A molecular marker related to beef cattle muscle meat quality traits, amino acid and fatty acid content and application thereof

By applying molecular marker technology to beef cattle and using specific SNP loci to assess the genotype of beef cattle, the problem that traditional feeding methods cannot improve beef quality has been solved, enabling rapid and accurate beef cattle breeding and improving the screening efficiency of meat quality and nutritional components.

CN122128443AActive Publication Date: 2026-06-02JILIN ACAD OF AGRI SCI

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
JILIN ACAD OF AGRI SCI
Filing Date
2026-04-30
Publication Date
2026-06-02

Smart Images

  • Figure CN122128443A_ABST
    Figure CN122128443A_ABST
Patent Text Reader

Abstract

This invention relates to the field of marker-assisted breeding technology, and in particular to a molecular marker related to the muscle quality traits, amino acid content, and fatty acid content of beef cattle, and its application. Through sequencing and polymorphism analysis of 106 Yanhuang cattle, this invention identified an SNP site located in exon 2 of the CRYAB gene. Based on this, a molecular marker was developed. This marker not only enables rapid and accurate typing of the CRYAB gene in beef cattle (such as Yanhuang cattle), but also shows a significant correlation with individual meat quality traits, amino acid content, and fatty acid content. Based on the genotype of the molecular marker, individuals with higher overall meat quality traits can be screened at an early stage, thereby improving the speed of breeding superior beef cattle.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular marker-assisted breeding technology, and in particular to a molecular marker related to the muscle quality traits, amino acid and fatty acid content of beef cattle and its application. Background Technology

[0002] Beef, as an important and high-quality animal meat, occupies a significant position in meat consumption. With the continuous improvement of people's living standards and the increasing attention to food quality and safety, people have higher requirements for beef quality. Therefore, improving beef quality has become a key issue that the cattle industry urgently needs to address. Currently, simply relying on traditional feeding methods to regulate nutritional levels cannot significantly improve beef quality. Analyzing the influencing factors of beef quality from the perspectives of genetic basis and molecular mechanisms provides a new approach to solving these problems. Therefore, seeking molecular markers that can affect beef quality, such as meat texture, amino acid content, and fatty acid content, is of great significance for improving beef quality. Summary of the Invention

[0003] To address the aforementioned problems, this invention provides molecular markers related to the meat quality traits, amino acid and fatty acid content of beef cattle, and their applications. The molecular markers provided by this invention can be used for early screening of beef cattle with superior meat quality traits (such as Yanhuang cattle), offering advantages in speed and accuracy, and improving the breeding efficiency of superior beef cattle.

[0004] To achieve the above objectives, the present invention provides the following technical solution: This invention provides a molecular marker related to the meat quality traits, amino acid content, and fatty acid content of beef cattle muscle. The molecular marker is a nucleic acid molecule containing an SNP site and its upstream and downstream sequences. The SNP site is located at position 31354722 on chromosome 15 of the reference genome GCF_002263795.3 and exhibits G / A polymorphism. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and the SNP site is located at position 264 bp.

[0005] This invention provides the application of reagents for detecting the molecular markers described in the above-mentioned technical solutions in one or more of 1) to 4): 1) Assess the meat quality traits of beef; the meat quality traits include one or more of the following: tenderness, centrifugal water loss, intramuscular fat content, and initial moisture content; 2) Assess the amino acid content in beef beef; 3) Assess the fatty acid content in beef; the fatty acids include one or more of oleic acid, linoleic acid, and arachidonic acid; 4) Beef cattle breeding; Evaluation was conducted based on the genotype of the SNP loci described in the molecular markers of beef cattle, including: AA genotype beef cattle have higher meat tenderness and / or initial moisture content than GG or GA genotype beef cattle. The centrifugal water loss rate of GG genotype beef cattle is lower than that of AA genotype beef cattle. Beef cattle with the GG or GA genotypes have higher intramuscular fat content than beef cattle with the AA genotype. The amino acid content of AA genotype beef cattle is higher than that of GG or GA genotype beef cattle. AA genotype beef cattle have higher levels of linoleic acid and / or arachidonic acid than GG or GA genotype beef cattle. The oleic acid content of GG genotype beef cattle is higher than that of AA genotype beef cattle. The amino acids include one or more of glutamic acid, leucine, lysine, and arginine; The beef cattle in question are Yanhuang cattle.

[0006] Preferably, the beef cattle breeding involves selecting beef cattle with superior indicators based on the genotype of the SNP locus in the molecular marker.

[0007] Preferably, the reagent comprises primer pairs that specifically amplify the SNP site and its upstream and downstream sequences.

