A venous thrombosis risk gene detection kit based on LAMP technology

By employing LAMP technology and a dual-tube parallel detection system, combined with isothermal amplification using cresol red indicator and Bst DNA polymerase, the problems of primer-probe interference and instrument dependence in venous thrombosis risk gene detection have been solved. This enables simultaneous detection and visual interpretation of polymorphic sites, improving the accuracy and ease of detection.

CN122128425APending Publication Date: 2026-06-02YURUI (XIAMEN) BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610382056.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-26
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

Existing gene detection technologies for venous thrombosis risk have problems such as easy interference between primers and probes, difficulty in simultaneously detecting multiple polymorphic sites, and high dependence on complex detection instruments, making it impossible to achieve visual interpretation of amplification results.

Method used

A venous thrombosis risk gene detection kit based on LAMP technology physically isolates the amplification reactions of wild-type and mutant targets through a dual-tube parallel detection system. Using cresol red as a pH-sensitive indicator, combined with the release of hydrogen ions during the isothermal amplification of Bst DNA polymerase, the amplification signal is visualized and converted, avoiding competitive inhibition and non-specific binding interference between primers and probes.

Benefits of technology

It improves the specificity and accuracy of gene polymorphism detection, enables simultaneous detection of multiple polymorphic sites, and allows for the visualization and interpretation of amplified signals without the need for complex instruments, thus improving the reliability and ease of detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122128425A_ABST
    Figure CN122128425A_ABST
Patent Text Reader

Abstract

This invention relates to the field of gene polymorphism detection technology and discloses a venous thrombosis risk gene detection kit based on LAMP technology. The kit includes primers and probes for detecting polymorphic sites in venous thrombosis risk genes, detection reaction system components, reagent A and reagent B, positive control A, positive control B, and a negative control. Reagent A and reagent B respectively contain matched primers and probes and the detection reaction system components. Reagent A is a 4G, C, AAG, G, or T reaction tube, and reagent B is a corresponding 5G, T, del, A, or C reaction tube. This invention avoids interference between primers and probes by physically isolating reactions of different nucleic acid sequences in independent reagents A and B. Simultaneously, it utilizes polymerase and cresol red to convert changes in system components into color changes, achieving simultaneous visualization and accurate genotyping of multi-target amplification signals without instrument assistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of gene polymorphism detection technology, specifically to a gene detection kit for venous thrombosis risk based on LAMP technology. Background Technology

[0002] Venous thromboembolism (VTE) is a multifactorial disease, with genetic factors playing a significant role in its pathogenesis. Multiple genetic variations are associated with thrombotic susceptibility. PAI-1 gene polymorphisms alter plasma tissue plasminogen activator (TPA) concentrations, increasing the risk of thrombosis. Single nucleotide mutations and deletion mutations in the PROC gene are genetic risk factors for VTE. MTHFR gene polymorphisms reduce the activity of corresponding metabolic enzymes, increasing the risk of thromboembolism. Furthermore, antithrombin deficiency caused by SERPINC1 gene mutations, APOH gene polymorphisms, and activating protein C resistance caused by F5 gene variations are all associated with an increased probability of VTE. Simultaneous screening and genotyping of these multiple thrombosis-related gene polymorphisms have practical clinical value in assisting in the assessment of VTE risk.

[0003] Currently, conventional methods for detecting gene polymorphisms mainly include sequencing, gene chips, high-resolution melting curves, and primer-probe-based polymerase chain reaction (PCR). Sequencing and chip methods suffer from drawbacks such as cumbersome procedures, long detection cycles, and high costs. Traditional nucleic acid amplification detection methods, when performing single-tube multiplex amplification, are prone to competitive inhibition and non-specific binding interference between primers or probes of different nucleic acid sequences. This leads to decreased specificity and typing accuracy for single nucleotide mutations and fragment deletion targets, and makes it difficult to simultaneously detect multiple gene polymorphic sites. Furthermore, most existing gene detection technologies rely on expensive quantitative fluorescence analyzers or complex electrophoresis instruments, making it difficult to operate without equipment assistance in routine experimental environments and to convert nucleic acid amplification signals into color changes that can be directly read by the naked eye for visual interpretation.

[0004] In summary, existing venous thrombosis risk gene detection technologies suffer from drawbacks such as easy interference between primers and probes within the system, difficulty in achieving simultaneous detection of multiple targets, and high dependence on complex detection instruments. Therefore, providing a venous thrombosis risk gene detection kit based on LAMP technology that can avoid primer and probe interference, simultaneously detect multiple polymorphic targets, and has visual interpretation capabilities is a problem that needs to be solved in this field. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention provides a venous thrombosis risk gene detection kit based on LAMP technology. This kit solves the problems of existing gene polymorphism detection technologies, such as the easy interference between different primers and probes leading to decreased specificity, the difficulty in simultaneously and accurately typing multiple polymorphic sites, and the high dependence on complex detection instruments that prevent the visualization and interpretation of amplification results.

[0006] To address the above problems, the present invention provides the following technical solution:

[0007] This invention provides a gene detection kit for venous thrombosis risk based on LAMP technology, employing the following technical solution:

[0008] A gene detection kit for venous thrombosis risk based on LAMP technology, comprising:

[0009] Primers and probes used to detect polymorphic sites in genes that pose a risk of venous thrombosis;

[0010] Detection of components in the reaction system;

[0011] Reagent A and Reagent B;

[0012] Positive control A, positive control B, and negative control;

[0013] The reagent A and the reagent B respectively contain the matched primer probe and the detection reaction system components;

[0014] Wherein, reagent A and reagent B are selected from any one of the following groups:

[0015] Reagent A is a 4G reaction tube, and reagent B is a 5G reaction tube;

[0016] Reagent A is in a C reaction tube, and reagent B is in a T reaction tube;

[0017] Reagent A is an AAG reaction tube, and reagent B is a del reaction tube;

[0018] Reagent A is a G reaction tube, and reagent B is an A reaction tube;

[0019] Reagent A is in reaction tube T, and reagent B is in reaction tube C.

[0020] By adopting the above technical solution, the amplification reactions of wild-type targets and mutant targets are physically isolated in independent reagents A and B due to the use of a dual-tube parallel detection system. This avoids competitive inhibition and non-specific binding interference between different primers and probes in single-tube multiplex amplification. By using reaction tubes set in pairs for specific polymorphic sites, the molecular typing results of single nucleotide polymorphisms and small fragment deletion mutations can be directly determined by comparing the independent specific amplification status of the two tubes. Therefore, the technical effect of improving the specificity and accuracy of typing detection is achieved.

[0021] Preferably, each 17.0 μL of the detection reaction system comprises:

[0022] 50 mM cresol red: 2.0 μL; 8 U / μL Bst DNA polymerase: 2.0 μL; 1 M (NH4)2SO4: 5.0 μL; 1 M dNTP: 1.0 μL; 1 M MgSO3: 2.0 μL; 10× Tween-20: 2.5 μL; 1 M KCl: 2.0 μL; balance ddH2O.

[0023] By employing the above technical solution, utilizing the biochemical mechanism of hydrogen ion release during isothermal amplification of DNA by polymerase, and combining it with cresol red as a pH-sensitive indicator, a low-buffered reaction system was constructed. When specific target amplification occurs, the pH value in the system decreases, triggering the cresol red to change from red to yellow. The specific components and concentration ratios ensure the isothermal amplification activity of the Bst DNA polymerase, while ensuring that the hydrogen production is sufficient to reach the color change threshold of the indicator, achieving a visual conversion of the amplification signal and eliminating dependence on fluorescence detection equipment.

