Application of exosome lncOSLMT in the diagnosis and treatment of osteosarcoma lung metastases
By identifying lncOSLMT in osteosarcoma cell exosomes and developing nanoparticle-delivered siRNA to interfere with its role in the inflammatory microenvironment, the early diagnosis and treatment challenges of osteosarcoma lung metastasis were solved, achieving effective inhibition of lung metastasis and improved survival rate.
Patent Information
- Application Number
- CN202610072240.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-20
- Publication Date
- 2026-06-02
AI Technical Summary
The molecular mechanisms of osteosarcoma lung metastasis are not fully understood in current technologies, and there is a lack of effective early diagnostic and therapeutic targets, which makes lung metastasis a major cause of death in osteosarcoma patients.
By using high-throughput sequencing and bioinformatics analysis, we identified lncOSLMT enriched in osteosarcoma cell exosomes and developed lactoferrin-resveratrol nanoparticles to deliver siRNA targeting lncOSLMT, interfering with its role in the inflammatory microenvironment, blocking the COX-2/PGE2 axis, and inhibiting lung metastasis.
It provides early diagnostic tools and treatment strategies for osteosarcoma lung metastases, significantly inhibits lung metastases, improves patient survival rates, and ensures clinical safety.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of exosome lncOSLMT in the diagnosis and treatment of osteosarcoma lung metastases. Background Technology
[0002] Osteosarcoma is the most common primary malignant bone tumor in children and adolescents, characterized by a highly aggressive clinical course and early metastasis. Despite advances in multimodal therapy, lung metastasis remains a leading cause of death, with the 5-year survival rate declining from 70% in localized disease to 20% in metastatic cases (Beird HC, Bielack SS, Flanagan AM, Gill J, Heymann D, Janeway KA, et al. Osteosarcoma. Nat Rev Dis Primers 2022;8:77). This grim prognosis underscores the urgent need to elucidate the molecular mechanisms driving metastatic spread. Targeted therapy for osteosarcoma lung metastases, aimed at improving overall survival and metastasis-free survival, urgently requires new and effective therapeutic targets and further integration of basic research with clinical translation.
[0003] Tumor cell-secreted exosomes (EVs) are key mediators of intercellular communication within the tumor microenvironment. Through the delivery of bioactive molecules (proteins, lipids, and nucleic acids), exosomes facilitate the reprogramming of recipient cells and prepare distant sites for metastatic seeding (Wang Z, Kim SY, Tu W, Kim J, Xu A, Yang YM, et al. Extracellular vesicles in fatty liver promote a metastatic tumor microenvironment. Cell Metab 2023;35:1209-26 e13). Recent studies have highlighted the functional role of exosomal lncRNAs in pre-metastatic niche (PMN) formation. For example, BCSC-derived exosomal lnc-PDGFD promotes the activation of fibroblasts in the lungs, creating a metastatic microenvironment in triple-negative breast cancer (Tang T, Yang T, Xue H, Liu X, Yu J, Liang C, et al. Breast cancer stem cell-derived exosomallnc-PDGFD induces fibroblast-niche formation and promotes lung metastasis. Oncogene 2025;44:601-17). Similarly, exosomal enriched with linc00482 promotes brain metastasis in NSCLC by inducing microglial M2 polarization (Xu W, Patel N, Deng Y, Ding S, Wang T, Zhang H. Extracellularvesicle-derived LINC00482 induces microglial M2 polarization to facilitate brain metastasis of NSCLC. Cancer Letters 2023;561:216146).In bladder cancer, the exosomal lncRNA LNMAT2 promotes lymphangiogenesis by activating PROX1 expression in lymphoendothelial cells (Chen C, Luo Y, He W, Zhao Y, Kong Y, Liu H, et al. Exosomal long noncoding RNA LNMAT2 promotes lymphatic metastasis in bladder cancer. The Journal of Clinical Investigation 2020;130:404-21). However, the specific lncRNAs regulating PMN formation in osteosarcoma lung metastases and their underlying mechanisms remain largely unexplored. The regulatory role of exosomal lncRNAs in the pre-metastatic microenvironment of osteosarcoma lung metastases and their influence on lung metastasis are not fully elucidated. Summary of the Invention This invention aims to address at least one of the technical problems existing in the prior art. Based on high-throughput transcriptome sequencing and bioinformatics analysis, this invention explores the biological effects of osteosarcoma cell exosome-mediated lung metastasis and the characteristic regulation of the pre-metastatic inflammatory microenvironment in osteosarcoma lung metastasis, starting from the exosome-mediated lung metastasis of osteosarcoma and the characteristic regulation of the pre-metastatic inflammatory microenvironment. Focusing on the regulatory role of osteosarcoma cell exosome lncOSLMT in the pre-metastatic inflammatory microenvironment and lung metastasis of osteosarcoma, this invention constructs an exosome lncOSLMT-hnRNPA2B1-PTGS2 gene regulatory network using high-throughput sequencing, proteomic identification, and bioinformatics analysis. In vitro and animal experiments reveal the specific molecular mechanism by which osteosarcoma cell exosome lncOSLMT mediates changes in the pre-metastatic inflammatory microenvironment and regulates the occurrence of osteosarcoma lung metastasis. This study explored the clinical significance of lncOSLMT and its downstream target gene PTGS2 in osteosarcoma metastasis, aiming to identify potential targets for early diagnosis and treatment of osteosarcoma metastasis and lay the foundation for precision treatment of osteosarcoma lung metastasis.
[0004] The first aspect of the present invention aims to provide the use of reagents for detecting lncOSLMT in the preparation of products for risk diagnosis or prognostic assessment of osteosarcoma lung metastases.
[0005] A second aspect of the present invention aims to provide the use of lncOSLMT inhibitors in the preparation of medicaments for the prevention and / or treatment of osteosarcoma lung metastases.
[0006] A third aspect of the present invention is to provide a siRNA.
[0007] The fourth aspect of this invention aims to provide biological materials related to siRNA in the third aspect of this invention.
[0008] The fifth aspect of this invention is to provide a nanoparticle.
[0009] The sixth aspect of this invention aims to provide the use of the siRNA of the third aspect of this invention, the biomaterial of the fourth aspect of this invention, and the nanoparticles of the fifth aspect of this invention in the preparation of medicaments for the prevention and / or treatment of osteosarcoma lung metastases.
[0010] The seventh aspect of this invention is to provide a medicine.
[0011] To achieve the above objectives, the technical solution adopted by the present invention is as follows: This invention identified lncRNA NR_125944.1, which the inventors named osteosarcoma lung metastasis-associated transcript (lncOSLMT), as a key driver of enrichment in osteosarcoma-derived exosomes. lncOSLMT and the RNA-binding protein hnRNPA2B1 are co-packaged into exosomes through direct interaction. After being taken up by lung fibroblasts, hnRNPA2B1 in the exosomes recognizes... PTGS2 N in mRNA 3'UTR 6 -Methyladenosine (m 6 A) Site, via m 6 An A-dependent mechanism enhances its stability. This interaction leads to the upregulation of COX-2 protein and the resulting overproduction of prostaglandin E2 (PGE2), thereby establishing an inflammatory pre-metastatic niche (PMN). For therapeutic intervention, the inventors developed a novel nanomedicine delivery system consisting of lactoferrin-resveratrol (LF-RES) nanoparticles loaded with siRNA targeting lncOSLMT. The findings of this invention provide new insights into the mechanism by which osteosarcoma-derived exosomes regulate distal stromal cells and propose a promising strategy to interfere with exosomal lncRNA-mediated PMN formation.
[0012] In a first aspect, the invention provides the use of a reagent for detecting lncOSLMT in the preparation of a product for risk diagnosis or prognostic assessment of osteosarcoma lung metastases, wherein the nucleotide sequence of said lncOSLMT is shown in SEQ ID NO:1.
[0013] In some embodiments of the present invention, the lncOSLMT comprises lncOSLMT in osteosarcoma cell exosomes.
[0014] In some embodiments of the present invention, the reagents include reagents for the quantitative detection of lncOSLMT.
[0015] In some embodiments of the present invention, the reagents include reagents for detecting lncOSLMT at the gene or protein level.
[0016] In some embodiments of the present invention, the reagents include those for detecting the lncOSLMT by enzyme-linked immunosorbent assay (ELISA), immunofluorescence assay, radioimmunoassay, immunoprecipitation assay, Western blotting, high performance liquid chromatography (HPLC), capillary gel electrophoresis, near-infrared spectroscopy, mass spectrometry, immunochemiluminescence assay, colloidal gold immunochromatography, fluorescence immunochromatography, surface plasmon resonance (SPR), PCR, immuno-PCR, or biotin-avidin assay.
[0017] In some embodiments of the present invention, the reagents are selected from: substances specific to lncOSLMT, probes specific to lncOSLMT, gene chips, and PCR primers.
[0018] In some embodiments of the present invention, the product includes, but is not limited to, reagents, kits, test strips, systems, or chips.
[0019] In some embodiments of the present invention, the test sample of the product is selected from at least one of the blood, tissue, cells, and exosomes of the test subject.
[0020] This invention clarifies the role and regulatory mechanism of exosome-mediated communication between osteosarcoma cells and fibroblasts in the pre-metastatic inflammatory microenvironment of osteosarcoma, providing a new theoretical basis for finding novel molecular targets for osteosarcoma lung metastasis. It has important clinical significance and application prospects for developing new targeted therapy strategies for osteosarcoma lung metastasis and improving the overall prognosis of osteosarcoma patients.
[0021] A second aspect of the present invention provides the use of an lncOSLMT inhibitor in the preparation of a medicament for the prevention and / or treatment of osteosarcoma lung metastases, wherein the nucleotide sequence of said lncOSLMT is shown in SEQ ID NO:1.
[0022] In some embodiments of the present invention, the lncOSLMT inhibitor is at least one of the following: a substance that inhibits lncOSLMT activity, a substance that degrades lncOSLMT, a substance that reduces lncOSLMT expression level, or a substance that knocks out / knocks down lncOSLMT expression.