[0008] Preferably, the primer pair consists of an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3.

[0009] This invention provides a method for evaluating the beef quality traits, amino acid content, and fatty acid content of beef, comprising the following steps: Using the genomic DNA of the cattle to be tested as a template, PCR amplification was performed using primer pairs to obtain the amplification products; The amplification products are sequenced to determine the genotype of the SNP site; the SNP site is the SNP site in the molecular marker described in the above technical solution; Evaluation is performed based on the genotype of the SNP locus, including: AA genotype beef cattle have higher meat tenderness and / or initial moisture content than GG or GA genotype beef cattle. The centrifugal water loss rate of GG genotype beef cattle is lower than that of AA genotype beef cattle. The intramuscular fat content of GG or GA genotype beef cattle is higher than that of AA genotype beef cattle. The amino acid content of AA genotype beef cattle is higher than that of GG or GA genotype beef cattle. AA genotype beef cattle have higher levels of linoleic acid and / or arachidonic acid than GG or GA genotype beef cattle. The oleic acid content of GG genotype beef cattle is higher than that of AA genotype beef cattle. The amino acids include one or more of glutamic acid, leucine, lysine, and arginine; The beef cattle in question are Yanhuang cattle.

[0010] Preferably, the primer pair consists of an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3.

[0011] Beneficial effects: This invention provides a molecular marker associated with the meat quality traits, amino acid content, and fatty acid content of beef cattle. The molecular marker is a nucleic acid molecule containing an SNP site and its upstream and downstream sequences. The SNP site is located at position 31354722 on chromosome 15 of the reference genome GCF_002263795.3, exhibiting G / A polymorphism. This invention discovered an SNP site located in exon 2 of the CRYAB gene through sequencing and polymorphism analysis of 106 Yanhuang cattle. Based on this, a molecular marker was developed. This molecular marker not only enables rapid and accurate typing of the CRYAB gene in beef cattle (such as Yanhuang cattle) populations, but also shows a significant correlation with individual meat quality traits, amino acid content, and fatty acid content. Based on the genotype of the molecular marker, individuals with higher overall meat quality traits can be screened at an early stage, thereby improving the breeding speed of superior beef cattle. Attached Figure Description

[0012] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly introduced below.

[0013] Figure 1 Electrophoresis diagram of PCR amplification products of exon 2 of the CRYAB gene in beef cattle; where M is the marker, and from top to bottom are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp. Figure 2 This is a sequence alignment diagram of the second exon of the CRYAB gene in beef cattle. Figure 3 This is a diagram showing the genotyping results of the three types of the second exon of the CRYAB gene in beef cattle. Detailed Implementation

[0014] This invention provides a molecular marker associated with the meat quality traits, amino acid content, and fatty acid content of beef cattle muscle. The molecular marker is a nucleic acid molecule containing an SNP site and its upstream and downstream sequences. The SNP site is located at position 31354722 on chromosome 15 of the reference genome GCF_002263795.3, exhibiting G / A polymorphism. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and is detailed below: 5'-AATCCCCAATCACAAGTCCTCATGAACGGGCGGTGAGCTGGGATAATAAAACTCCTGACATCACCATTCCAGAAGCTTCACAAGACTGCGTATATAAGGGGGCTGGCTGCAGCTGCGGCTGAAGGAGCTGACCAGCCAGCTGACGCCACACACTCACCTAACCACCATGGATATCGCCATCCACCACCCCTGGATCCGCCGCCCCTTCTTCCCTTTCCAC TCTCCCAGCCGCCTCTTGACCAGTTTTTTGGCGAGCACCTGTTRGAGTCTGATCTCTTCCCAGCTTCTACTTCCCTGAGCCCCTTCTACCTTCGGCCGCCCTCATTTCTG CGGGCACCCAGCTGGATTGACACTGGCCTCTCAGAGGTAAGTCCCCTTTTCCCGGACAGGAGAGTTCATTCTGG-3'; the SNP site is located at 264 bp, that is, the degenerate base R is the SNP site.

[0015] This invention, through sequencing and polymorphism analysis of 106 Yanhuang cattle, identified an SNP site located in exon 2 of the CRYAB gene. Based on this, a molecular marker was developed. This marker can be used for early screening of beef cattle with superior meat quality traits (such as Yanhuang cattle). Specifically, beef cattle with the AA genotype showed superior overall meat quality traits compared to those with the GG and GA genotypes, offering advantages in speed and accuracy, thus improving the breeding efficiency of superior beef cattle. Furthermore, the molecular marker of this invention showed significant correlations with the meat quality traits, amino acid content, and fatty acid content of individual beef cattle, demonstrating higher accuracy compared to traditional single-genotype selection. It has significant advantages in screening beef cattle with high amino acid content, saving feeding costs and improving the breeding efficiency of superior beef cattle.

