3. UDG activity analysis in cell lysates

[0067] HeLa cells (purchased from Shanghai Zhongqiao Xinzhou Biotechnology Co., Ltd.) were used for cell lysate analysis. After cell plating and overnight adhesion, APE-1 siRNA was transfected using Lipo8000 transfection reagent to knock down intracellular APE-1 levels. Cell lysates were then obtained using RIPA lysis buffer. The lysates were diluted according to cell number and incubated with NTS-UTU / TSdsDNA substrate (37℃). After incubation, the product was reacted with 1x RNP (17.2 nM) and a 200 nM fluorescent probe at 37℃. The fluorescence curve formed in the FAM channel was detected using a microplate reader, and the rate of rise of the curve was evaluated. Figure 7 As shown, Figure 7 A diagram illustrates the workflow for detecting cell lysates. Figure 7 b shows that the level of APE1 in cells was significantly reduced after siRNA intervention; Figure 7 c represents the fluorescence curves for analyzing the activity of UDG in different numbers of cells. The results show that the system can detect UDG obtained from the lysis of one cell. Figure 7 Analysis of the fluorescence curve rise rate shown in d indicates that UDG obtained from one cell lysis can be effectively distinguished from the blank control.

[0068] 4. Nanosystems applied to cellular UDG fluorescence imaging

[0069] A CMV-Cas12a expression system was constructed using the pcDNA3.1 plasmid vector. Following the protocol in Part 1, dsDNA substrate (TS / NTS-UTU) was prepared, stabilized by temperature annealing, and then transfected into cells using Lipo8000 liposomes along with the plasmid and fluorescent probe. The fluorescence level of the FAM channel was observed 6 hours after transfection. Cell nuclei were stained with Hoechst fluorescent dye. Figure 8 As shown, compared with the blank control, the system can achieve fluorescence imaging of intracellular UDG under the condition of APE1 knockdown.

[0070] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A single-enzyme activated CRISPR-Cas12a nanodetection system based on dsDNA substrate, characterized in that, The invention comprises a dsDNA substrate, a CRISPR-Cas12a ribonucleoprotein complex, and a fluorescent reporter probe; the CRISPR-Cas12a ribonucleoprotein complex is assembled from Cas12a protein and crRNA; the dsDNA substrate comprises a target strand and a non-target strand; the target strand contains a complementary sequence that pairs with the crRNA; the non-target strand contains at least one U base and a vesicular sequence that is not complementary to the target strand.

2. The nano-detection system according to claim 1, characterized in that, The non-target chain includes at least two consecutive or non-consecutive bases U.

3. The nano-detection system according to claim 1, characterized in that, The size of the vesicular sequence is 4-10 nt; and / or, the vesicular sequence is located at the corresponding position of the complementary sequence to which the crRNA is paired, and is 2-10 bases away from the 3' end.

4. The nano-detection system according to claim 1, characterized in that, The nucleotide sequence of the target chain is shown in SEQ ID NO: 1; And / or, the non-target chain is selected from any one of the nucleotide sequences shown in SEQ ID NO: 2-6; And / or, the nucleotide sequence of the crRNA is shown in SEQ ID NO: 7; And / or, the nucleotide sequence of the fluorescent reporter probe is shown in SEQ ID NO:

8.

5. The nano-detection system according to claim 1, characterized in that, The CRISPR-Cas12a ribonucleoprotein complex is assembled using a Cas12a protein to crRNA molar ratio of 2:1; and / or the dsDNA substrate is formed by annealing of the target strand and the non-target strand in a 1:2 molar ratio.

6. The application of the nano-detection system according to any one of claims 1-5 in the preparation of uracil-DNA glycosylation enzyme detection products.

7. The application according to claim 6, characterized in that, The testing products include reagent kits, test strips, or chips.

8. A uracil-DNA glycosylation enzyme detection kit, characterized in that, Includes the nanodetection system according to any one of claims 1-5.

9. A uracil-DNA glycosylation enzyme live-cell imaging detection system, characterized in that, It includes a dsDNA substrate, a fluorescent probe, a Cas12a expression vector, liposomes, and a fluorescent dye; wherein the dsDNA substrate and the fluorescent probe are the dsDNA substrate and the fluorescent probe in any one of the nanodetection systems described in claims 1-5.

10. A method for detecting uracil-DNA glycosylation enzyme for non-diagnostic purposes, characterized in that, The sample is detected using the nano-detection system according to any one of claims 1-5.

Images