[0023] In some embodiments of the present invention, the lncOSLMT inhibitor is at least one of a1)-a5): a1) siRNA, dsRNA, miRNA, sgRNA, ribozyme, or shRNA targeting lncOSLMT; a2) nucleic acid molecules encoding the siRNA, dsRNA, miRNA, sgRNA, ribozyme, or shRNA targeting lncOSLMT described in a2); a3) expression cassettes, vectors, or transgenic cell lines containing the nucleic acid molecules described in a2); a4) small molecule drugs targeting lncOSLMT; a5) hnRNPA2B1 inhibitors.
[0024] In some embodiments of the present invention, the lncOSLMT inhibitor is at least one of b1)-b4): b1) siRNA targeting lncOSLMT; b2) nucleic acid molecule encoding the siRNA targeting lncOSLMT described in b1); b3) expression cassette, vector, or transgenic cell line containing the nucleic acid molecule described in b2); b4) hnRNPA2B1 inhibitor.
[0025] In some embodiments of the present invention, the nucleotide sequence of the siRNA is shown in SEQ ID NO:20.
[0026] In some embodiments of the present invention, the hnRNPA2B1 inhibitor includes at least one of c1)-c4): c1) siRNA, dsRNA, miRNA, sgRNA, ribozyme, or shRNA targeting hnRNPA2B1; c2) nucleic acid molecules encoding the siRNA, dsRNA, miRNA, sgRNA, ribozyme, or shRNA targeting hnRNPA2B1 as described in c2); c3) expression cassettes, vectors, or transgenic cell lines containing the nucleic acid molecules described in c2); c4) small molecule drugs or antibodies targeting hnRNPA2B1.
[0027] In some embodiments of the present invention, the hnRNPA2B1 inhibitor is at least one of d1)-d4): d1) siRNA targeting hnRNPA2B1; d2) nucleic acid molecule encoding the siRNA targeting hnRNPA2B1 described in d1); d3) expression cassette, vector, or transgenic cell line containing the nucleic acid molecule described in d2); d4) small molecule drug or antibody targeting hnRNPA2B1.
[0028] In some embodiments of the present invention, the nucleotide sequence of the siRNA targeting hnRNPA2B1 is shown in SEQ ID NO:2 or 3.
[0029] In some embodiments of the present invention, the drug achieves treatment of osteosarcoma lung metastases via the hnRNPA2B1 / COX-2 / PGE2 axis.
[0030] A third aspect of the present invention provides an siRNA, the nucleotide sequence of which is shown in SEQ ID NO:20.
[0031] A fourth aspect of the present invention provides biological materials related to the siRNA of the third aspect of the present invention, said biological materials comprising any one of 1)-12): 1) a nucleic acid molecule encoding the siRNA of the third aspect of the present invention; 2) an expression cassette comprising the nucleic acid molecule of 1); 3) a vector comprising the nucleic acid molecule of 1); 4) a vector comprising the expression cassette of 2); 5) a transgenic cell line comprising the nucleic acid molecule of 1); 6) a transgenic cell line comprising the expression cassette of 2); 7) a transgenic cell line comprising the vector of 3); 8) a transgenic cell line comprising the vector of 4); 9) a recombinant microorganism containing the nucleic acid molecule of 1); 10) a recombinant microorganism containing the expression cassette of 2); 11) a recombinant microorganism containing the vector of 3); 12) a recombinant microorganism containing the vector of 4).
[0032] In some embodiments of the present invention, the transgenic cell line does not contain propagation material.
[0033] A fifth aspect of the present invention provides a nanoparticle comprising siRNA and carrier particles from the third aspect of the present invention.
[0034] In some preferred embodiments of the present invention, the siRNA is loaded onto the carrier particles via electrostatic interactions.
[0035] In some embodiments of the present invention, the nanoparticles are prepared by a method comprising: mixing siRNA with carrier particles and incubating at room temperature for 0.5-2 hours to obtain nanoparticles.
[0036] In some embodiments of the present invention, the molar ratio of the siRNA to the vector particles is 1:(1-2).
[0037] In some embodiments of the present invention, the carrier particles are lactoferrin-resveratrol nanoparticles.
[0038] Lactoferrin targets tumors via its highly expressed LF receptor on various tumor cells. RES, a natural polyphenol, enhances antioxidant activity and promotes nucleic acid transfection. This carrier particle achieves efficient delivery of siRNA to tumors and inflamed stromal tissues through the synergistic effect of LF-mediated tumor targeting and the stabilizing effect of RES.
[0039] In some embodiments of the present invention, the lactoferrin-resveratrol nanoparticles are obtained by cross-linking glutamine residues in lactoferrin and lysine residues in resveratrol under the catalysis of transglutaminase.
[0040] In some embodiments of the present invention, the lactoferrin-resveratrol nanoparticles are prepared by the following method: mixing lactoferrin solution and resveratrol solution, adding transglutaminase, reacting, and inactivating to obtain lactoferrin-resveratrol nanoparticles.
[0041] In some preferred embodiments of the present invention, the solvent of the lactoferrin solution is sterile water.
[0042] In some preferred embodiments of the present invention, the solvent of the resveratrol solution is ethanol.
[0043] In some preferred embodiments of the present invention, the mass ratio of lactoferrin to resveratrol is (160-170):1; more specifically (165-167):1.
[0044] In some preferred embodiments of the present invention, the reaction conditions are stirring at 40-50°C for 1-3 hours; further, stirring at 43-46°C for 1.5-2.5 hours.
[0045] In some preferred embodiments of the present invention, the inactivation conditions are heating at 70-90°C for 5-15 minutes; further, heating at 75-85°C for 8-12 minutes.
[0046] In some preferred embodiments of the present invention, the preparation method further includes dialysis.
[0047] A sixth aspect of the present invention provides the use of the siRNA of the third aspect of the present invention, the biomaterial of the fourth aspect of the present invention, and the nanoparticles of the fifth aspect of the present invention in the preparation of medicaments for the prevention and / or treatment of osteosarcoma lung metastases.
[0048] A seventh aspect of the present invention provides a medicine comprising siRNA (as described in the third aspect of the present invention), biomaterials (as described in the fourth aspect of the present invention), and nanoparticles (as described in the fifth aspect of the present invention).
[0049] In some embodiments of the present invention, the drug further includes at least one of hnRNPA2B1 inhibitor, PGE2 antagonist, or EP2 / EP4 antagonist.
[0050] In some embodiments of the present invention, the PGE2 antagonist includes at least one of PF-04418948, SC-19220, ONO-8713, GW-848687X, TG-4-155, and AH-6809.
[0051] In some embodiments of the present invention, the EP2 / EP4 antagonist includes at least one of MF498, AH-6809, AAT-008, BLU-808, and RQ-15986.
[0052] In some embodiments of the present invention, the drug further includes pharmaceutically acceptable excipients.
[0053] In some embodiments of the present invention, the pharmaceutically acceptable excipients include at least one selected from fillers, disintegrants, diluents, dispersants, excipients, stabilizers, lubricants, binders, humectants, flavoring agents, solubilizers, suspending agents, solvents, sustained-release agents, emulsifiers, absorption enhancers, surfactants, preservatives, pigments, fragrances, and solvents.
[0054] In some embodiments of the present invention, the dosage form of the drug includes a gastrointestinal dosage form or a non-gastrointestinal dosage form.
[0055] In some embodiments of the present invention, the gastrointestinal dosage form includes at least one of powder, tablet, granule, capsule, sustained-release, solution, dry suspension, effervescent tablet, emulsion, suspension, syrup, drops, and chewable tablet.
[0056] In some embodiments of the present invention, the gastrointestinal dosage forms include, but are not limited to, enteric-coated tablets, coated tablets, film-coated tablets, sugar-coated tablets, dispersible tablets, sucking tablets, chewable tablets, effervescent tablets, scratch tablets, sustained-release and controlled-release dosage forms, sustained-release tablets, sustained-release coated tablets, controlled-release tablets, orally disintegrating tablets, lozenges, and oral patches.
[0057] In some embodiments of the present invention, the non-gastrointestinal drug delivery dosage form includes at least one of injection dosage form, respiratory dosage form, skin dosage form, mucosal dosage form, and cavity dosage form.
[0058] In some embodiments of the present invention, the injectable dosage forms include, but are not limited to, injection solutions, solutions for injection, injection solutions for intravenous infusion, suspensions for injection, sterile powders for injection, intravenous injections, water injections, emulsions for injection, powder injections, injections, sterile powder injections, lyophilized powder injections, etc.
[0059] The beneficial effects of this invention are: This invention reveals that lncOSLMT selectively accumulates in exosomes released by osteosarcoma cells with high metastatic potential. Its elevated expression is positively correlated with the incidence of lung metastasis and serves as an independent prognostic factor for poor outcomes in osteosarcoma patients. This invention elucidates the regulatory role of exosomal lncOSLMT in the pre-metastatic microenvironment of osteosarcoma and its effect on lung metastasis, clarifying the significant clinical translational value of targeting lncOSLMT for targeted treatment of osteosarcoma lung metastasis, particularly in liquid biopsy and early metastasis prediction in osteosarcoma, and ensuring adequate clinical safety.