[0024] Preferably, the positive control A is a plasmid containing the wild-type sequence of the venous thrombosis risk gene, the positive control B is a plasmid containing the mutant sequence of the venous thrombosis risk gene, and the negative control is sterile deionized water.

[0025] By adopting the above technical solution, an independent and stable benchmark system is established. The plasmid, as a positive control, possesses physicochemical structural stability and can provide standard nucleic acid sequences to simulate real amplification reactions of homozygous wild-type and homozygous mutant types, thereby monitoring the effectiveness of the kit and eliminating false negatives caused by amplification inhibition. The sterile deionized water, as a negative control, can screen for false positives caused by aerosol contamination or primer dimers in the system.

[0026] Preferably, the venous thrombosis risk gene polymorphism site is the PAI-1 gene 675 4G / 5G site;

[0027] The primers and probes include PAI-1-4G-FIP probe, PAI-1-4G-BIP probe, PAI-1-5G-FIP probe, PAI-1-5G-BIP probe, PAI-1-F primer, and PAI-1-B primer; the PAI-1-4G-FIP probe sequence is SEQ ID NO:01; the PAI-1-4G-BIP probe sequence is SEQ ID NO:02; the PAI-1-5G-FIP probe sequence is SEQ ID NO:03; the PAI-1-5G-BIP probe sequence is SEQ ID NO:04; the PAI-1-F primer sequence is SEQ ID NO:05; and the PAI-1-B primer sequence is SEQ ID NO:06.

[0028] The reagent A is a 4G reaction tube, and the primers and probes contained in the reagent A include PAI-1-4G-FIP probe, PAI-1-4G-BIP probe, PAI-1-F primer and PAI-1-B primer;

[0029] The reagent B is a 5G reaction tube, and the primers and probes contained in the reagent B include PAI-1-5G-FIP probe, PAI-1-5G-BIP probe, PAI-1-F primer and PAI-1-B primer.

[0030] By employing the above technical solution, a specific recognition system was constructed targeting the 675 4G / 5G polymorphic site of the PAI-1 gene. The inner and outer probe sequences were designed based on specific segments of the target sequence, guiding the target to form a stem-loop structure and initiating strand substitution amplification under isothermal conditions. The probes distinguishing between the 4G and 5G alleles were separately assigned to reagents A and B, respectively, achieving dual-tube genotyping of this specific polymorphic site.

[0031] Preferably, the venous thrombosis risk gene polymorphism site is the MTHFR gene 677 C>T site;

[0032] The primers and probes include MTHFR-C-FIP probe, MTHFR-C-BIP probe, MTHFR-T-FIP probe, MTHFR-T-BIP probe, MTHFR-F primer, and MTHFR-B primer; the MTHFR-C-FIP probe sequence is SEQ ID NO:07; the MTHFR-C-BIP probe sequence is SEQ ID NO:08; the MTHFR-T-FIP probe sequence is SEQ ID NO:09; the MTHFR-T-BIP probe sequence is SEQ ID NO:10; the MTHFR-F primer sequence is SEQ ID NO:11; and the MTHFR-B primer sequence is SEQ ID NO:12.

[0033] The reagent A is a C reaction tube, and the primers and probes contained in the reagent A include MTHFR-C-FIP probe, MTHFR-C-BIP probe, MTHFR-F primer and MTHFR-B primer;

[0034] The reagent B is a T-reaction tube, and the primers and probes contained in the reagent B include MTHFR-T-FIP probe, MTHFR-T-BIP probe, MTHFR-F primer and MTHFR-B primer.

[0035] By employing the above technical solution, a specific loop-mediated isothermal amplification sequence combination was configured for the 677 C>T single nucleotide polymorphism site of the MTHFR gene. The C-reaction tube and the T-reaction tube respectively provide independent recognition and strand substitution environments for the corresponding alleles, ensuring the recognition and amplification interpretation of single-base differences.

[0036] Preferably, the polymorphic site of the venous thrombosis risk gene is the PROC gene 565 C>T site;

[0037] The primers and probes include PROC-C-FIP probe, PROC-C-BIP probe, PROC-T-FIP probe, PROC-T-BIP probe, PROC-F primer, and PROC-B primer; the PROC-C-FIP probe sequence is SEQ ID NO:13; the PROC-C-BIP probe sequence is SEQ ID NO:14; the PROC-T-FIP probe sequence is SEQ ID NO:15; the PROC-T-BIP probe sequence is SEQ ID NO:16; the PROC-F primer sequence is SEQ ID NO:17; and the PROC-B primer sequence is SEQ ID NO:18.

[0038] The reagent A is a C reaction tube, and the primers and probes contained in the reagent A include PROC-C-FIP probe, PROC-C-BIP probe, PROC-F primer and PROC-B primer;

[0039] The reagent B is a T-reaction tube, and the primers and probes contained in the reagent B include PROC-T-FIP probe, PROC-T-BIP probe, PROC-F primer and PROC-B primer.

[0040] By adopting the above technical solution and introducing the primers and probes designed for the 565 C>T site of the PROC gene, the amplification of non-target templates can be restricted under isothermal reaction conditions, so that the color development states of reagent A and reagent B can specifically map the objective existence of wild-type C allele and mutant T allele.

[0041] Preferably, the venous thrombosis risk gene polymorphism site is the PROC gene 574_576 delAAG site;

[0042] The primers and probes include PROC-del-FIP probe, PROC-del-BIP probe, PROC-AAG-FIP probe, PROC-AAG-BIP probe, PROC-F1 primer, and PROC-B1 primer; the PROC-del-FIP probe sequence is SEQ ID NO:19; the PROC-del-BIP probe sequence is SEQ ID NO:20; the PROC-AAG-FIP probe sequence is SEQ ID NO:21; the PROC-AAG-BIP probe sequence is SEQ ID NO:22; the PROC-F1 primer sequence is SEQ ID NO:23; and the PROC-B1 primer sequence is SEQ ID NO:24.

[0043] The reagent A is an AAG reaction tube, and the primers and probes contained in the reagent A include PROC-AAG-FIP probe, PROC-AAG-BIP probe, PROC-F1 primer and PROC-B1 primer;

[0044] The reagent B is a del reaction tube, and the primers and probes contained in the reagent B include PROC-del-FIP probe, PROC-del-BIP probe, PROC-F1 primer and PROC-B1 primer.

[0045] By employing the above technical solution, the sequence recognition region was optimized to target the three nucleotide deletion mutations present in the PROC gene. The physical separation of the AAG sequence probe and the del sequence probe in the two-tube system eliminated the interference of template secondary structures caused by fragment deletions in this region, thus improving the reliability of molecular diagnosis of fragment deletion mutations.

[0046] Preferably, the venous thrombosis risk gene polymorphism site is the SERPINC1 gene 5301 G>A site;

[0047] The primers and probes include SERPINC1-G-FIP probe, SERPINC1-G-BIP probe, SERPINC1-A-FIP probe, SERPINC1-A-BIP probe, SERPINC1-F primer, and SERPINC1-B primer; the SERPINC1-G-FIP probe sequence is SEQ ID NO:25; the SERPINC1-G-BIP probe sequence is SEQ ID NO:26; the SERPINC1-A-FIP probe sequence is SEQ ID NO:27; the SERPINC1-A-BIP probe sequence is SEQ ID NO:28; the SERPINC1-F primer sequence is SEQ ID NO:29; and the SERPINC1-B primer sequence is SEQ ID NO:30.