[0016] Based on the above advantages, the present invention provides the application of the reagent for detecting the molecular markers described in the above technical solutions in one or more of 1) to 4): 1) Assess the meat quality traits of beef; the meat quality traits include one or more of the following: tenderness, centrifugal water loss, intramuscular fat content, and initial moisture content; 2) Assess the amino acid content in beef beef; 3) Assess the fatty acid content in beef; the fatty acids include one or more of oleic acid, linoleic acid, and arachidonic acid; 4) Beef cattle breeding; Evaluation was conducted based on the genotype of the SNP loci described in the molecular markers of beef cattle, including: AA genotype beef cattle have higher meat tenderness and / or initial moisture content than GG or GA genotype beef cattle. The centrifugal water loss rate of GG genotype beef cattle is lower than that of AA genotype beef cattle. The intramuscular fat content of GG or GA genotype beef cattle is higher than that of AA genotype beef cattle. The amino acid content of AA genotype beef cattle is higher than that of GG or GA genotype beef cattle. AA genotype beef cattle have higher levels of linoleic acid and / or arachidonic acid than GG or GA genotype beef cattle. The oleic acid content of GG genotype beef cattle is higher than that of AA genotype beef cattle. The amino acids include one or more of glutamic acid, leucine, lysine, and arginine; The beef cattle in question are Yanhuang cattle.

[0017] In one implementation, the beef cattle breeding involves selecting beef cattle with superior indicators based on the genotype of the SNP locus in the molecular marker.

[0018] In one implementation, the beef cattle breeding involves selecting beef cattle with superior indicators based on the genotype of the SNP locus in the molecular marker.

[0019] In one embodiment, the reagent includes primer pairs that specifically amplify the SNP site and its upstream and downstream sequences.

[0020] In one embodiment, the primer pair consists of an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3.

[0021] Based on the above advantages, the present invention provides a method for evaluating the beef quality traits, amino acid content, and fatty acid content of beef, comprising the following steps: Using the genomic DNA of the cattle to be tested as a template, PCR amplification was performed using primer pairs to obtain the amplification products; The amplification products are sequenced to determine the genotype of the SNP site; the SNP site is the SNP site in the molecular marker described in the above technical solution; Evaluation is performed based on the genotype of the SNP locus, including: AA genotype beef cattle have higher meat tenderness and / or initial moisture content than GG or GA genotype beef cattle. The centrifugal water loss rate of GG genotype beef cattle is lower than that of AA genotype beef cattle. The intramuscular fat content of GG or GA genotype beef cattle is higher than that of AA genotype beef cattle. The amino acid content of AA genotype beef cattle is higher than that of GG or GA genotype beef cattle. AA genotype beef cattle have higher levels of linoleic acid and / or arachidonic acid than GG or GA genotype beef cattle. The oleic acid content of GG genotype beef cattle is higher than that of AA genotype beef cattle. The amino acids include one or more of glutamic acid, leucine, lysine, and arginine; The beef cattle in question are Yanhuang cattle.

[0022] In one embodiment, the primer pair consists of an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3.

[0023] To further illustrate the present invention, the following detailed description, in conjunction with embodiments and accompanying drawings, describes a molecular marker related to the meat quality traits, amino acid and fatty acid content of beef cattle muscle and its application, but these descriptions should not be construed as limiting the scope of protection of the present invention.

[0024] Example 1 1. Sample collection Blood was collected from the jugular vein of 106 Yanhuang cattle born in the same farm and raised in the same environment. The blood was placed in anticoagulant tubes and stored at 4°C.

[0025] 2. Genomic DNA extraction Genomic DNA was extracted using a rapid blood genomic DNA extraction kit (Axygen, USA), and its concentration and purity were determined using an ultra-micro spectrophotometer. Qualified DNA samples were aliquoted and stored at -80°C.

[0026] 3. Primer design Based on the sequence information of the beef bovine CRYAB gene (NM_174290.2) published in GenBank, primers for amplifying exon 2 of the CRYAB gene were designed using PrimerPremier 5.0 software. The target fragment length was 406 bp. The primers were synthesized by Shanghai Sangon Biotech Co., Ltd., and the primer sequences are as follows: Upstream primer: 5'-AATCCCCAATCACAAGTCCTCA-3', SEQ ID NO.2; Downstream primer: 5'-CCAGAATGAACTCTCCTGTCCG-3', SEQ ID NO.3.