[0060] This invention develops a long-chain fatty acid (lactoferrin)-resveratrol-based nanoparticle for targeting and silencing lncOSLMT drugs (LF-RES-siRNA nanoparticles). LF-RES-siRNA nanoparticles effectively inhibited COX-2 / PGE2-driven inflammatory responses and suppressed lung metastasis in preclinical models. Furthermore, combination therapy with LF-RES-siRNA nanoparticles and EP2 / EP4 antagonists produced a synergistic effect, indicating that a strategy of simultaneously blocking upstream lncRNAs and key inflammatory mediators has potential value in inhibiting metastasis. Attached Figure Description
[0061] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein: Figure 1Characterization and functional assessment of EVs during lung metastasis. (A) Schematic diagram of EV isolation process. (B) Transmission electron microscopy images showing the morphology of EVs, scale bar 1:15000 for 143B and 1:30000 for others. (C) Western blot analysis of typical EV markers. (D) Schematic diagram of in vivo experimental design. (E) Representative immunofluorescence images showing the biodistribution of PKH26-labeled EVs (indicated by orange arrows) in major organs after tail vein injection, scale bar: 10µm (top), 5µm (bottom). (F) Gross images and histological sections of mouse lungs pretreated with PBS, MNNG / HOS-EVs, or 143B-EVs before tumor cell injection, scale bar: 2mm (top), 400mm (bottom). (G) Quantification of the number and total area of lung metastatic nodules. (H) Representative H&E staining of lung tissue, scale bar: 200μm (top), 50μm (bottom). (1) Representative Malcolm X-chromosome staining of lung tissue. Scale bar: 200 μm (top), 50 μm (bottom). (J) Top differentially expressed genes identified by RNA-seq analysis. (K) Volcano plot showing differential gene expression in lung tissue pretreated with 143B-EVs and MNNG / hos-EVs. (L) GSEA analysis showing enrichment of inflammatory response pathways. Data in (E) and (G) are expressed as mean ± SD (n = 6), and data in (H) and (I) are expressed as mean ± SD (n = 5). Statistical significance was determined by one-way ANOVA and appropriate post-hoc comparisons. The significance level was defined as no statistical significance (ns). .
[0062] Figure 2Identification, expression patterns, and clinical relevance of lncOSLMT in osteosarcoma and EVs. (A) Sequencing of lncRNA expression in SJSA-1 EVs compared to U2OS EVs. (B) Sequencing of lncRNA expression in 143B EVs compared to MNNG / HOS EVs. (C) lncOSLMT is the most significantly upregulated lncRNA among the candidate genes (highlighted in red). (D) Agarose gel electrophoresis showing 5' and 3' RACE results of lncOSLMT. (E) Analysis of predicted lncOSLMT secondary structure. (F) Relative expression of lncOSLMT in different osteosarcoma cell lines (normalized to U2OS). (G) Relative expression of lncOSLMT in EVs secreted by osteosarcoma cell lines (normalized to U2OS-EVs). (H) Representative FISH images showing subcellular localization of lncOSLMT in 143B and SJSA-1 cells, scale bar: 50 µm. (I) Nuclear and cytoplasmic separation confirms the subcellular distribution of lncOSLMT in osteosarcoma cells, with lncRNA MALAT1 (nuclear control), U6 (nuclear control), and GAPDH (cytoplasmic control) as references. (J) ISH in osteosarcoma patient tissues showing cytoplasmic localization of lncOSLMT, scale bar: 100 µm (top), 25 µm (bottom). (K) Relative expression of lncOSLMT in paired tumors and adjacent normal tissues of osteosarcoma patients. (L) Representative ISH images of lncOSLMT expression in tumors of patients with (LM) or without (NLM) lung metastases, scale bar: 100 µm (top), 25 µm (bottom). (M) Quantitative expression of lncOSLMT in fresh osteosarcoma tissues of patients with or without lung metastases. (N) Expression levels of lncOSLMT in serum EVs of osteosarcoma patients with and without lung metastases. (O) Kaplan-Meier survival analysis showed an association between lncOSLMT expression and lung metastasis-free survival and overall survival. (P) Univariate and multivariate analyses of lncOSLMT expression and clinical parameters in osteosarcoma patients. Data in (F) and (G) are expressed as mean ± SD (n = 3). One-way ANOVA and appropriate post-hoc comparisons were used to determine statistical significance. Data in (K) are expressed as mean ± SD (n = 30 pairs). A paired two-tailed Student's t-test was used to determine statistical significance. Data in (M) are expressed as mean ± SD (n = 12 for NLM and n = 18 for LM). An unpaired two-tailed Student's t-test was used to determine statistical significance. Data in (N) are expressed as mean ± SD (N = 20 for NLM and LM).Statistical significance was determined using the unpaired two-tailed Student's t-test, and the significance level was defined as follows: .
[0063] Figure 3 lncOSLMT transferred to EVs promotes lung microenvironment remodeling and in vivo colonization. (A) Relative expression of lncOSLMT in all MNNG / HOS cells after transfection with the empty vector or lncOSLMT overexpression construct. (B) Relative expression of lncOSLMT in MNNG / HOS cells transfected with the empty vector or lncOSLMT overexpression construct. (C) Representative FISH images showing subcellular localization of lncOSLMT in MNNG / HOS cells transfected with the vector or lncOSLMT, scale bar: 50 µm. (D) Schematic diagram of the in vivo experimental workflow. (E) H&E staining of lung tissue pretreated with PBS, vector EVs, or EVs overexpressing lncOSLMT, scale bar: 200 μm (top), 50 μm (bottom). (F) Masson's staining of lung tissue pretreated with PBS, EV vector, or EVs overexpressing lncOSLMT, scale bar: 200 μm (top), 50 μm (bottom). (G) Gross and histological images of lung metastases in mice after tail vein injection of tumor cells pretreated with PBS or EVs, scale bar: 2mm (top), 400mm (bottom). (H) Quantification of lung metastatic nodules and percentage of metastatic area in each group. Data in (A) and (B) are expressed as mean ± SD (n = 3) and analyzed using an unpaired two-tailed Student's test. Data in (E), (F), and (H) are expressed as mean ± standard deviation (n = 5 for E and F; n = 6 for H) and analyzed using one-way ANOVA with corresponding post-hoc comparisons. The significance level is defined as... .
[0064] Figure 4 lncOSLMT, which is transferred from EVs, activates lung fibroblasts and induces inflammatory activation through the COX-2 / PGE2 axis. Specifically, (A) flow cytometry analysis of EV-positive lung cells after intravenous injection of pkh26-labeled EVs showed that fibroblasts (CD140a) were present. + ), macrophages (F4 / 80) + ) and endothelial cells (CD31) + (B) The proportion of EVs in EV-positive cells. pkh26-labeled EVs co-localized with major lung cell subtypes, including fibroblasts (S100A4). + ), macrophages (F4 / 80) +) and endothelial cells (CD31) + (C) Schematic diagram of in vitro EV uptake assay and fluorescence image of HFL-1 cells representing EV uptake, scale bar: 25µm. (D) Volcano plot of differentially expressed genes in HFL-1 cells treated with EVs overexpressing lncOSLMT and vector EVs. (E) GSEA showing enrichment of inflammatory response pathways. (F) Venn plot showing overlap of upregulated genes between RNA-seq results in mouse lung tissue and HFL-1 cells. (G) Logarithmic folding changes of selected candidate downstream genes. (H) HFL-1 cells treated with lncOSLMT overexpression or vector EVs. PTGS2 Quantitative PCR analysis of mRNA levels. (I) Western blot analysis of COX-2 protein levels in HFL-1 cells treated with overexpression of lncOSLMT or vector EVs. (J) PTGS2 Schematic diagram of the regulated inflammatory signaling pathway. (K) PGE2 levels in HFL-1 cell culture medium treated with PBS, empty EVs, or EVs overexpressing lncOSLMT were determined by ELISA. (L) PGE2 concentration in mouse cysteine after injection of PBS, empty EVs, or EVs overexpressing lncOSLMT. (M) PGE2 levels in HFL-1 cell culture medium treated with PBS, MNNG / HOS-EVs, 143B-EVs, or 143B-si-lncOSLMT-EVs were determined by ELISA. Data in (A), (B), (K), (L), and (M) are expressed as mean ± SD (n = 6 for B, n = 3 for A, K, and M, and n = 5 for L). One-way ANOVA and appropriate post-hoc comparisons were used to determine statistical significance. Data in (H) are expressed as mean ± SD (n = 3). Statistical significance was determined using an unpaired two-tailed Student's t-test. The significance level was defined as... .
[0065] Figure 5lncOSLMT directly binds to hnRNPA2B1 and regulates its role in EV-mediated signal transduction. (A) Silver staining of lncOSLMT-pulled proteins; arrows indicate differentially expressed protein bands of interest. (B) Venn plots showing that in SJSA-1 and 143B cells, 687 shared proteins were enriched in the sense strand pull-down group compared to the antisense control ("143B_UP" and "SJSA_UP" indicate that 687 shared proteins were enriched in the sense strand group relative to the antisense strand in 143B and SJSA-1 cells, respectively). (C) SJSA-1 RNA pull-down protein abundance ranking (sense strand vs. antisense strand). (D) 143B RNA pull-down protein abundance ranking (sense strand vs. antisense strand). (E) Representative mass spectra of the protein peptides corresponding to hnRNPA2B1. (F) RNA pull-down and Western blot validation confirm the binding of lncOSLMT to hnRNPA2B1. (G) RIP validated the interaction between lncOSLMT and hnRNPA2B1. (H) Representative fluorescence images of intracellular colocalization of lncOSLMT and hnRNPA2B1, scale bar: 25µm. (I) RNA pull-down assay using a truncated lncOSLMT to map the binding region of hnRNPA2B1. (J) Prediction of the lncOSLMT binding motif required for hnRNPA2B1 interaction. (K) RIP experiments showed that hnRNPA2B1 interacts with wild-type lncOSLMT and mutants lacking the 770-800nt binding region. (L) Western blot confirmed the knockdown efficiency of hnRNPA2B1 at the protein level. (M) Relative levels of lncOSLMT in exosomes after hnRNPA2B1 knockdown. (N) Western blot analysis of hnRNPA2B1 protein in EVs of cells overexpressing the vector, wild-type lncOSLMT, or lncOSLMT mutants with a 777-800nt nucleotide mutation. (O) Schematic diagram of EV treatment experiments in HFL-1 cells. (P) Protein levels of hnRNPA2B1 and COX-2 in HFL-1 cells treated with EVs from transfected vectors, wild-type lncOSLMT, or 770-800 nt mutant cells. Data in (G) are expressed as mean ± SD (n = 3) and analyzed using an unpaired two-tailed Student's test. Data in (K) and (M) are expressed as mean ± SD (n = 3) and analyzed using one-way ANOVA and appropriate post-hoc comparisons. Significance level is defined as... .