[0048] The reagent A is a G reaction tube, and the primers and probes contained in the reagent A include SERPINC1-G-FIP probe, SERPINC1-G-BIP probe, SERPINC1-F primer and SERPINC1-B primer;

[0049] The reagent B is reaction tube A, and the primers and probes contained in the reagent B include SERPINC1-A-FIP probe, SERPINC1-A-BIP probe, SERPINC1-F primer and SERPINC1-B primer.

[0050] By employing the above technical solution, a targeted strand substitution amplification structure targeting the 5301 G>A site of the SERPINC1 gene was constructed. The primers and probes in reagent A and reagent B mediate targeted continuous synthesis and hydrogen ion release only when the corresponding bases match, thereby achieving specific colorimetric determination of single-base mutations.

[0051] Preferably, the polymorphic site of the venous thrombosis risk gene is the APOH gene 422 T>C site;

[0052] The primers and probes include APOH-T-FIP probe, APOH-T-BIP probe, APOH-C-FIP probe, APOH-C-BIP probe, APOH-F primer, and APOH-B primer; the APOH-T-FIP probe sequence is SEQ ID NO:31; the APOH-T-BIP probe sequence is SEQ ID NO:32; the APOH-C-FIP probe sequence is SEQ ID NO:33; the APOH-C-BIP probe sequence is SEQ ID NO:34; the APOH-F primer sequence is SEQ ID NO:35; and the APOH-B primer sequence is SEQ ID NO:36.

[0053] The reagent A is a T-reaction tube, and the primers and probes contained in the reagent A include APOH-T-FIP probe, APOH-T-BIP probe, APOH-F primer and APOH-B primer;

[0054] The reagent B is a C reaction tube, and the primers and probes contained in the reagent B include APOH-C-FIP probe, APOH-C-BIP probe, APOH-F primer and APOH-B primer.

[0055] By adopting the above technical solution, and by setting multiple probe sequences and distributing them in reagent A and reagent B, the target sequence spatial recognition and localization of the APOH gene 422 T>C site was achieved, ensuring that the system can complete the specific chain extension of a single base site and the color change of the reaction solution only under isothermal conditions.

[0056] Preferably, the venous thrombosis risk gene polymorphism site is the F5 gene 1601 G>A site;

[0057] The primers and probes include F5-G-FIP probe, F5-G-BIP probe, F5-A-FIP probe, F5-A-BIP probe, F5-F primer, and F5-B primer; the F5-G-FIP probe sequence is SEQ ID NO:37; the F5-G-BIP probe sequence is SEQ ID NO:38; the F5-A-FIP probe sequence is SEQ ID NO:39; the F5-A-BIP probe sequence is SEQ ID NO:40; the F5-F primer sequence is SEQ ID NO:41; and the F5-B primer sequence is SEQ ID NO:42.

[0058] The reagent A is a G reaction tube, and the primers and probes contained in the reagent A include F5-G-FIP probe, F5-G-BIP probe, F5-F primer and F5-B primer;

[0059] The reagent B is reaction tube A, and the primers and probes contained in the reagent B include F5-A-FIP probe, F5-A-BIP probe, F5-F primer and F5-B primer.

[0060] By adopting the above technical solution, a set of loop-mediated isothermal amplification primers was designed based on the sequences flanking the 1601 G>A site of the F5 gene. Combined with a dual-tube system, the exponential amplification reaction with G base and A base targets is physically isolated, enabling the system to have typing and colorimetric response capabilities for single-base mutations at susceptible sites.

[0061] This invention provides a gene detection kit for venous thrombosis risk based on LAMP technology. It has the following beneficial effects:

[0062] 1. This invention physically isolates the detection of different nucleic acid sequences in separate reagents A and B by including matched primers, probes, and detection reaction system components in reagents A and B, respectively. This avoids competition, inhibition, and mutual interference between different primers and probes within the system, and improves the amplification specificity of target markers for polymorphic sites of venous thrombosis risk genes and the overall detection accuracy of the kit.

[0063] 2. This invention uses paired primers and probes targeting multiple polymorphic sites of venous thrombosis risk genes and contains them in corresponding reagents A and B, respectively. This enables the LAMP-based venous thrombosis risk gene detection kit to simultaneously cover the amplification detection of multiple targets. By directly comparing the independent specific amplification changes in the two tubes, molecular screening for related single nucleotide polymorphisms and fragment deletion mutations and accurate allele typing are achieved.

[0064] 3. This invention introduces Bst DNA polymerase and cresol red into the components of the detection reaction system. Bst DNA polymerase is used to perform isothermal amplification of polymorphic sites of venous thrombosis risk genes, and cresol red is used to convert the changes in the components of the detection reaction system caused by the release of hydrogen ions during amplification into visible liquid color changes. This achieves the visualization output of amplification signals and the intuitive interpretation of detection results without the need for complex instruments. Attached Figure Description

[0065] Figure 1 This is a schematic diagram illustrating the principle of dual-tube visual typing detection according to an embodiment of the present invention;

[0066] Figure 2The image shows the visualization results of the typing detection of PAI-1 (675 4G / 5G), MTHFR (677 C>T), PROC (565 C>T), PROC (574_576 delAAG), SERPINC1 (5301 G>A), APOH (422 T>C) and F5 (1601 G>A) according to an embodiment of the present invention. Detailed Implementation

[0067] The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0068] Examples 1-7:

[0069] Example 1:

[0070] This embodiment provides a gene detection kit for venous thrombosis risk based on LAMP technology, including the following steps:

[0071] S1. Primers and probes for detecting the 675 4G / 5G site of the PAI-1 gene are provided, and their primer and probe sequences are as follows: PAI-1-4G-FIP probe sequence is shown in SEQ ID NO:01; PAI-1-4G-BIP probe sequence is shown in SEQ ID NO:02; PAI-1-5G-FIP probe sequence is shown in SEQ ID NO:03; PAI-1-5G-BIP probe sequence is shown in SEQ ID NO:04; PAI-1-F primer sequence is shown in SEQ ID NO:05; PAI-1-B primer sequence is shown in SEQ ID NO:06.

[0072] S2. Prepare reagent A (4G reaction tube) for detection by adding the following components in sequence: PAI-1-4G-FIP (1mM) 2.0μL, PAI-1-4G-BIP (1mM) 2.0μL, PAI-1-F (100μM) 2.0μL, PAI-1-B (100μM) 2.0μL, cresol red (50mM) 2.0μL, Bst DNA polymerase (8U / μL) 2.0μL, (NH4)2SO4 (1M) 5.0μL, dNTP (1M) 1.0μL, MgSO3 (1M) 2.0μL, Tween-20 (10×) 2.5μL, KCl (1M) 2.0μL, and then add ddH2O to bring the volume to 17.0μL.