[0027] 4. PCR amplification The PCR reaction system consisted of 20 μL: 10 μL of 2×ES Taq Master Mix, 0.4 μL each of upstream and downstream primers, 1 μL of DNA, and 8.2 μL of ddH2O.

[0028] The PCR reaction program was as follows: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 30 s, 57.7℃ annealing for 30 s, 72℃ extension for 25 s, for a total of 34 cycles; 72℃ extension for 5 min; and storage at 12℃.

[0029] The PCR products were detected by 2.0% agarose gel electrophoresis. The PCR products with bright bands were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The electrophoresis image of the PCR amplification of exon 2 of the CRYAB gene is shown below. Figure 1 As shown, the fragment length is approximately 406 bp, consistent with the expected size.

[0030] 5. Sequencing and sequence analysis The PCR amplification product of the target fragment was recovered from the gel and subjected to Sanger sequencing. Comparison analysis using DNAMAN 8 software with the CRYAB gene mRNA sequence (NM_174290.2) revealed a polymorphic site G>A in exon 2 of the CRYAB gene, located at chr.15:31354722 in the genome at GCF_002263795.3. The sequence alignment diagram of exon 2 of the CRYAB gene in beef cattle is shown below. Figure 2 As shown.

[0031] 6. Polymorphism analysis of CRYAB gene in beef cattle The polymorphism analysis and genetic index results of the polymorphic locus chr.15:31354722 are shown in Table 1. The results showed that the genotypes at the chr.15:31354722 locus of the CRYAB gene in the Yanhuang cattle population were GG, GA, and AA, respectively; the alleles were G, A, and AA, respectively. Figure 3Chi-square goodness test showed that the three loci were in Hardy-Weinberg equilibrium in the Yanhuang cattle population. P >0.05).

[0032] Table 1. Polymorphism analysis and genetic indicators of CRYAB gene in Yanhuang cattle.

[0033] 7. Association analysis of genetic variation of CRYAB gene in beef cattle with meat quality traits According to the methods described in NY / T1333—2007 Determination of Meat Quality of Livestock and Poultry, the following parameters were measured in 106 Yanhuang cattle: pressing moisture, cooked meat yield, meat tenderness, cooking loss, thawing loss rate, centrifugal water loss rate, meat color (24h), meat color (1h), pH (1h), pH (24h), drip loss (24h), drip loss (48h), drip loss (72h), intramuscular fat content, initial moisture content, protein content (dry basis), and eye muscle area. Association analysis was performed between the three genotypes and meat quality traits in the Yanhuang cattle population; the results are shown in Table 2.

[0034] The results showed that the tenderness and initial moisture content of individuals with the AA genotype were significantly higher than those with the GG and GA genotypes, while the centrifugal water loss rate of individuals with the AA genotype was significantly higher than that of individuals with the G genotype. Individuals containing the G allele had significantly higher intramuscular fat content than homozygous mutant (AA) individuals. Except for the indicators in Table 2, the SNP locus (chr.15:31354722) genotype was not significantly correlated with other detected meat quality traits.

[0035] Table 2. Results of the significance test for the differences in meat quality traits among different genotypes of the CRYAB gene in Yanhuang cattle.

[0036] Note: Different lowercase letters in the superscript of data from the same row indicate significant differences. P <0.05).

[0037] 8. Correlation analysis between genetic variation of the CRYAB gene and amino acid content in beef cattle The amino acid content of aspartic acid, threonine, serine, glutamic acid, proline, glycine, alanine, valine, methionine, isoleucine, leucine, tyrosine, phenylalanine, histidine, lysine, and arginine in 106 Yanhuang cattle were determined according to the method described in GB / T 5009.124—2016. The association analysis between the three genotypes and amino acid content in the Yanhuang cattle population is shown in Table 3.

[0038] The results showed that the contents of glutamic acid, leucine, lysine, and arginine in individuals with the AA genotype were significantly higher than those in individuals with the GG and GA genotypes, indicating that individuals with the A allele had significantly higher contents of glutamic acid, leucine, lysine, and arginine than homozygous wild-type (GG) individuals. The SNP locus (chr.15:31354722) genotype was not significantly correlated with the contents of glutamic acid, leucine, lysine, and arginine.

[0039] Table 3. Results of the significance test for the differences in amino acid content among different genotypes of the CRYAB gene in Yanhuang cattle (unit: g / 100g)

[0040] Note: Different lowercase letters in the superscript of data from the same row indicate significant differences. P <0.05).