[0066] Figure 6 For hnRNPA2B1 via m 6A-dependent binding to stable PTGS2 mRNA. Specifically, (A) RIP-qPCR analysis showed enrichment of hnRNPA2B1 via immunoprecipitation. PTGS2 (B) Western blot analysis of COX-2 protein levels after hnRNPA2B1 knockdown. (C) After hnRNPA2B1 knockdown PTGS2 mRNA stability assay. (D) Analysis of the GSE71154 dataset showed... PTGS2 mRNA contains m 6 A modified peak. (E) SRAMP database prediction PTGS2 Potential mRNA on mRNA 6 A modified site. (F)hnRNPA2B1 is m-dependent 6 A schematic diagram illustrating method A for maintaining mRNA stability. (G) MeRIP-qPCR confirmation. PTGS2 m on mRNA 6 A. Modification. (H) Western blot analysis of COX-2 protein levels after METTL3 knockdown. (I) MeRIP-qPCR showing the effect of METTL3 knockdown. PTGS2 mRNA m6A modification is reduced. (J) RIP-qPCR showed that METTL3 knockdown reduced hnRNPA2B1 and PTGS2 Reduced mRNA binding. (K) METTL3 knockdown PTGS2 mRNA stability assay. (L) Using truncated mRNA PTGS2 mRNA fragments were analyzed using RNA pull-down to identify the hnRNPA2B1 binding region. (M) GTEx dataset analysis of lung tissue. PTGS2 Correlation analysis with hnRNPA2B1 mRNA expression levels. (N) was used to assess... PTGS2 Schematic diagram of a dual-luciferase reporter gene assay involving the interaction of mRNA 3'UTR-hnRNPA2B1. (O) Transfection vector control, PTGS2 The relative luciferase activity of the 3'UTR WT or PTGS2 3'UTRMut reporter plasmid. (P) PTGS2mRNA stability assays were performed in HFL-1 cells treated with EVs overexpression vector control, wild-type lncRNA, or Δ770-800 lncRNA mutant. Data in (A) and (G) are expressed as mean ± SD (n = 3) and analyzed using an unpaired two-tailed Student's test. Data in (I) and (O) are expressed as mean ± SD (n = 3) and analyzed using one-way ANOVA and appropriate post-hoc comparisons. Data in (C) and (P) are expressed as mean ± SD (n = 3). Differences between curve groups were analyzed using two-way ANOVA. The significance level was defined as... .
[0067] Figure 7 This study aims to synthesize, characterize, and evaluate the therapeutic efficacy of LF-RES-siRNA nanoparticles. (A) Schematic diagram of LF-RES-siRNA nanoparticle synthesis. (B) AFM morphology (scale bar: 400 nm) and particle size distribution of the nanoparticles. (C) Schematic diagram of animal experiments. (D) Representative images of HE staining, Masson's trichrome staining, and COX-2 immunohistochemistry, scale bar: 200 μm. (E) Quantitative histopathological scores, Masson's trichrome staining scores, and COX-2 IHC scores. (F) PGE2 concentration in BALF. (G) Typical gross morphology and histological sections of lung metastases, scale bar: 2 mm. (H) Quantification of the number of lung metastatic nodules and the percentage of lung metastatic area. Data in (E), (F), and (H) are expressed as mean ± SD. One-way ANOVA and appropriate post-hoc comparisons were used to determine statistical significance. The sample size for (E) and (F) was n = 5, and the sample size for (H) was n = 6. The significance level was defined as... .
[0068] Figure 8 The physicochemical properties and in vivo biodistribution of LF-RES-siRNA nanoparticles are shown. (A) Atomic force microscopy (AFM) image of LF-RES-siRNA nanoparticles. (B) Transmission electron microscopy (TEM) image of LF-RES-siRNA nanoparticles. (C) Representative images of major mouse organs obtained using in vitro fluorescence imaging technology. The experimental groups were PBS, LF-RES nanoparticles, free FAM-labeled siRNA, and LF-RES-FAM-siRNA treatment groups, respectively, visually demonstrating the biodistribution characteristics of different formulations.
[0069] Figure 9This study illustrates the therapeutic effect of combined treatment with LF-RES-siRNA nanoparticles and EP2 / EP4 antagonists. (A) Schematic diagram of animal experiments using the combined treatment. (B) Representative images of H&E staining, Masson's triple staining, and COX-2 IHC after pretreatment with vector EVs and oelncRNA-EVs, scale bar: 200 μm. (C) Quantitative histopathological scores, Masson's triple staining scores, and COX-2 IHC scores. (D) Representative gross morphology after EV pretreatment and tail vein injection of tumor cells. (E) Typical lung metastasis sections after EV pretreatment and tail vein injection of tumor cells, scale bar: 2 mm. (F) Quantification of the number of lung metastatic nodules and the percentage of lung metastatic area. Data in (C) and (F) are expressed as mean ± SD. One-way ANOVA and appropriate post-hoc comparisons were used to determine statistical significance. (C) Sample size n=5, (F) Sample size n=6. The significance level was defined as... .
[0070] Figure 10 This is a schematic diagram of the present invention. Detailed Implementation
[0071] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.
[0072] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.
[0073] Based on high-throughput transcriptome sequencing and bioinformatics analysis, this invention explores the biological effects of osteosarcoma cell exosome-mediated lncOSLMT on the pre-metastatic inflammatory microenvironment and its role in osteosarcoma lung metastasis, starting with the characteristic regulation of the pre-metastatic inflammatory microenvironment mediated by osteosarcoma cell exosomes. Focusing on the regulatory role of osteosarcoma cell exosome lncOSLMT in the pre-metastatic inflammatory microenvironment and lung metastasis of osteosarcoma, high-throughput sequencing, proteomic identification, and bioinformatics analysis were used to construct an exosome lncOSLMT-hnRNPA2B1-PTGS2 gene regulatory network. In vitro and animal experiments revealed the specific molecular mechanism by which osteosarcoma cell exosome lncOSLMT mediates changes in the pre-metastatic inflammatory microenvironment and regulates osteosarcoma lung metastasis. To explore the clinical significance of lncOSLMT and its downstream target gene PTGS2 in osteosarcoma metastasis, to identify potential targets for early diagnosis and treatment of osteosarcoma metastasis, and to lay the foundation for precision treatment of osteosarcoma lung metastasis.
[0074] The features and performance of the present invention will be further described in detail below with reference to embodiments.
[0075] Example In this invention, the inventors demonstrated that osteosarcoma cell exosomes can induce characteristic changes in the inflammatory microenvironment of the lungs, and that highly metastatic osteosarcoma cell exosomes increase osteosarcoma lung metastasis. High-throughput sequencing analysis and verification of long non-coding (lncRNAs) produced by exosomes revealed that lncRNA NR_125944.1 (named in this invention as the osteosarcoma lung metastasis-associated transcript lncOSLMT, nucleotide sequence as shown in SEQ ID NO:1) is a candidate gene enriched in exosomes and significantly upregulated in patient tumors and serum; its elevated level is associated with poor prognosis. Mechanistically, through RNA pull-down combined with proteomic profiling and high-throughput sequencing, the inventors discovered that lncOSLMT directly binds to the RNA-binding protein hnRNPA2B1 in exosomes. After internalization by recipient lung fibroblasts, hnRNPA2B1 binds to the N in the 3'UTR of PTGS2 mRNA. 6 -Methyladenosine (m 6 A) Modification site, stabilization PTGS2Transcription, thereby increasing COX-2 expression. For therapeutic intervention, the inventors developed lactoferrin-resveratrol (LF-RES) nanoparticles loaded with siRNA targeting lncOSLMT. Intravenous injection of LF-RES-siRNA in mice reduced exosome-induced lung inflammation and inhibited lung metastasis. Combined use with an EP2 / EP4 antagonist enhanced the anti-metastatic effect. These findings confirm that lncOSLMT in exosomes is a key regulator of inflammatory PMN formation in the lungs and highlight the potential of LF-RES-siRNA nanoparticles as a targeted anti-metastatic therapy for osteosarcoma.
[0076] Experimental methods: (1) Human samples Osteosarcoma tissue, adjacent tissue, and blood samples were obtained from the Department of Bone Oncology, The First Affiliated Hospital of Sun Yat-sen University. All specimens were collected with the informed consent or broad consent of the patients. This study was approved by the Research Medical Ethics Committee of The First Affiliated Hospital of Sun Yat-sen University.
[0077] (2) Animal experiments Four-week-old BALB / c nude mice (RRID:IMSR_RJ:BALBC-NUDE), weighing 12–16 g, were obtained from GemPharmatech Co. and housed under specific pathogen-free (SPF) conditions. To induce a lung microenvironment, mice were injected via tail vein with designated exosomes for four weeks. Subsequently, 1×10⁻⁶ exosomes were suspended in 100 μL of PBS. 6 MNNG / HOS cells (osteosarcoma cells) were injected into mice via tail vein. In nanoparticle therapy, 30 µg of EVs suspended in 100 µL PBS were administered every other day, along with an EP2 antagonist (PF-04418948, MCE, Cat#HY-18966, 10 mg / kg), an EP4 antagonist (MF498, MCE, Cat#HY-10794, 10 mg / kg), or 5 nmol LF-RES nanoparticles or 5 nmol LF-RES-siRNA nanoparticles (siRNA target sequence TCAAGGTTAAAGACCCTCTT (SEQ ID NO:20), with equimolar amounts of LF-RES and siRNA mixed and incubated at room temperature for 1 hour). All drugs were administered via tail vein every other day for four weeks. 2 × 10 6 MNNG / HOS cells were suspended in 100 µg PBS. Lung metastases were assessed after four weeks.