[0073] S3. Prepare reagent B (5G reaction tube) for detection by adding the following components in sequence: PAI-1-5G-FIP (1mM) 2.0μL, PAI-1-5G-BIP (1mM) 2.0μL, PAI-1-F (100μM) 2.0μL, PAI-1-B (100μM) 2.0μL, cresol red (50mM) 2.0μL, Bst DNA polymerase (8U / μL) 2.0μL, (NH4)2SO4 (1M) 5.0μL, dNTP (1M) 1.0μL, MgSO3 (1M) 2.0μL, Tween-20 (10×) 2.5μL, KCl (1M) 2.0μL, and then add ddH2O to bring the volume to 17.0μL.

[0074] S4. Provide positive control A, positive control B and negative control, where positive control A is a plasmid containing the wild-type sequence of PAI-1 gene, positive control B is a plasmid containing the mutant sequence of PAI-1 gene, and negative control is sterile deionized water.

[0075] S5. Combine and package the prepared reagent A (4G reaction tube), reagent B (5G reaction tube), positive control A, positive control B, and negative control to obtain a LAMP-based gene detection kit for detecting the PAI-1 gene 675 4G / 5G site.

[0076] Example 2:

[0077] This embodiment provides a gene detection kit for venous thrombosis risk based on LAMP technology, including the following steps:

[0078] S1. Primers and probes for detecting the 677 C>T site of the MTHFR gene are provided, and their primer and probe sequences are as follows: MTHFR-C-FIP probe sequence is shown in SEQ ID NO:07; MTHFR-C-BIP probe sequence is shown in SEQ ID NO:08; MTHFR-T-FIP probe sequence is shown in SEQ ID NO:09; MTHFR-T-BIP probe sequence is shown in SEQ ID NO:10; MTHFR-F primer sequence is shown in SEQ ID NO:11; MTHFR-B primer sequence is shown in SEQ ID NO:12.

[0079] S2. Prepare reagent A (reaction tube C) for detection by adding the following components in sequence: MTHFR-C-FIP (1mM) 2.0μL, MTHFR-C-BIP (1mM) 2.0μL, MTHFR-F (100μM) 2.0μL, MTHFR-B (100μM) 2.0μL, cresol red (50mM) 2.0μL, Bst DNA polymerase (8U / μL) 2.0μL, (NH4)2SO4 (1M) 5.0μL, dNTP (1M) 1.0μL, MgSO3 (1M) 2.0μL, Tween-20 (10×) 2.5μL, KCl (1M) 2.0μL, and then add ddH2O to bring the volume to 17.0μL.

[0080] S3. Prepare reagent B (T reaction tube) for detection by adding the following components in sequence: MTHFR-T-FIP (1mM) 2.0μL, MTHFR-T-BIP (1mM) 2.0μL, MTHFR-F (100μM) 2.0μL, MTHFR-B (100μM) 2.0μL, cresol red (50mM) 2.0μL, Bst DNA polymerase (8U / μL) 2.0μL, (NH4)2SO4 (1M) 5.0μL, dNTP (1M) 1.0μL, MgSO3 (1M) 2.0μL, Tween-20 (10×) 2.5μL, KCl (1M) 2.0μL, and then add ddH2O to bring the volume to 17.0μL.

[0081] S4. Provide positive control A, positive control B and negative control, where positive control A is a plasmid containing the wild-type sequence of the MTHFR gene, positive control B is a plasmid containing the mutant sequence of the MTHFR gene, and negative control is sterile deionized water.

[0082] S5. Combine and package the prepared reagent A (C reaction tube) and reagent B (T reaction tube), along with positive control A, positive control B, and negative control, to obtain a LAMP-based gene detection kit for detecting the MTHFR gene 677 C>T site.

[0083] Example 3:

[0084] This embodiment provides a gene detection kit for venous thrombosis risk based on LAMP technology, including the following steps:

[0085] S1. Primers and probes for detecting the 565 C>T site of the PROC gene are provided, and their primer and probe sequences are as follows: PROC-C-FIP probe sequence as shown in SEQ ID NO:13; PROC-C-BIP probe sequence as shown in SEQ ID NO:14; PROC-T-FIP probe sequence as shown in SEQ ID NO:15; PROC-T-BIP probe sequence as shown in SEQ ID NO:16; PROC-F primer sequence as shown in SEQ ID NO:17; PROC-B primer sequence as shown in SEQ ID NO:18;

[0086] S2. Prepare reagent A (reaction tube C) for detection by adding the following components in sequence: PROC-C-FIP (1mM) 2.0μL, PROC-C-BIP (1mM) 2.0μL, PROC-F (100μM) 2.0μL, PROC-B (100μM) 2.0μL, cresol red (50mM) 2.0μL, Bst DNA polymerase (8U / μL) 2.0μL, (NH4)2SO4 (1M) 5.0μL, dNTP (1M) 1.0μL, MgSO3 (1M) 2.0μL, Tween-20 (10×) 2.5μL, KCl (1M) 2.0μL, and then add ddH2O to bring the volume to 17.0μL.

[0087] S3. Prepare reagent B (T reaction tube) for detection by adding the following components in sequence: PROC-T-FIP (1mM) 2.0μL, PROC-T-BIP (1mM) 2.0μL, PROC-F (100μM) 2.0μL, PROC-B (100μM) 2.0μL, cresol red (50mM) 2.0μL, Bst DNA polymerase (8U / μL) 2.0μL, (NH4)2SO4 (1M) 5.0μL, dNTP (1M) 1.0μL, MgSO3 (1M) 2.0μL, Tween-20 (10×) 2.5μL, KCl (1M) 2.0μL, and then add ddH2O to bring the volume to 17.0μL.

[0088] S4. Provide positive control A, positive control B and negative control, where positive control A is a plasmid containing the wild-type sequence of the PROC gene, positive control B is a plasmid containing the mutant sequence of the PROC gene, and negative control is sterile deionized water.

[0089] S5. Combine and package the prepared reagent A (C reaction tube) and reagent B (T reaction tube), along with positive control A, positive control B, and negative control, to obtain a LAMP-based gene detection kit for detecting the PROC gene 565 C>T site.

[0090] Example 4:

[0091] This embodiment provides a gene detection kit for venous thrombosis risk based on LAMP technology, including the following steps:

[0092] S1. Primers and probes for detecting the delAAG site at 574_576 of the PROC gene are provided, and their primer and probe sequences are as follows: PROC-del-FIP probe sequence as shown in SEQ ID NO:19; PROC-del-BIP probe sequence as shown in SEQ ID NO:20; PROC-AAG-FIP probe sequence as shown in SEQ ID NO:21; PROC-AAG-BIP probe sequence as shown in SEQ ID NO:22; PROC-F1 primer sequence as shown in SEQ ID NO:23; PROC-B1 primer sequence as shown in SEQ ID NO:24.

[0093] S2. Prepare reagent A (AAG reaction tube) for detection by adding the following components in sequence: PROC-AAG-FIP (1mM) 2.0μL, PROC-AAG-BIP (1mM) 2.0μL, PROC-F1 (100μM) 2.0μL, PROC-B1 (100μM) 2.0μL, cresol red (50mM) 2.0μL, Bst DNA polymerase (8U / μL) 2.0μL, (NH4)2SO4 (1M) 5.0μL, dNTP (1M) 1.0μL, MgSO3 (1M) 2.0μL, Tween-20 (10×) 2.5μL, KCl (1M) 2.0μL, and then add ddH2O to bring the volume to 17.0μL.

