Application of SNP haplotype molecular marker related to average daily gain of large white pig

By using GWAS and linkage disequilibrium analysis, SNP haplotype molecular markers related to average daily weight gain in Large White pigs were identified. This solved the problems of low accuracy and low efficiency in screening for average daily weight gain in existing technologies, enabling early and efficient breeding and improving breeding efficiency and economic benefits.

CN122128446APending Publication Date: 2026-06-02WUHAN POLYTECHNIC UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610598200.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-30
Publication Date
2026-06-02

Smart Images

  • Figure CN122128446A_ABST
    Figure CN122128446A_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of animal molecular breeding, and particularly relates to application of a SNP haplotype molecular marker related to average daily weight gain of Large White pigs, wherein the SNP haplotype molecular marker comprises 12 loci of SNP1-SNP12, when the combination of SNP1-SNP12 is TTGCCCCACAGT in turn, the average daily weight gain of the Large White pig is higher than that of the combination of TCATATTTTGGC; the application refers to any one of the following: identifying the average daily weight gain of the Large White pig; improving the average daily weight gain of offspring of the Large White pig. Based on the application, in the actual breeding process, the H001 (TTGCCCCACAGT) haplotype individual is reserved, which is beneficial to screening of the high average daily weight gain individual and breeding, and improves the accuracy of early selection of the average daily weight gain trait of the Large White pig, and has good economic benefits and wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of animal molecular breeding technology, specifically involving the application of a SNP haplotype molecular marker related to the average daily weight gain of Large White pigs. Background Technology

[0002] As the world's largest producer and consumer of pork, my country's massive consumption base has kept its pig inventory and slaughter volume at consistently high levels, with pork accounting for over 60% of total meat consumption. In pig farming, the growth performance of pigs directly impacts the economic benefits of the industry. Average daily gain (ADG), a key indicator of growth performance in pig farming, measures the rate of growth of pigs over a specific feeding cycle, directly affecting feed utilization efficiency and indirectly reflecting the level of feeding management. Improving ADG is crucial for the production efficiency and economic benefits of pig farms.

[0003] Average daily weight gain is a quantitative trait regulated by multiple genes, with a heritability of 0.19–0.4, classifying it as a low to medium heritability trait. This indicates that the trait possesses stable genetic improvement potential and can be enhanced through selective breeding and genetic regulation. Genomic variation is a crucial genetic basis for individual differences in pigs. Single nucleotide polymorphisms (SNPs), as the most common type of mutation, account for over 90% of genomic polymorphisms and are one of the main factors leading to phenotypic differences. Screening and identifying relevant candidate genes or gene mutation sites can help improve the average daily weight gain trait in pigs through marker-assisted selection, accelerating the process of genetic improvement in pigs.

[0004] With the development of high-throughput sequencing technology, genome-wide association studies (GWAS) have become an important tool for elucidating the localization of genetic variations in complex traits in pigs. They are widely used to identify genetic variations and candidate genes associated with economic traits such as average daily weight gain. Public databases have accumulated a large amount of research data on genome-wide association studies and gene expression regulation of livestock and poultry traits, providing data support for elucidating the molecular mechanisms of target traits. Previous studies have used GWAS to identify a significant association between GWAS and reaching 115 kg in Large White pigs. ZFPM2 Functional genes, research has found FAM135B Genetic variations are significantly genetically associated with an individual's average daily weight gain, providing an important theoretical basis for the development and application of key molecular markers for growth traits.

[0005] In practical breeding applications, determining the average daily weight gain phenotype is challenging. Average daily weight gain requires continuous weighing and recording throughout the entire weaning-to-market cycle, resulting in long data collection periods, high equipment costs, and demanding skilled operators, making it difficult to implement in actual production. Therefore, relying solely on phenotypic data for selection suffers from significant problems such as low selection accuracy, long generation intervals, and slow genetic progress. Marker-assisted selection technologies developed based on these molecular markers can accurately assess an individual's genetic potential early in its growth, effectively overcoming the shortcomings of traditional phenotypic selection, which is characterized by long cycles and low efficiency. This enables synergistic optimization of growth rate and carcass quality, significantly improving breeding efficiency and economic benefits. Summary of the Invention

[0006] The purpose of this invention is to provide an application of SNP haplotype molecular markers related to the average daily weight gain of Large White pigs, thereby solving the problems existing in the prior art.