[0078] (3) Cell lines The cell lines used in this invention include 143B (RRID: CVCL_2270), SJSA-1 (RRID: CVCL_1697), U2OS (RRID: CVCL_0042), MNNG / HOS (RRID: CVCL_0439), HFL-1 (RRID: CVCL_0298), and HEK293T (RRID: CVCL_0063), all derived from ATCC. All cell lines were cultured in high-glucose DMEM (Gibco) containing 10% FBS and 1% penicillin / streptomycin (Gibco) at 37°C and 5% carbon dioxide. All cell lines were identified and confirmed to be free of mycoplasma contamination.
[0079] (4) Statement of ethical approval All animal experiments were approved by the Institutional Animal Care and Utilization Committee of Sun Yat-sen University (Approval No.:
[2017] 209) and conducted in accordance with established guidelines for the care and use of laboratory animals. The osteosarcoma and blood samples used in this study were approved by the Ethics Committee of the First Affiliated Hospital of Sun Yat-sen University (Approval No.:
[2021] 755). Informed consent was obtained from all patients in the study.
[0080] (5) Preparation and characterization of exosomes (EVs) The method for isolating exosomes from cell culture medium is as follows: Cells (osteosarcoma cell lines, including highly metastatic osteosarcoma cell lines (143B and SJSA-1) and low-metastatic osteosarcoma cell lines (MNNG / HOS and U2OS)) were cultured in DMEM containing exosome-free FBS at 37°C and 5% CO2. The collected culture supernatant was centrifuged sequentially at 300×g, 2000×g, and 4°C for 10 min to remove cells and cell debris. The resulting supernatant was then centrifuged at 10,000×g for 10 min to eliminate larger vesicles. Subsequently, the supernatant was centrifuged at 10,000×g for 70 min. The particles were resuspended in PBS and filtered through a 0.22 μm pore filter to remove residual contaminants. The filtrate was ultracentrifuged at 100,000×g for 70 min at 4°C. The obtained exosome particles were washed with PBS and centrifuged again at 100,000×g for 70 min. The final particles were enriched with exosomes, resuspended in PBS, and used for downstream analysis.
[0081] The morphology of exosomes was observed by transmission electron microscopy (TEM). Particle size and concentration were analyzed using a NanoSight LM10 system (Malvern, Framingham, MA) and NTA software (version 3.1). Western blotting confirmed the presence of exosome marker proteins. Exosomes were quantified using the BCA method (Thermo Fisher, Cat# 23227), with 30 µg of exosomes suspended in 100 µL of PBS and administered via tail vein injection.
[0082] EVs were isolated from patient serum using VEX exosome isolation reagent (from serum) (Vazyme, Cat# R602) according to the manufacturer's instructions. Simply put, the serum sample was centrifuged at 2000×g for 30 minutes at 4°C to remove cell debris. The supernatant was carefully transferred to a fresh tube and mixed with the VEX exosome isolation reagent at a 5:1 volume ratio (serum:reagent). After gentle mixing, the sample was incubated at 4°C for 30 minutes, followed by centrifugation at 10,000×g for 10 minutes. The resulting exosome-containing particles were resuspended in nuclease-free PBS for downstream analysis.
[0083] (6) Cell knockdown and overexpression Transfection began when the cell density in the 6-well plates reached 60%-70%. 250 µL of serum-free Opti-MEM transfection medium was added to each EP tube. One tube contained 5 µL of lipofectamine iMAX, and the other contained 5 µL of siRNA (si-hnRNPA2B1#1:GCAAUUCAUUGAGCGCAUUTT (SEQ ID NO:2), si-hnRNPA2B1#2:GCUCUUUAUUGGUGGCUUATT (SEQ ID NO:3)). The mixture was thoroughly incubated at room temperature for 5 minutes. The two EP tubes were then combined and incubated at room temperature for 15 minutes. The cell culture medium in the 6-well plates was then removed, and 500 µL of the above transfection mixture was added, followed by 1.5 mL of antibiotic-free complete culture medium. The plates were then placed in a cell culture incubator for further culture. Six to eight hours after transfection, the medium was replaced with complete culture medium. After another 24 hours of culturing, cells could be collected to extract RNA for real-time quantitative PCR, or cells could be collected after 48 hours to extract protein for polyacrylamide gel electrophoresis to detect siRNA knockdown efficiency. Simultaneously, successfully transfected cells could be collected for subsequent experiments.
[0084] Healthy cells were evenly seeded into 6-well plates, mixed using a cross-hatching method, and then placed in a 37°C cell culture incubator containing 5% CO2 for adherent culture. Observation was performed under an inverted microscope. When the cell density reached 40%-50%, 1 mL of viral solution (lncOSLMT viral solution) and 1 mL of DMEM complete medium were added to each well. A certain amount of Polybrene (working concentration 8 µg / mL) was also added to increase the efficiency of viral infection. The mixture was thoroughly mixed and then placed in the incubator for further culture. After 12-16 hours, the viral solution was removed, and fresh DMEM complete medium was added, and culture continued. When the cells reached a suitable confluence density, puromycin was added for selection (final concentration 2 µg / mL). After several generations of selection, once the cells were stably growing, RNA and protein were extracted from the cells. The knockdown or overexpression efficiency of the genes was detected to obtain a stably transfected cell line for further experiments.
[0085] (7) Immunoblotting Proteins were extracted using RIPA lysis buffer (Beyotime, China) with 1 mM benzoyl fluoride (PMSF). Protein concentration was determined using the Pierce BCA protein assay kit (Thermo Fisher Scientific, USA). Equal volumes of protein were separated using 10% SDS-PAGE (EpiZyme, China) and transferred to a PVDF membrane (Millipore, USA). The membrane was blocked with 5% skim milk and incubated overnight at 4°C with a suitable primary antibody. Subsequently, the membrane was incubated with a species-specific enzyme-labeled secondary antibody at room temperature for 1 hour. Protein bands were visualized using a High-sig ECL assay kit (Tanon, China).
[0086] (8) RNA sequencing Total RNA was extracted from specified samples and evaluated using an Agilent 2100 bioanalyzer. mRNA was enriched using oligomeric (dT) magnetic beads. Library preparation included RNA fragmentation, cDNA synthesis, double-stranded cDNA end repair, and adapter ligation, followed by PCR amplification to generate the final sequencing library. After quality control, the library was sequenced on a BGISEQ-500 platform. Differential gene expression analysis was performed using the DESeq2 package (RRID: SCR_015687) (Love, MI, W. Huber and S. Anders. "Moderated estimation of fold change and dispersion for rna-seq"). Data with deseq2. "Genome Biology 15 (2014): 550. https: / / pubmed.ncbi.nlm.nih.gov / 25516281). Gene set enrichment analysis (GSEA, RRID: SCR_003199) was performed using the GSEA software package, and the gene set was obtained from the Molecular Characteristic Database (MSigDB) (https: / / www.gsea-msigdb.org / ).
[0087] (9) lncRNA sequencing Total RNA was extracted from EVs using TRIzol reagent (Invitrogen) according to the manufacturer's instructions. According to NEBNext® Ultra TM Following the instructions for the RNA library Prep Kit for Illumina (NEB, USA), RNA fragments were prepared to an average length of approximately 200 bp for first- and second-strand cDNA synthesis, followed by adapter ligation and low-cycle PCR enrichment of the library. The purified library was evaluated using an Agilent 2200 tapstation and a Qubit® 2.0 fluorescence analyzer (Life Technologies, USA). Paired-end sequencing (PE150, 150 bp reads) was performed on the Illumina HiSeq 3000 platform at Guangzhou Ribon Biotechnology Co., Ltd.
[0088] (10) Dual-luciferase reporter assay To evaluate the 3'UTR pair PTGS2 Post-transcriptional regulation was investigated using a dual-luciferase reporter gene assay with the psiCHECK-2 vector system (Promega, USA, RRID: Addgene_196655). PCR amplification was performed. PTGS2 Wild-type (WT) and mutant (Mut) 3' UTR sequences were obtained and cloned downstream of the Renilla luciferase gene in the psiCHECK-2 vector. The putative m was predicted using the online tool SRAMP (http: / / www.cuilab.cn / sramp / ). 6 A modified site. The mutated 3'UTR sequence contains predicted m introduced by site-directed mutation. 6A point mutation at site A. Luciferase activity was measured 24–48 hours after transfection using the Dual-Luciferase® reporter assay system (Promega, USA), according to the manufacturer's protocol. Simply put, cells were lysed in passive lysis buffer, and luciferase activity was quantified using a microplate spectrophotometer. Guinea pig luciferase activity was normalized to firefly luciferase activity as an internal control for transfection efficiency. All experiments were performed in triplicate, and results are expressed as mean ± standard deviation.
[0089] (11) Histological evaluation For hematoxylin and eosin (HE) staining, tissues were fixed in formalin, embedded in paraffin, and sectioned to a thickness of 5 μm. Sections were then dewaxed according to the manufacturer's instructions and stained using an HE staining kit (Solarbio, G1120-3). For Masson's trichrome staining, paraffin-embedded tissue sections were similarly dewaxed and rehydrated via a series of graded alcohols. Staining was performed using a Masson's trichrome staining kit (Solarbio, G1340) to visualize fibers and nuclei. For immunohistochemical (IHC) staining, sections were dewaxed and treated with 3% hydrogen peroxide (H2O2) for 10 minutes to block endogenous peroxidase activity. Antigen extraction was performed at high temperature using 10 mM citrate buffer (pH 6.0). After cooling, sections were blocked with 5% bovine serum albumin (BSA) and incubated overnight with primary antibody at 4°C. The next day, sections were incubated with a suitable secondary antibody and stained with a 3,3'-diaminophenylbiidine (DAB) substrate for visualization. Immunohistochemical staining intensity was independently assessed by two pathologists, and the degree of immunoreactivity was quantified using the immunoreactive score (IRS) system.