[0094] S3. Prepare reagent B (del reaction tube) for detection by adding the following components in sequence: PROC-del-FIP (1mM) 2.0μL, PROC-del-BIP (1mM) 2.0μL, PROC-F1 (100μM) 2.0μL, PROC-B1 (100μM) 2.0μL, cresol red (50mM) 2.0μL, Bst DNA polymerase (8U / μL) 2.0μL, (NH4)2SO4 (1M) 5.0μL, dNTP (1M) 1.0μL, MgSO3 (1M) 2.0μL, Tween-20 (10×) 2.5μL, KCl (1M) 2.0μL, and then add ddH2O to bring the volume to 17.0μL.

[0095] S4. Provide positive control A, positive control B and negative control, wherein positive control A is a plasmid containing the wild-type sequence of the PROC gene, positive control B is a plasmid containing the PROC gene deletion mutant sequence, and negative control is sterile deionized water.

[0096] S5. Combine and package the prepared reagent B (del reaction tube) with reagent A (AAG reaction tube), positive control A, positive control B and negative control to obtain a LAMP-based gene detection kit for detecting the delAAG site of the PROC gene 574_576.

[0097] Example 5:

[0098] This embodiment provides a gene detection kit for venous thrombosis risk based on LAMP technology, including the following steps:

[0099] S1. Primers and probes for detecting the 5301 G>A site of the SERPINC1 gene are provided, and their primer and probe sequences are as follows: SERPINC1-G-FIP probe sequence is shown in SEQ ID NO:25; SERPINC1-G-BIP probe sequence is shown in SEQ ID NO:26; SERPINC1-A-FIP probe sequence is shown in SEQ ID NO:27; SERPINC1-A-BIP probe sequence is shown in SEQ ID NO:28; SERPINC1-F primer sequence is shown in SEQ ID NO:29; SERPINC1-B primer sequence is shown in SEQ ID NO:30.

[0100] S2. Prepare reagent A (G reaction tube) for detection by adding the following components in sequence: SERPINC1-G-FIP (1mM) 2.0μL, SERPINC1-G-BIP (1mM) 2.0μL, SERPINC1-F (100μM) 2.0μL, SERPINC1-B (100μM) 2.0μL, cresol red (50mM) 2.0μL, Bst DNA polymerase (8U / μL) 2.0μL, (NH4)2SO4 (1M) 5.0μL, dNTP (1M) 1.0μL, MgSO3 (1M) 2.0μL, Tween-20 (10×) 2.5μL, KCl (1M) 2.0μL, and then add ddH2O to bring the volume to 17.0μL.

[0101] S3. Prepare reagent B (reaction tube A) for detection by adding the following components in sequence: SERPINC1-A-FIP (1mM) 2.0μL, SERPINC1-A-BIP (1mM) 2.0μL, SERPINC1-F (100μM) 2.0μL, SERPINC1-B (100μM) 2.0μL, cresol red (50mM) 2.0μL, Bst DNA polymerase (8U / μL) 2.0μL, (NH4)2SO4 (1M) 5.0μL, dNTP (1M) 1.0μL, MgSO3 (1M) 2.0μL, Tween-20 (10×) 2.5μL, KCl (1M) 2.0μL, and then add ddH2O to bring the volume to 17.0μL.

[0102] S4. Provide positive control A, positive control B and negative control, where positive control A is a plasmid containing the wild-type sequence of the SERPINC1 gene, positive control B is a plasmid containing the mutant sequence of the SERPINC1 gene, and negative control is sterile deionized water.

[0103] S5. Combine and package the prepared reagent A (G reaction tube) and reagent B (A reaction tube), as well as positive control A, positive control B and negative control, to obtain a LAMP-based gene detection kit for detecting the 5301 G>A site of the SERPINC1 gene.

[0104] Example 6:

[0105] This embodiment provides a gene detection kit for venous thrombosis risk based on LAMP technology, including the following steps:

[0106] S1. Primers and probes for detecting the 422 T>C site of the APOH gene are provided, and their primer and probe sequences are as follows: APOH-T-FIP probe sequence as shown in SEQ ID NO:31; APOH-T-BIP probe sequence as shown in SEQ ID NO:32; APOH-C-FIP probe sequence as shown in SEQ ID NO:33; APOH-C-BIP probe sequence as shown in SEQ ID NO:34; APOH-F primer sequence as shown in SEQ ID NO:35; APOH-B primer sequence as shown in SEQ ID NO:36.

[0107] S2. Prepare reagent A (T reaction tube) for detection by adding the following components in sequence: APOH-T-FIP (1mM) 2.0μL, APOH-T-BIP (1mM) 2.0μL, APOH-F (100μM) 2.0μL, APOH-B (100μM) 2.0μL, cresol red (50mM) 2.0μL, Bst DNA polymerase (8U / μL) 2.0μL, (NH4)2SO4 (1M) 5.0μL, dNTP (1M) 1.0μL, MgSO3 (1M) 2.0μL, Tween-20 (10×) 2.5μL, KCl (1M) 2.0μL, and then add ddH2O to bring the volume to 17.0μL.

[0108] S3. Prepare reagent B (reaction tube C) for detection by adding the following components in sequence: APOH-C-FIP (1mM) 2.0μL, APOH-C-BIP (1mM) 2.0μL, APOH-F (100μM) 2.0μL, APOH-B (100μM) 2.0μL, cresol red (50mM) 2.0μL, Bst DNA polymerase (8U / μL) 2.0μL, (NH4)2SO4 (1M) 5.0μL, dNTP (1M) 1.0μL, MgSO3 (1M) 2.0μL, Tween-20 (10×) 2.5μL, KCl (1M) 2.0μL, and then add ddH2O to bring the volume to 17.0μL.

[0109] S4. Provide positive control A, positive control B and negative control, wherein positive control A is a plasmid containing the wild-type sequence of the APOH gene, positive control B is a plasmid containing the mutant sequence of the APOH gene, and negative control is sterile deionized water;

[0110] S5. Combine and package the prepared reagent A (T reaction tube) and reagent B (C reaction tube), along with positive control A, positive control B, and negative control, to obtain a LAMP-based gene detection kit for detecting the APOH gene 422 T>C site.

[0111] Example 7:

[0112] This embodiment provides a gene detection kit for venous thrombosis risk based on LAMP technology, including the following steps:

[0113] S1. Primers and probes for detecting the 1601 G>A site of the F5 gene are provided, and their primer and probe sequences are as follows: F5-G-FIP probe sequence as shown in SEQ ID NO:37; F5-G-BIP probe sequence as shown in SEQ ID NO:38; F5-A-FIP probe sequence as shown in SEQ ID NO:39; F5-A-BIP probe sequence as shown in SEQ ID NO:40; F5-F primer sequence as shown in SEQ ID NO:41; F5-B primer sequence as shown in SEQ ID NO:42.

[0114] S2. Prepare reagent A (G reaction tube) for detection by adding the following components in sequence: F5-G-FIP (1mM) 2.0μL, F5-G-BIP (1mM) 2.0μL, F5-F (100μM) 2.0μL, F5-B (100μM) 2.0μL, cresol red (50mM) 2.0μL, Bst DNA polymerase (8U / μL) 2.0μL, (NH4)2SO4 (1M) 5.0μL, dNTP (1M) 1.0μL, MgSO3 (1M) 2.0μL, Tween-20 (10×) 2.5μL, KCl (1M) 2.0μL, and then add ddH2O to bring the volume to 17.0μL.