[0041] 9. Association analysis of genetic variation of CRYAB gene in beef cattle with fatty acid content The myristic acid, myristoleic acid, pentadecanoic acid, palmitic acid, palmitoleic acid, heptadecanoic acid, methyl cis-10-heptadecenoic acid, stearic acid, oleic acid, linoleic acid, and arachidonic acid content in 106 Yanhuang cattle were detected according to the method described in GB / T 5009.168—2016. The association analysis between the three genotypes and fatty acid content in the Yanhuang cattle population is shown in Table 4.

[0042] The results showed that the AA genotype individuals in this population had significantly higher levels of linoleic acid and arachidonic acid than the GG and GA genotype individuals, indicating that individuals with the A allele had significantly higher levels of linoleic acid and arachidonic acid than homozygous wild-type (GG) individuals; the GG genotype individuals had significantly higher oleic acid levels than homozygous mutant (AA) individuals. The SNP locus (chr.15:31354722) genotype was correlated with the levels of oleic acid, linoleic acid, and arachidonic acid, but not significantly correlated with the levels of other detected fatty acids.

[0043] Table 4. Significance test results of fatty acid content differences among different genotypes of the CRYAB gene in Yanhuang cattle (unit: %)

[0044] Note: Different lowercase letters in the superscript of data from the same row indicate significant differences. P <0.05).

[0045] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A molecular marker associated with the meat quality traits, amino acid content, and fatty acid content of beef cattle muscle, characterized in that, The molecular marker is a nucleic acid molecule containing an SNP site and its upstream and downstream sequences. The SNP site is located at position 31354722 on chromosome 15 of the reference genome GCF_002263795.3 and exhibits G / A polymorphism. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and the SNP site is located at position 264 bp.

2. The use of the reagent for detecting the molecular marker as described in claim 1 in one or more of 1) to 4): 1) Assess the meat quality traits; the meat quality traits include one or more of the following: tenderness, centrifugal water loss, intramuscular fat content, and initial moisture content; 2) Assess the amino acid content in beef beef; 3) Assess the fatty acid content in beef; the fatty acids include one or more of oleic acid, linoleic acid, and arachidonic acid; 4) Beef cattle breeding; Evaluation was conducted based on the genotype of the SNP loci described in the molecular markers of beef cattle, including: AA genotype beef cattle have higher meat tenderness and / or initial moisture content than GG or GA genotype beef cattle. The centrifugal water loss rate of GG genotype beef cattle is lower than that of AA genotype beef cattle. The intramuscular fat content of GG or GA genotype beef cattle is higher than that of AA genotype beef cattle. The amino acid content of AA genotype beef cattle is higher than that of GG or GA genotype beef cattle. AA genotype beef cattle have higher levels of linoleic acid and / or arachidonic acid than GG or GA genotype beef cattle. The oleic acid content of GG genotype beef cattle is higher than that of AA genotype beef cattle. The amino acids include one or more of glutamic acid, leucine, lysine, and arginine; The beef cattle in question are Yanhuang cattle.

3. The application according to claim 2, characterized in that, The beef cattle breeding involves selecting beef cattle with superior indicators based on the genotype of the SNP locus in the molecular marker.

4. The application according to claim 2, characterized in that, The reagents include primer pairs that specifically amplify the SNP site and its upstream and downstream sequences.

5. The application according to claim 4, characterized in that, The primer pair consists of an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

3.

6. A method for evaluating the beef quality traits, amino acid content, and fatty acid content of beef, characterized in that, Includes the following steps: Using the genomic DNA of the cattle to be tested as a template, PCR amplification was performed using primer pairs to obtain the amplification products; The amplified products were sequenced to determine the genotype of the SNP locus. The SNP site is the SNP site in the molecular marker according to claim 1; Evaluation is performed based on the genotype of the SNP locus, including: AA genotype beef cattle have higher meat tenderness and / or initial moisture content than GG or GA genotype beef cattle. The centrifugal water loss rate of GG genotype beef cattle is lower than that of AA genotype beef cattle. The intramuscular fat content of GG or GA genotype beef cattle is higher than that of AA genotype beef cattle. The amino acid content of AA genotype beef cattle is higher than that of GG or GA genotype beef cattle. AA genotype beef cattle have higher levels of linoleic acid and / or arachidonic acid than GG or GA genotype beef cattle. The oleic acid content of GG genotype beef cattle is higher than that of AA genotype beef cattle. The amino acids include one or more of glutamic acid, leucine, lysine, and arginine; The beef cattle in question are Yanhuang cattle.

7. The method according to claim 6, characterized in that, The primer pair consists of an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3.