[0090] (12) Fluorescence in situ hybridization (FISH) FISH was used to detect the subcellular localization of target lncRNAs. In short, cells were cultured on glass domes, washed twice with PBS, and fixed with 4% paraformaldehyde (Solarbio, Cat# P1110) at room temperature for 15 minutes. After fixation, cells were infiltrated with 0.5% Triton X-100 (Sigma-Aldrich, Cat# T9284) for 10 minutes. Hybridization was performed using lncRNA-specific 5'-fitc-labeled oligonucleotide probes. The probes were designed and synthesized by RiboBio in Guangzhou, China. Hybridization was performed using hybridization buffer (Ribo...). TM Cells were incubated overnight in a humidified chamber using a FISH kit (RiboBio, Cat# C10910). Cell nuclei were reverse-stained with DAPI at room temperature. Images were obtained using a confocal fluorescence microscope (ZEISS LSM880).
[0091] (13) In situ hybridization (ISH) To detect lncRNA on a tissue-based basis, ISH was performed on paraffin-embedded tissue sections using digoxigenin (DIG)-labeled probes. Briefly, 5 μm thick sections were dewaxed in xylene and hydrated with fractionated ethanol. Sections were treated with proteinase K (20 μg / mL, Roche, Cat# 03115836001) at 37°C for 30 min, followed by acetylation with 0.25% acetic anhydride in 0.1 M triethanolamine buffer. Hybridization was performed overnight using a DIG-labeled antisense RNA probe against lncRNA (DIG RNA Labeling Kit, Roche, Cat# 11175025910). DIG signal was detected using an anti-DIG-AP Fab fragment (Roche, Cat# 11093274910) and visualized using NBT / BCIP substrate solution (Roche, Cat# 11681451001).
[0092] (14) RNA extraction and quantification RT-qPCR Total RNA was isolated using TRIzol reagent (Invitrogen) according to the manufacturer's protocol, and then reverse transcribed into cDNA using the HiScript 1st Strand cDNA Synthesis Kit (Vazyme, R111). RT-qPCR was performed using a real-time quantitative PCR kit (Vazyme, Q321) on a rapid real-time quantitative PCR system (Applied Biosystems, CA, USA). GAPDH was used as an internal control, and relative gene expression levels were determined using the 2^-ΔΔCT method. The primers used are shown in Table 1.
[0093] Table 1 Primer sequences used
[0094] (15) Rapid amplification of the ends of full-length lncRNA cDNA (RACE) To obtain the full-length sequence of the target lncRNA, SMARTer was used. TM The RACE 5' / 3' kit (Takara, USA) was used for rapid 5' and 3' amplification (RACE) of cDNA ends according to the manufacturer's instructions. Total RNA was extracted with TRIzol (Invitrogen) and reverse transcribed to obtain 5' and 3' RACE-ready cDNA. Gene-specific primers and nested primers were designed based on partial sequences (see Table 1). PCR products were separated by agarose gel electrophoresis.
[0095] (16) RNA pull-down RNA pull-down assays were performed using the Pierce Magnetic RNA-Protein Pull-Down Kit (ThermoFisher Scientific, 20164) according to the manufacturer's instructions. Biotinylated RNA was synthesized using the T7 Transcription Kit (Thermo Fisher Scientific). 50 pmol of biotinylated RNA and 50 μL of magnetic beads were used for each assay. After incubation and three washing steps, RNA-binding proteins were analyzed by Western blotting, silver staining, or mass spectrometry.
[0096] (17) RNA immunoprecipitation (RIP) RIP assays were performed using the Magna RIP RNA-Binding Protein Immunoprecipitation Kit (17-700, Millipore) according to the manufacturer's instructions. Briefly, Protein A / G magnetic beads (Roche, USA) were incubated overnight at 4°C with 5 μg of specific antibody and cell lysis buffer. After incubation, the resulting immune complexes were washed six times with the provided wash buffer, followed by treatment with proteinase K digestion buffer. RNA was then purified from the complexes, analyzed by qPCR, and normalized to an input control.
[0097] (18) MeRIP Total RNA was detected using a NanoDrop ND-1000, following the manufacturer's instructions using Arraystar Seq-Star. TM Intact mRNA was isolated using the poly(A) mRNA Isolation Kit (Arraystar, MD, USA). The purified mRNA was randomly fragmented into fragments of approximately 100 nt in fragment buffer. Anti-mRNA was then used... 6 Antibody A (Synaptic Systems, Cat#202003, RRID: AB_2279214) immunoprecipitates fragmented mRNA, retaining 1 / 10 of the fragmented mRNA as input.
[0098] (19) RNA stability assay Cells were seeded in 6-well plates and incubated overnight. Cells were then treated with actinomycin D (HY-17559, MCE) at a final concentration of 5 μg / mL for 0, 3, and 6 hours before collection. Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, USA) and analyzed by RT-PCR. mRNA half-life was calculated according to a previously published method (Chen, C.-YA, N. Ezzeddine and A.-B.Shyu. "Messenger RNA half-life measurements in mammalian cells." Methods In Enzymology 448 (2008): 335-57. 10.1016 / S0076-6879(08)02617-7. https: / / pubmed.ncbi.nlm.nih.gov / 19111184.).
[0099] (20) Preparation of lactoferrin-resveratrol (LF-RES) nanoparticles Lactoferrin-resveratrol nanoparticles were prepared using the following method: Lactoferrin (LF) was dissolved in sterile water (pH=8) overnight to obtain a 50 mg / mL lactoferrin solution. Resveratrol (RES) was dissolved in ethanol to obtain a 3 mg / mL resveratrol solution. Then, 0.5 mL of the resveratrol solution and 5 mL of the 50 mg / mL lactoferrin solution were mixed. A 3 mg / mL solution was dissolved in 0.5 mL of ethanol and mixed with the LF solution to obtain a mixture. Free resveratrol was removed from the mixture by centrifugation at 10,000 × g for 10 minutes. Transglutaminase (5 mg) was added, and the mixture was heated and stirred at 45 °C for 2 hours, followed by heating at 80 °C for 10 minutes to inactivate the transglutaminase. Finally, the mixture was dialyzed in water for 1 day to obtain an LF-RES nanoparticle suspension, which was stored at 4 °C for later use.
[0100] (21) Characterization of LF-RES nanoparticles The particle size and zeta potential of LF-RES nanoparticles were measured using a dynamic light scattering instrument (Zetasizer Nano-ZS, Malvern Instruments, UK). The angle was 90° and the refractive index was 1.45. The morphology of the LF-RES nanoparticles was characterized using atomic force microscopy (AFM) and transmission electron microscopy (TEM). The sample suspension was dropped onto a freshly cleaved mica surface and dried with nitrogen. AFM images were obtained using a Multimode Nanoscope-V (Veeco Instruments, USA) in tapping mode. The nominal spring constant of the silica probe was set to 5 N / m. The LF-RES nanoparticle suspension was spread on a carbon-coated copper grid and air-dried at room temperature. The samples were observed using a Tecnai G2 Spirit Twin microscope (FEI, USA) at an accelerating voltage of 200 kV. The content of free RES in the dialysis medium was determined by high performance liquid chromatography (HPLC), and the free RES was considered as unloaded RES to determine the RES content in the LF-RES nanoparticles.
[0101] (22) Lung tissue separation and flow cytometry Animals were euthanized using CO2 inhalation followed by cervical dislocation. The lungs were removed, placed in cold HBSS, and minced with sterile scissors. Tissue fragments were added to 2 mL of digestion buffer with 1 mg / mL Collagenase IV (Worthington), 0.1 mg / mL DNase I (Roche), and 2% FBS, and incubated at 37°C with gentle stirring for 50 minutes. After enzymatic digestion, the tissue was mechanically dissociated by 10-15 up-and-down suction cycles, and the cell suspension was passed through a 70 µm nylon cell filter into a 50 mL tube. Cells were centrifuged at 570 × g for 5 minutes at 4°C, the supernatant was discarded, and the cells were resuspended in 2 mL of erythrocyte lysis buffer for 2 minutes to remove residual red blood cells. Staining was performed in 100 µL of FACS buffer at 4 °C in the dark for 30 min using the following antibodies: anti-mouse CD140a antibody (Thermo Fisher, Cat# 11-1401-80, RRID: AB_2572475), anti-mouse F4 / 80 antibody (Elabscience, Cat# E-AB-F0995C, RRID: AB_3065037), and anti-mouse CD31 (biolgend, Cat#102405, RRID: AB_312900). Data were obtained using a Beckman Coulter CytoFLEX flow cytometer (BeckmanCoulter).
[0102] (23) Statistical analysis All results were derived from at least three independent experiments, and data from one representative experiment are presented. Data are expressed as mean ± SD. For comparisons between two groups, either a two-tailed unpaired Student's test or a two-tailed paired Student's test was used, depending on the experimental design. Comparisons involving more than two groups were performed using one-way or two-way ANOVA, followed by appropriate post-hoc multiple comparison tests where applicable. Chi-square tests were used for categorical variable analysis. Survival rates were assessed using the Kaplan-Meier method and compared using the log-rank test. P A value < 0.05 was considered statistically significant. All statistical analyses were performed using R 4.3.1 (www.r-project.org / ) or GraphPad Prism (8.0, GraphPad Software, USA, RRID:SCR_002798).
[0103] Experimental results: (1) Tumor-derived EVs from highly metastatic osteosarcoma promote the formation of inflammatory PMNs in the lungs. EVs were isolated from highly metastatic osteosarcoma cell lines (143B and SJSA-1) and low-metastatic osteosarcoma cell lines (MNNG / HOS and U2OS). Figure 1 (A). And through TEM ( Figure 1 (B) and Western blotting of established EV markers ( Figure 1 (C) verification. In in vivo experiments ( Figure 1 (Middle D), through PKH26 fluorescent labeling and tail vein injection, it was found that EVs preferentially accumulate in lung tissue ( Figure 1 (Middle E). Subsequently, nude mice were pretreated for 4 weeks with EVs containing either 143B (high metastasis) or MNNG / HOS (low metastasis) cells via tail vein injection, followed by intravenous injection of MNNG / HOS cells. Compared with the PBS and MNNG / HOS EV groups, mice pretreated with 143B-derived EVs had a significantly higher incidence of lung metastases ( Figure 1 (F and G) indicates that EVs derived from highly metastatic osteosarcoma cells promote tumor colonization in the lungs.