[0115] S3. Prepare reagent B (reaction tube A) for detection by adding the following components in sequence: F5-A-FIP (1mM) 2.0μL, F5-A-BIP (1mM) 2.0μL, F5-F (100μM) 2.0μL, F5-B (100μM) 2.0μL, cresol red (50mM) 2.0μL, Bst DNA polymerase (8U / μL) 2.0μL, (NH4)2SO4 (1M) 5.0μL, dNTP (1M) 1.0μL, MgSO3 (1M) 2.0μL, Tween-20 (10×) 2.5μL, KCl (1M) 2.0μL, and then add ddH2O to bring the volume to 17.0μL.

[0116] S4. Provide positive control A, positive control B and negative control, where positive control A is a plasmid containing the wild-type sequence of the F5 gene, positive control B is a plasmid containing the mutant sequence of the F5 gene, and negative control is sterile deionized water.

[0117] S5. Combine and package the prepared reagent A (G reaction tube) and reagent B (A reaction tube), as well as positive control A, positive control B and negative control, to obtain a LAMP-based gene detection kit for detecting the F5 gene 1601 G>A site.

[0118] Test example:

[0119] Experimental description:

[0120] This experiment aims to verify the effectiveness of the kits provided in the aforementioned embodiments in genotyping polymorphisms of genes related to venous thrombosis risk. This method employs a dual-tube parallel detection mode, pre-adding cresol red as an indicator to the system to convert microscopic nucleic acid amplification signals into macroscopic color changes visible to the naked eye, thereby achieving genotyping of single nucleotide polymorphisms or fragment deletion mutations.

[0121] Reference Figure 1 The diagram shown illustrates the genotyping detection method: Figure 1 The upper part shows the initial state before amplification, where the WT tube represents the wild-type primer reaction tube (reagent A) and the MUT tube represents the mutant primer reaction tube (reagent B). Before amplification, the liquid in both tubes is red. Under isothermal amplification conditions of 60℃ and 30min, if the target gene amplification occurs, the liquid in the tube changes from red to yellow. Figure 1 The lower half shows the expected response results for three common clinical genotypes: For homozygous wild-type samples, the wild-type reaction tube (WT tube) amplifies and turns yellow, while the mutant reaction tube (MUT tube) does not amplify and remains red; for homozygous mutant samples, the WT tube remains red, while the MUT tube amplifies and turns yellow; for heterozygous samples, both the WT and MUT tubes amplify and both turn yellow.

[0122] Experimental steps:

[0123] Genomic DNA was extracted from the clinical sample to be tested as a template;

[0124] Use a pipette to take 1 μL of the extracted sample nucleic acid, as well as the positive control A, positive control B and negative control taken from the kit, and add them to the corresponding detection duplex reaction tubes prepared in each example.

[0125] Cover the tube and vortex to mix for 5-10 seconds. Then place it in a handheld centrifuge and centrifuge at 10,000 rpm for 5-10 seconds to collect the liquid from the tube wall to the bottom of the tube.

[0126] Each group of fully sealed reaction tubes was placed in a constant temperature heating device such as a metal bath, and isothermal amplification was performed at 60℃ for 30 minutes. After amplification, the reaction was immediately terminated at 85℃ for 5 minutes to inactivate the polymerase.

[0127] After the reaction procedure is completed, remove all reaction tubes and observe the final color of the liquid in each reaction tube directly with the naked eye under natural light, and record the analysis results.

[0128] Experimental data:

[0129] The specific color development results of the target genes corresponding to each embodiment under different template conditions all showed a consistent regularity, and the specific data statistics are shown in Table 1.

[0130] Table 1. Results of Visualized Genotyping Detection of Genes Targeting Venous Thrombosis Risk

[0131] Target gene categories Template nucleic acid type Wild-type primer reaction tube color development (Reagent A) The mutant primer reaction tube showed color development (reagent B). Actual genotyping determination PAI-1, MTHFR, PROC, SERPINC1, APOH and F5 Clinical homozygous wild-type sample / positive control A yellow red Pure wild type PAI-1, MTHFR, PROC, SERPINC1, APOH and F5 Clinical homozygous mutant sample / positive quality control B red yellow homozygous mutant PAI-1, MTHFR, PROC, SERPINC1, APOH and F5 Clinical heterozygous samples yellow yellow Hybrid PAI-1, MTHFR, PROC, SERPINC1, APOH and F5 negative control red red Target-free amplification

[0132] Experimental conclusion:

[0133] Refer to Table 1 and its appendix Figure 2 The document details the visualized genotyping results for venous thrombosis risk target genes (PAI-1, MTHFR, PROC, SERPINC1, APOH, and F5) in each embodiment. (See attached document.) Figure 2 As shown in the figure, the horizontal "Template" represents different amplification templates added in the reaction, and the vertical "Primers" represents the corresponding primer reaction tubes. The specific verification and genotyping results are as follows:

[0134] When clinical homozygous wild-type samples or positive quality control A are used as amplification templates ( Figure 2 When labeled WT, the wild-type primer reaction tube covering all tested gene loci is reagent A. Figure 2 The middle primer (labeled WT) amplifies and turns yellow; the corresponding mutant primer reaction tube is reagent B. Figure 2 The primers labeled MUT (some genes contain MUT1 / MUT2) did not amplify and appeared in red. Based on the criteria in Table 1, this result was determined to be homozygous wild-type. When a clinically homozygous mutant sample or positive control B was used as the amplification template ( Figure 2 When the primers for each gene locus are labeled MUT, the reaction tubes (reagent B) for the mutant primers change color to yellow, while the corresponding wild-type primers (reagent A) remain red. Based on Table 1, this indicates a homozygous mutant. When sterile deionized water is used as the negative control template (…),… Figure 2 When the target amplification is marked as NC, all reaction tubes remain red and show no target amplification. In addition, referring to the genotyping judgment logic in Table 1, when the nucleic acid template is a clinical heterozygous sample, both reagent A and reagent B tubes amplify and turn yellow, indicating heterozygosity.

[0135] The above verification results demonstrate that, for multiple venous thrombosis susceptibility gene loci, this kit can achieve target recognition and colorimetric differentiation in a closed detection system, and the added centrifugation and 85℃ inactivation steps ensure the stability of the detection results.

[0136] Appendix: Primers and probes for PAI-1 (675 4G / 5G):

[0137] SEQ ID NO:01:

[0138] GGGGTTACACGTGTCCAGACTCCAACCTCAGCCAGATTTC。

[0139] SEQ ID NO:02:

[0140] CCCCATTGAGTCAGCCGTGTATCACTCTTGGTCTTTCCAAT。

[0141] SEQ ID NO:03:

[0142] GGGGGTTACACGTGTCCAGACTCCAACCTCAGCCAGAGAAT。

[0143] SEQ ID NO:04:

[0144] CCCCTTTGGAGTCAGCCGTGTATCACTCTTGGTCTTTCCCAACG。

[0145] SEQ ID NO:05:

[0146] AGAACAGCTCCAACATTC。

[0147] SEQ ID NO:06:

[0148] AGCCAGTAACGTGATTGTACTA。

[0149] Primers and probes for PROC (565 C>T):

[0150] SEQ ID NO:07:

[0151] CACTGCCGCAGACACCTTCTCCTGGAGCTTTGAGGCTAATT。

[0152] SEQ ID NO:08:

[0153] GATCCTTCATCATCACGCAGCTTGCCTTCACAAAGCGCTCT。

[0154] SEQ ID NO:09:

[0155] TACCGCGCAGACACCTTCTCCTGGAGCTTTGAGGCTACTT。

[0156] SEQ ID NO:10:

[0157] ATCATTTTCATCATCACGCAGCTTGCCTTCACAAAGCGATTC。

[0158] SEQ ID NO:11:

[0159] GTTACCCCAAAGGCACTT。

[0160] SEQ ID NO:12:

[0161] AGTGATGCCCATGTCCTA。

[0162] Primers and probes for PROC (565 C>T):

[0163] SEQ ID NO:13:

[0164] CTTAGCCAGGGCCTTCCACCAGTCTCGGGAGGACTT。

[0165] SEQ ID NO:14:

[0166] GAATCTGGAGAAGCGCAGTCGATCTACTTGGTCTTCTCTTC。

[0167] SEQ ID NO:15:

[0168] TTTACCCAGGGCCTTCCACCAGTCTCGGGAGGAATT。

[0169] SEQ ID NO:16:

[0170] ATTAATGGAGAAGCGCAGTCGATCTACTTGGTCTTCTACAC。

[0171] SEQ ID NO:17:

[0172] AGTCTCGGGAGGAAATT。

[0173] SEQ ID NO:18:

[0174] GGTCATCTTCCCATCACCAC。

[0175] Primers and probes for PROC (574_576 delAAG):

[0176] SEQ ID NO:19:

[0177] AAGAATTCCATCCGCTTCCAGGACCTCTGCCTACCTTTAA。

[0178] SEQ ID NO:20:

[0179] TTCCCAAGCAGTCACCTGAAACGCGCGGATCTACTTGCCAA。

[0180] SEQ ID NO:21:

[0181] AAGAAGACCTTTCTCCATCCGCTTCCAGGACCTCTGCCTACCTCACA。

[0182] SEQ ID NO:22:

[0183] TTCTTCCCTAAGCGCAGTCACCTGAAACGCGCGGATCTACTTCTTGCGAA。

[0184] SEQ ID NO:23:

[0185] GGAGGAGGACCAAGCGC。

[0186] SEQ ID NO:24:

[0187] GGTCATCTTCCCATCATTCC。

[0188] SERPINC1 (5301 G>A) in the following:

[0189] SEQ ID NO:25:

[0190] GCCTATTTCAAGTGCTCTCCCTCCGTTTCTTAGGCTAGGGTGGT。

[0191] SEQ ID NO:26:

[0192] CACACTTCCAAAACAGGTCTTTGACACAGGAATGACCTCCTGT。

[0193] SEQ ID NO:27:

[0194] ACCAATTCAAGTGCTCTCCCTCCGTTTCTTAGGCTAGGGTGGT。

[0195] SEQ ID NO:28:

[0196] TCCACTTCCAAACAGGTCTTTGACACAGGAATGACCTCTTGT。

[0197] SEQ ID NO:29:

[0198] TTCCTGCACAGCATCTACTT。

[0199] SEQ ID NO:30:

[0200] GTTTTGTGACCTCCAATCCT。

[0201] Primers and probes for APOH (422 T>C):

[0202] SEQ ID NO:31:

[0203] TAATCCCCTCTACCATCCATATTTCCATCTGATGGGAAT。

[0204] SEQ ID NO:32:

[0205] ATTACGGCTGGGAAAAGAAATTCTGGAAAGAGTGTACCAC。

[0206] SEQ ID NO:33:

[0207] CGGACCCCTCTACCATCCATATTTCCATCTGATGGGAAT。

[0208] SEQ ID NO:34:

[0209] GCCACTGGCTGGGAAAAGAAATTCTGGAAAGAGTGTAAACT。

[0210] SEQ ID NO:35:

[0211] CGATAGAGGGAATTGAAAG。

[0212] SEQ ID NO:36:

[0213] TCTCAAGTTTATCCTTACCA。

[0214] Primers and probes for F5 (1601 G>A):

[0215] SEQ ID NO:37:

[0216] GTCCAATACAGGTATTTTGTCCGTTCTAGCCAGAAGATTCA。

[0217] SEQ ID NO:38:

[0218] AGCAATGTCTAGGGATCTGGGACATCATGAGAGGATC。

[0219] SEQ ID NO:39:

[0220] ATTCCAATACAGGTATTTTGTCCGTTCTAGCCAGAAGATTAA。

[0221] SEQ ID NO:40:

[0222] TACGGTGTCTAGGGATCTGGGACATCATGAGAGACTC。

[0223] SEQ ID NO:41:

[0224] CATTATTTAGCCAGGCTGC。

[0225] SEQ ID NO:42:

[0226] TTAACAAGACCATACTCAGT。

Claims

1. A gene detection kit for venous thrombosis risk based on LAMP technology, characterized in that, include: Primers and probes used to detect polymorphic sites in genes that pose a risk of venous thrombosis; Detection of components in the reaction system; Reagent A and Reagent B; Positive control A, positive control B, and negative control; The reagent A and the reagent B respectively contain the matched primer probe and the detection reaction system components; Wherein, reagent A and reagent B are selected from any one of the following groups: Reagent A is a 4G reaction tube, and reagent B is a 5G reaction tube; Reagent A is in a C reaction tube, and reagent B is in a T reaction tube; Reagent A is an AAG reaction tube, and reagent B is a del reaction tube; Reagent A is a G reaction tube, and reagent B is an A reaction tube; Reagent A is in reaction tube T, and reagent B is in reaction tube C.

2. The venous thrombosis risk gene detection kit based on LAMP technology according to claim 1, characterized in that, Each 17.0 μL of the detection reaction system comprises: 50 mM cresol red: 2.0 μL; Bst DNA polymerase at a concentration of 8 U / μL: 2.0 μL; 5.0 μL of 1 M (NH4)2SO4; dNTP concentration of 1M: 1.0 μL; 1M MgSO3: 2.0 μL; Tween-20 at a concentration of 10×: 2.5 μL; 2.0 μL of 1 M KCl; The balance is ddH2O.

3. The venous thrombosis risk gene detection kit based on LAMP technology according to claim 1, characterized in that, The positive control A is a plasmid containing the wild-type sequence of the venous thrombosis risk gene, the positive control B is a plasmid containing the mutant sequence of the venous thrombosis risk gene, and the negative control is sterile deionized water.

4. The venous thrombosis risk gene detection kit based on LAMP technology according to claim 1, characterized in that, The polymorphic site of the venous thrombosis risk gene is the PAI-1 gene 675 4G / 5G site; The primers and probes include PAI-1-4G-FIP, PAI-1-4G-BIP, PAI-1-5G-FIP, PAI-1-5G-BIP, PAI-1-F primers, and PAI-1-B primers; the PAI-1-4G-FIP probe sequence is shown in SEQ ID NO:01; the PAI-1-4G-BIP probe sequence is shown in SEQ ID NO:02; the PAI-1-5G-FIP probe sequence is shown in SEQ ID NO:03; the PAI-1-5G-BIP probe sequence is shown in SEQ ID NO:04; the PAI-1-F primer sequence is shown in SEQ ID NO:05; and the PAI-1-B primer sequence is shown in SEQ ID NO:

06. The reagent A is a 4G reaction tube, and the primers and probes contained in the reagent A include PAI-1-4G-FIP probe, PAI-1-4G-BIP probe, PAI-1-F primer and PAI-1-B primer; The reagent B is a 5G reaction tube, and the primers and probes contained in the reagent B include PAI-1-5G-FIP probe, PAI-1-5G-BIP probe, PAI-1-F primer and PAI-1-B primer.