[0104] Use HE ( Figure 1 (H) and Masson's trichrome staining ( Figure 1Histological analysis of lung tissue pretreated with 143B-EVs revealed significant inflammatory changes. To investigate potential molecular alterations, the inventors performed RNA sequencing on lung tissue pretreated with 143B-EVs, as well as lung tissue treated with MNNG / HOS EVs and PBS. The results showed a significant upregulation of inflammation-related genes. Figure 1 J and K), enrichment of inflammatory signaling pathways ( Figure 1 (Middle L). These findings suggest that EVs derived from highly metastatic osteosarcoma cells promote the formation of pulmonary PMNs by inducing inflammation.
[0105] (2) lncOSLMT derived from EVs is a key regulator of osteosarcoma PMN formation and a poor prognostic indicator. Increasing evidence suggests that lncRNAs are enriched in tumor-derived EVs and participate in PMN formation. Based on these findings, the inventors performed high-throughput sequencing on EVs from osteosarcoma cell lines with different metastatic potentials (143B vs. MNNG / HOS, SJSA-1 vs. U2OS). Figure 2 (A and B). Seven lncRNAs (lncOSLMT, ENST00000578583.1, NR_125339.1, NR_023312.2, NR_125755.1, NR_023313.2, NR_133645.1) were persistently enriched in EVs released from highly metastatic osteosarcoma cell lines, with lncOSLMT showing the most significant upregulation. Figure 2 (C). The full-length sequence of lncOSLMT was determined using nested PCR with 5' and 3' RACE. Figure 2 (D), and predicted its secondary structure ( Figure 2 (E). RT-qPCR confirmed that lncOSLMT in highly metastatic osteosarcoma cells ( Figure 2 High expression of (F) in both F and its derived EVs Figure 2 (G). FISH analysis ( Figure 2 (H), nuclear cytoplasmic separation ( Figure 2 ISH staining results of the middle I) and patient tissues ( Figure 2 The results from the study showed that lncOSLMT is mainly located in the cytoplasm.
[0106] Further expression analysis of osteosarcoma tissue and adjacent tissues showed that the level of lncOSLMT in the tumor sample was significantly elevated. Figure 2 (K). Importantly, in the tumor tissue of patients with lung metastases ( Figure 2 L and M) and serum EVs ( Figure 2High levels of lncOSLMT expression were also detected in N (nephrotic lung). Kaplan-Meier survival analysis showed that elevated lncOSLMT expression was associated with shortened lung metastasis-free survival and overall survival. Figure 2 (See Table 2). Both univariate and multivariate Cox regression analyses revealed that high expression of lncOSLMT was an independent risk factor for poor prognosis. Figure 2 (See Table 3). This suggests that lncOSLMT could serve as a potential prognostic biomarker for osteosarcoma.
[0107] Table 2. Clinical characteristics of patients included in the Kaplan-Meier survival analysis
[0108] Table 3. Clinical characteristics of patients included in univariate and multivariate analyses
[0109] To investigate the functional role of lncOSLMT, this invention stably overexpressed lncOSLMT in low-metastatic MNNG / HOS cells. Upregulation of lncOSLMT was observed throughout the entire cell line (…). Figure 3 (A) and EVs ( Figure 3 Both were confirmed in (B) and (C). Furthermore, FISH was used to verify its cellular localization (B). Figure 3 EVs isolated from these lncOSLMT-overexpressing cells were injected into nude mice via tail vein (C). Figure 3 (Middle D). HE staining ( Figure 3 (E) and Masson's trichrome staining ( Figure 3 (F) showed that mice pretreated with these EVs exhibited significant lung inflammation. Following tail vein injection of tumor cells, a significantly increased incidence of lung metastasis was observed. Figure 3 (G and H). This indicates that lncOSLMT promotes the formation of inflammatory PMNs in the lungs.
[0110] (3) Osteosarcoma EVs lncOSLMT promotes pro-inflammatory activation of lung fibroblasts through the COX-2 / PGE2 axis. Next, the inventors investigated the cellular localization of osteosarcoma-derived EVs in the lung microenvironment. Twenty-four hours after intravenous injection of fluorescently labeled EVs, lung tissue was collected for cellular uptake analysis. Single-cell suspensions of lung tissue were analyzed by flow cytometry to quantitatively determine the cellular composition of EV-positive cells within the major resident lung cell populations (including fibroblasts, macrophages, and endothelial cells). Figure 4 (A). Simultaneously, immunofluorescence staining was performed on frozen lung sections to observe the distribution of EVs ( ). Figure 4(B) Notably, EVs preferentially accumulate in lung fibroblasts. In vitro co-culture of fibroblasts and EVs confirmed the efficient uptake of EVs. Figure 4 (C)
[0111] To explore the specific regulatory effect of lncOSLMT on fibroblasts, the inventors performed RNA-seq on fibroblasts treated with EVs overexpressing lncOSLMT. Figure 4 Transcriptomic analysis showed a significant upregulation of inflammatory response pathways (D). Figure 4 (Middle E). Combined with previous RNA-seq data from lung tissues treated with highly metastatic and low-metastatic cell-derived EVs ( Figure 1 A comprehensive analysis of H) identified six common upregulated genes ( PTGS2 , AREG , NR4A3 , CFB , CLSPN and P4HA1 () Figure 4 (in F), among which PTGS2 The most significant increase was in ( ). Figure 4 G (in the middle jiao) has been previously reported to be a key downstream effector of the inflammatory response.
[0112] Further in vitro validation showed that treatment of fibroblasts with EVs overexpressing lncOSLMT significantly improved... PTGS2 mRNA expression ( Figure 4 (H) and COX-2 protein levels ( Figure 4 COX-2, encoded by PTGS2, is the rate-limiting enzyme in the synthesis of prostaglandin E2 (PGE2), a key mediator of inflammation. Figure 4 (J). Consistent with this, fibroblasts treated with EVs overexpressing lncOSLMT showed increased PGE2 secretion (J). Figure 4 In vivo, treatment of nude mouse BALF with EVs overexpressing lncOSLMT also showed elevated PGE2 levels (K). Figure 4 (Middle L), because PGE2 secreted in the lung microenvironment can be directly measured in BALF. Furthermore, ELISA analysis showed that EVs from highly metastatic 143B cells significantly increased PGE2 secretion compared to PBS and low-metastatic MNNG / HOS cells. Importantly, this effect was significantly attenuated when treated with 143B cell-derived EVs silenced by lncOSLMT ( Figure 4 These results indicate that EVs lncOSLMT are preferentially uptaken by lung fibroblasts, where they induce pro-inflammatory activation via the COX-2 / PGE2 axis.
[0113] (4) The synergistic effect of lncOSLMT and hnRNPA2B1 in EVs regulates COX-2 signal transduction in receptor cells. hnRNPA2B1 was identified by RNA pull-down combined with mass spectrometry. Figure 5 hnRNPA2B1 (α) is a specific interactor of lncOSLMT, and hnRNPA2B1 is a previously reported RNA-binding protein (RBP) (Wang, L., M. Wen and X. Cao. "Nuclear hnrnpa2b1 initiates and amplifies the innate immune response to DNA viruses." Science (New York, NY) 365 (2019): 10.1126 / science.aav0758. https: / / pubmed.ncbi.nlm.nih.gov / 31320558). The interaction between lncOSLMT and hnRNPA2B1 is mediated by RNA pull-down (α) Figure 5 (F) and RIP ( Figure 5 Further validation was achieved using (G). Furthermore, FISH analysis revealed subcellular co-localization of lncOSLMT and hnRNPA2B1 (G). Figure 5 (H).
[0114] To determine the specific binding region between lncOSLMT and hnRNPA2B1, the inventors constructed a series of truncated RNA fragments ( Figure 5 (I). Analysis showed that the region spanning nucleotides 770-800 is a potential binding segment ( Figure 5 The deletion of this fragment (770-800 nt) significantly reduced the binding ability of hnRNPA2B1 to lncOSLMT. Figure 5 The K region indicates that it is crucial for the interaction.
[0115] Next, we investigated how lncRNA-RBP interactions affect the encapsulation and composition of EVs. After hnRNPA2B1 knockdown ( Figure 5 In the middle L), the level of lncOSLMT in exosomes was significantly reduced ( Figure 5 Conversely, overexpression of wild-type lncOSLMT increased the enrichment of hnRNPA2B1 in EVs, while mutants lacking the 770-800 nt binding region did not produce this effect. Figure 5These findings suggest that the interaction between lncOSLMT and hnRNPA2B1 influences their binding in exosomes. EVs extracted from cells overexpressing wild-type or mutant lncOSLMT are used to treat fibroblasts ( Figure 5 Western blot analysis showed that fibroblasts exposed to wild-type lncOSLMT-derived EVs exhibited elevated hnRNPA2B1 levels and upregulation of the downstream effector COX-2, while mutant lncOSLMT-EVs did not show this effect. Figure 5 These results indicate that the interaction between lncOSLMT and hnRNPA2B1 is related to their co-packaging into EVs and is involved in regulating the hnRNPA2B1-COX-2 signaling axis in receptor fibroblasts.
[0116] (5) hnRNPA2B1 recognizes m 6 A modifies PTGS2 3'UTR regulates COX-2 expression via RNA stabilization. According to reports, hnRNPA2B1 can bind to m 6 A-modified transcripts regulate their stability. To investigate how hnRNPA2B1 regulates COX-2 expression, the inventors studied its role as an m 6 The function of the A reader and its interaction with transcripts. RIP-qPCR revealed that hnRNPA2B1 directly interacts with... PTGS2 mRNA interaction ( Figure 6 (A). Knockdown of hnRNPA2B1 resulted in a significant decrease in COX-2 protein expression. Figure 6 (B) at the same time PTGS2 Decreased mRNA stability Figure 6 (C), suggesting the existence of a post-transcriptional regulatory mechanism. Using m from the GEO database... 6 A CLIP / IP data ( Figure 6 (D) and the online prediction tool SRAMP ( Figure 6 (E), confirmed PTGS2 Potential mRNA on mRNA 6 A modification site. Based on these findings, the inventors hypothesize that hnRNPA2B1 may be related to... PTGS2 mRNA on mRNA 6 A modification site binds to enhance its stability ( Figure 6 (Middle F).