5. The venous thrombosis risk gene detection kit based on LAMP technology according to claim 1, characterized in that, The polymorphic site of the venous thrombosis risk gene is the MTHFR gene 677 C>T site; The primers and probes include MTHFR-C-FIP probes, MTHFR-C-BIP probes, MTHFR-T-FIP probes, MTHFR-T-BIP probes, MTHFR-F primers, and MTHFR-B primers; the MTHFR-C-FIP probe sequence is shown in SEQ ID NO:07; the MTHFR-C-BIP probe sequence is shown in SEQ ID NO:08; the MTHFR-T-FIP probe sequence is shown in SEQ ID NO:09; the MTHFR-T-BIP probe sequence is shown in SEQ ID NO:10; the MTHFR-F primer sequence is shown in SEQ ID NO:11; and the MTHFR-B primer sequence is shown in SEQ ID NO:

12. The reagent A is a C reaction tube, and the primers and probes contained in the reagent A include MTHFR-C-FIP probe, MTHFR-C-BIP probe, MTHFR-F primer and MTHFR-B primer; The reagent B is a T-reaction tube, and the primers and probes contained in the reagent B include MTHFR-T-FIP probe, MTHFR-T-BIP probe, MTHFR-F primer and MTHFR-B primer.

6. The venous thrombosis risk gene detection kit based on LAMP technology according to claim 1, characterized in that, The polymorphic site of the venous thrombosis risk gene is the PROC gene 565 C>T site; The primers and probes include PROC-C-FIP probes, PROC-C-BIP probes, PROC-T-FIP probes, PROC-T-BIP probes, PROC-F primers, and PROC-B primers; the PROC-C-FIP probe sequence is shown in SEQ ID NO:13; the PROC-C-BIP probe sequence is shown in SEQ ID NO:14; the PROC-T-FIP probe sequence is shown in SEQ ID NO:15; the PROC-T-BIP probe sequence is shown in SEQ ID NO:16; the PROC-F primer sequence is shown in SEQ ID NO:17; and the PROC-B primer sequence is shown in SEQ ID NO:

18. The reagent A is a C reaction tube, and the primers and probes contained in the reagent A include PROC-C-FIP probe, PROC-C-BIP probe, PROC-F primer and PROC-B primer; The reagent B is a T-reaction tube, and the primers and probes contained in the reagent B include PROC-T-FIP probe, PROC-T-BIP probe, PROC-F primer and PROC-B primer.

7. The venous thrombosis risk gene detection kit based on LAMP technology according to claim 1, characterized in that, The polymorphic site of the venous thrombosis risk gene is the PROC gene 574_576 delAAG site; The primers and probes include PROC-del-FIP probe, PROC-del-BIP probe, PROC-AAG-FIP probe, PROC-AAG-BIP probe, PROC-F1 primer, and PROC-B1 primer; the PROC-del-FIP probe sequence is shown in SEQ ID NO:19; the PROC-del-BIP probe sequence is shown in SEQ ID NO:20; the PROC-AAG-FIP probe sequence is shown in SEQ ID NO:21; the PROC-AAG-BIP probe sequence is shown in SEQ ID NO:22; the PROC-F1 primer sequence is shown in SEQ ID NO:23; and the PROC-B1 primer sequence is shown in SEQ ID NO:

24. The reagent A is an AAG reaction tube, and the primers and probes contained in the reagent A include PROC-AAG-FIP probe, PROC-AAG-BIP probe, PROC-F1 primer and PROC-B1 primer; The reagent B is a del reaction tube, and the primers and probes contained in the reagent B include PROC-del-FIP probe, PROC-del-BIP probe, PROC-F1 primer and PROC-B1 primer.

8. The venous thrombosis risk gene detection kit based on LAMP technology according to claim 1, characterized in that, The polymorphic site of the venous thrombosis risk gene is the SERPINC1 gene 5301 G>A site; The primers and probes include SERPINC1-G-FIP probe, SERPINC1-G-BIP probe, SERPINC1-A-FIP probe, SERPINC1-A-BIP probe, SERPINC1-F primer, and SERPINC1-B primer; the SERPINC1-G-FIP probe sequence is shown in SEQ ID NO:25; the SERPINC1-G-BIP probe sequence is shown in SEQ ID NO:26; the SERPINC1-A-FIP probe sequence is shown in SEQ ID NO:27; the SERPINC1-A-BIP probe sequence is shown in SEQ ID NO:28; the SERPINC1-F primer sequence is shown in SEQ ID NO:29; and the SERPINC1-B primer sequence is shown in SEQ ID NO:

30. The reagent A is a G reaction tube, and the primers and probes contained in the reagent A include SERPINC1-G-FIP probe, SERPINC1-G-BIP probe, SERPINC1-F primer and SERPINC1-B primer; The reagent B is reaction tube A, and the primers and probes contained in the reagent B include SERPINC1-A-FIP probe, SERPINC1-A-BIP probe, SERPINC1-F primer and SERPINC1-B primer.

9. The venous thrombosis risk gene detection kit based on LAMP technology according to claim 1, characterized in that, The polymorphic site of the venous thrombosis risk gene is the APOH gene 422 T>C site; The primers and probes include APOH-T-FIP probe, APOH-T-BIP probe, APOH-C-FIP probe, APOH-C-BIP probe, APOH-F primer, and APOH-B primer; the APOH-T-FIP probe sequence is shown in SEQ ID NO:31; the APOH-T-BIP probe sequence is shown in SEQ ID NO:32; the APOH-C-FIP probe sequence is shown in SEQ ID NO:33; the APOH-C-BIP probe sequence is shown in SEQ ID NO:34; the APOH-F primer sequence is shown in SEQ ID NO:35; and the APOH-B primer sequence is shown in SEQ ID NO:

36. The reagent A is a T-reaction tube, and the primers and probes contained in the reagent A include APOH-T-FIP probe, APOH-T-BIP probe, APOH-F primer and APOH-B primer; The reagent B is a C reaction tube, and the primers and probes contained in the reagent B include APOH-C-FIP probe, APOH-C-BIP probe, APOH-F primer and APOH-B primer.

10. The venous thrombosis risk gene detection kit based on LAMP technology according to claim 1, characterized in that, The polymorphic site of the venous thrombosis risk gene is the F5 gene 1601 G>A site; The primers and probes include F5-G-FIP probe, F5-G-BIP probe, F5-A-FIP probe, F5-A-BIP probe, F5-F primer, and F5-B primer; the F5-G-FIP probe sequence is shown in SEQ ID NO:37; the F5-G-BIP probe sequence is shown in SEQ ID NO:38; the F5-A-FIP probe sequence is shown in SEQ ID NO:39; the F5-A-BIP probe sequence is shown in SEQ ID NO:40; the F5-F primer sequence is shown in SEQ ID NO:41; and the F5-B primer sequence is shown in SEQ ID NO:

42. The reagent A is a G reaction tube, and the primers and probes contained in the reagent A include F5-G-FIP probe, F5-G-BIP probe, F5-F primer and F5-B primer; The reagent B is reaction tube A, and the primers and probes contained in the reagent B include F5-A-FIP probe, F5-A-BIP probe, F5-F primer and F5-B primer.