[0117] In order to evaluate m 6 A modifies in PTGS2 The existence of the above, the inventor used anti-m 6 Antibody A was used for m6A-RIP, and it was found that... PTGS2 mRNA significantly enriched ( Figure 6 (G). It is worth noting that m 6 A core methyltransferase METTL3 ( Figure 6 The knockdown of H) led to PTGS2 mRNA on mRNA 6 A level decreased ( Figure 6 (I), which in turn weakens hnRNPA2B1 and PTGS2 The combination of these elements has been confirmed by RIP experiments. Figure 6 (J), and further reduced the stability of its mRNA ( Figure 6 (Middle K). To plot hnRNPA2B1 in PTGS2 The binding region on mRNA, RNA pull-over experiments showed that hnRNPA2B1 mainly binds to... PTGS2 The 3'UTR. The m predicted in the 3'UTR segment. 6 A site mutation causes hnRNPA2B1 and PTGS2 Interactions between mRNAs are broken ( Figure 6 (L), indicating that this interaction depends on m in the 3'UTR. 6 Modification of A. Furthermore, analysis of RNA-seq expression data from GTEx Portal (https: / / gtexportal.org / ) revealed that in lung tissue... PTGS2 It is positively correlated with hnRNPA2B1 mRNA levels. Figure 6 (M). Dual-luciferase reporter gene assays further confirmed that hnRNPA2B1 and... PTGS2 mRNA binding is achieved through the 3'UTR m 6 A-modified mediating ( Figure 6 (N and O). Treatment of HFL-1 cells with EVs carrying wild-type lncOSLMT significantly improved PTGS2 The stability of mRNA was significantly affected, while the stability of vector control or EVs derived from overexpression of the Δ770-800 lncOSLMT mutant was not significantly affected. Figure 6 (P). In summary, these findings indicate that hnRNPA2B1 binds to... PTGS2 3'UTR in m 6 The A-modified site promotes mRNA stability and regulates COX-2 expression.
[0118] (6) LF-RES-siRNA nanoparticles combined with EP2 / EP4 inhibitors alleviate lung inflammation and metastasis induced by EVs-derived lncOSLMT. The clinical application of siRNA therapy remains limited due to challenges in delivery efficiency, stability, and tissue-specific targeting. Lactoferrin (LF) is a mammalian cationic glycoprotein with strong tumor-targeting capabilities through receptor-mediated endocytosis, while resveratrol (RES) is a polyphenol compound with the ability to enhance nucleic acid transfection. To leverage the synergistic effect of LF and RES in tumor-targeting siRNA delivery, LF-RES nanoparticles were synthesized via a one-step transglutaminase-catalyzed cross-linking reaction between glutamine residues in LF and lysine residues in RES. Subsequently, negatively charged siRNA targeting lncOSLMT was efficiently loaded onto the cationic LF-RES nanoparticles through simple electrostatic interactions, forming LF-RES-siRNA nanoparticles. Figure 7 (A). Atomic force microscopy (AFM) was used. Figure 7 B, Figure 8 (A) and transmission electron microscopy (TEM) Figure 8 (B) Characterization of the nanoparticles. The average particle size of the LF-RES nanoparticles was 625±58 nm, and the zeta potential was 21.30±1.99 mV. The RES loading content of the LF-RES nanoparticles was 0.18 mg / mL. The biodistribution of the nanoparticles in ex vivo organs was as follows: Figure 8 As shown in C. Compared with PBS, free siRNA, or LF-RES alone, LF-RES-siRNA nanoparticles significantly reduced EV-induced lung inflammation ( Figure 7 (C and D). H&E and masson staining of lung sections showed decreased pathological changes, and IHC showed decreased COX-2 expression. Figure 7 In the middle E), the PGE2 level in BALF decreased ( Figure 7 (F). Furthermore, in a tail vein injection model of tumor metastasis, LF-RES-siRNA nanoparticle therapy significantly reduced the lung metastasis burden (F). Figure 7 (G and H).
[0119] Antagonists of PGE2 receptors EP2 and EP4 have been clinically investigated due to their anti-inflammatory and anti-cancer potential. Interestingly, combining LF-RES-siRNA nanoparticles with PGE2 receptor and EP2 / EP4 antagonists can enhance therapeutic effects. Figure 9 (A), in inhibiting inflammation ( Figure 9 (B and C) and reducing the burden of lung metastases ( Figure 9 The results showed that LF-RES-siRNA nanoparticles provided an effective siRNA delivery platform. When used in combination with EP2 / EP4 inhibitors, this strategy offered an effective approach to alleviate EV-induced lung inflammation and inhibit metastasis.
[0120] in conclusion: In summary, this study reveals a novel mechanism by which EV-derived lncOSLMT promotes lung metastasis by regulating the formation of inflammatory stromal cells (PMNs). Mechanistically, lncOSLMT promotes lung metastasis through the hnRNPA2B1 / COX-2 / PGE2 axis. 6 A modification-dependent pathway binds to hnRNPA2B1, thereby activating lung fibroblasts. Furthermore, LF-RES-based siRNA delivery demonstrated therapeutic potential. Co-administration with EP2 / EP4 antagonists further improved therapeutic efficacy. These findings provide new insights into the molecular mechanisms driving organ-specific metastasis and establish proof-of-concept for lncRNA-based anti-metastasis strategies.
[0121] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.
Claims
1. The application of a reagent for detecting lncOSLMT in the preparation of products for risk diagnosis or prognostic assessment of osteosarcoma lung metastases, wherein the nucleotide sequence of lncOSLMT is shown in SEQ ID NO:
1.
2. The application according to claim 1, characterized in that, The lncOSLMT includes lncOSLMT in osteosarcoma cell exosomes; and / or, the reagent includes reagents for quantitative detection of lncOSLMT; Preferably, the reagents include reagents for detecting lncOSLMT at the gene or protein level; Preferably, the reagents include those for detecting the lncOSLMT by enzyme-linked immunosorbent assay (ELISA), immunofluorescence assay, radioimmunoassay, immunoprecipitation assay, Western blotting, high performance liquid chromatography (HPLC), capillary gel electrophoresis, near-infrared spectroscopy, mass spectrometry, immunochemiluminescence assay, colloidal gold immunochromatography, fluorescence immunochromatography, surface plasmon resonance (SPR), PCR, immuno-PCR, or biotin-avidin assay.
3. The use of lncOSLMT inhibitors in the preparation of drugs for the prevention and / or treatment of osteosarcoma lung metastases, wherein the nucleotide sequence of said lncOSLMT is shown in SEQ ID NO:
1.
4. The application according to claim 3, characterized in that, The lncOSLMT inhibitor is at least one of the following: a substance that inhibits lncOSLMT activity, a substance that degrades lncOSLMT, a substance that reduces lncOSLMT expression level, or a substance that knocks out / knocks down lncOSLMT expression. Preferably, the lncOSLMT inhibitor is at least one of a1)-a5): a1) siRNA, dsRNA, miRNA, sgRNA, ribozyme, or shRNA that target lncOSLMT; a2) Nucleic acid molecules encoding the siRNA, dsRNA, miRNA, sgRNA, ribozyme, or shRNA that targets lncOSLMT as described in a2); a3) An expression cassette, vector, or transgenic cell line containing the nucleic acid molecules described in a2); a4) Small molecule drugs targeting lncOSLMT; a5) hnRNPA2B1 inhibitor; Preferably, the lncOSLMT inhibitor is at least one of b1)-b4): b1) siRNA targeting lncOSLMT; b2) A nucleic acid molecule encoding the siRNA targeting lncOSLMT described in b1); b3) Expression cassettes, vectors, or transgenic cell lines containing the nucleic acid molecules described in b2); b4) hnRNPA2B1 inhibitor; Preferably, the nucleotide sequence of the siRNA is shown in SEQ ID NO:
20.
5. An siRNA, the nucleotide sequence of which is shown in SEQ ID NO:
20.
6. A biomaterial related to the siRNA of claim 5, wherein the biomaterial comprises any one of 1)-12): 1) A nucleic acid molecule encoding the siRNA of claim 5; 2) An expression cassette containing the nucleic acid molecule described in 1); 3) A carrier containing the nucleic acid molecule described in 1); 4) A carrier containing the expression box described in 2); 5) Transgenic cell lines containing the nucleic acid molecules described in 1); 6) A transgenic cell line containing the expression cassette described in 2); 7) Transgenic cell lines containing the vector described in 3); 8) A transgenic cell line containing the vector described in 4); 9) Recombinant microorganisms containing the nucleic acid molecules described in 1); 10) Recombinant microorganisms containing the expression cassette described in 2); 11) Recombinant microorganisms containing the vector described in 3); 12) Recombinant microorganisms containing the vector described in 4).
7. A nanoparticle comprising the siRNA and carrier particles as described in claim 5; Preferably, the siRNA is loaded onto the carrier particles via electrostatic interactions.
8. The nanoparticles according to claim 7, characterized in that, The carrier particles are lactoferrin-resveratrol nanoparticles; Preferably, the lactoferrin-resveratrol nanoparticles are obtained by cross-linking glutamine residues in lactoferrin and lysine residues in resveratrol under the catalysis of transglutaminase.
9. The use of the siRNA of claim 5, the biomaterial of claim 6, or the nanoparticles of claim 7 or 8 in the preparation of a medicament for the prevention and / or treatment of osteosarcoma lung metastases.
10. A drug comprising the siRNA of claim 5, the biomaterial of claim 6, and the nanoparticles of claim 7 or 8; Preferably, the drug further includes at least one of hnRNPA2B1 inhibitor, PGE2 antagonist, or EP2 / EP4 antagonist.