[0007] The technical solution adopted in this invention is: This invention provides an application of SNP haplotype molecular markers related to the average daily weight gain of Large White pigs. The SNP haplotype molecular markers include 12 sites, SNP1 to SNP12. The nucleotide sequences containing SNP1 to SNP12 are shown in SEQ ID NO.1 to SEQ ID NO.12, respectively. SNP1 is located at 101 bp of SEQ ID NO.1, and its nucleotide is A or T; SNP2 is located at 101 bp of SEQ ID NO.2, and its nucleotide is T or C; SNP3 is located at position 101 of SEQ ID NO.3, and its nucleotide is G or A; SNP4 is located at 101 bp of SEQ ID NO.4, and its nucleotide is C or T; SNP5 is located at position 101 of SEQ ID NO.5, and its nucleotide is C or A; SNP6 is located at 101 bp of SEQ ID NO.6, and its nucleotide is C or T; SNP7 is located at 101 bp of SEQ ID NO.7, and its nucleotide is C or T; SNP8 is located at 101 bp of SEQ ID NO.8, and its nucleotide is A or T; SNP9 is located at 101 bp of SEQ ID NO.9, and its nucleotide is C or T; SNP10 is located at 101 bp of SEQ ID NO.10, and its nucleotide is A or G; SNP11 is located at 101 bp of SEQ ID NO.11, and its nucleotide is A or G; SNP12 is located at 101 bp of SEQ ID NO.12, and its nucleotide is T or C; When the combinations of SNP1 to SNP12 are TTGCCCCACAGT, the average daily weight gain of Large White pigs is higher than that of the combination TCATATTTTGGC. The application refers to any one of the following (1) and (2): (1) Determine the average daily weight gain of Large White pigs; (2) Increase the average daily weight gain of Large White pig offspring.

[0008] Preferably, the method for determining the average daily weight gain of Large White pigs is as follows: Genomic DNA was extracted from the Large White pigs to be tested and sequenced. Determine the nucleotides at SNP1~SNP12 sites in this Large White pig; When the combination of SNP1 to SNP12 is TTGCCCCACAGT, the Large White pig has a high average daily weight gain, which means an average daily weight gain of more than 0.84 kg / d.

[0009] Preferably, the method for improving feed utilization in Large White pig offspring is as follows: Genomic DNA was extracted from the Large White pigs to be tested and sequenced. Determine the nucleotides at SNP1~SNP12 sites in this Large White pig; If the nucleotide sequences of SNP1 to SNP12 are TTGCCCCACAGT, then selecting Large White pigs carrying this SNP haplotype molecular marker as parents for breeding can improve the average daily weight gain of Large White pig offspring.

[0010] Preferably, the genomic DNA is derived from any one of the ear tissue, hair follicles, and blood of Large White pigs.

[0011] Preferably, the average daily weight gain refers to: The ratio of the total weight gain of Large White pigs during the fattening period to the total number of feeding days.

[0012] Compared with the prior art, the beneficial effects of the present invention are: This invention provides an application of SNP haplotype molecular markers related to the average daily weight gain of Large White pigs. The SNP haplotype molecular markers include 12 sites, SNP1 to SNP12. The nucleotide sequences containing SNP1 to SNP12 are shown in SEQ ID NO.1 to SEQ ID NO.12. When the combination of SNP1 to SNP12 is TTGCCCCACAGT, the average daily weight gain of Large White pigs is higher than that of the combination TCATATTTTGGC. The application refers to any one of the following (1) and (2): (1) identifying the average daily weight gain of Large White pigs; (2) improving the average daily weight gain of Large White pig offspring.

[0013] This invention provides 12 SNP loci that significantly affect the average daily weight gain of Large White pigs, forming an LDblock haplotype module, and detects two haplotype molecular markers affecting the average daily weight gain trait in Large White pigs. Specifically, haplotypes H001 (TTGCCCCACAGT) and H002 (TCATATTTTGGC) were identified at SNP loci on chromosome 8, located between loci 41794916 and 41801724, spanning 6.809 kb. Individuals containing haplotype H001 have high average daily weight gain, while individuals containing haplotype H002 have low average daily weight gain. The variance of the average daily weight gain phenotype explained by this haplotype is 3.45%. In actual breeding processes, retaining individuals with haplotype H001 is beneficial for screening individuals with high average daily weight gain for breeding, improving the accuracy of early selection for the average daily weight gain trait in Large White pigs, and has good economic benefits and broad application prospects. Attached Figure Description

[0014] Figure 1 The results of agarose gel electrophoresis analysis of genomic DNA extracted from ear tissue of large white pigs are shown. Lanes 1 to 23 represent 23 different samples.

[0015] Figure 2 Linkage disequilibrium analysis for Large White pig populations.

[0016] Figure 3 GWAS analysis of the average daily weight gain trait in Large White pigs. A: Manhattan plot; B: QQ plot.

[0017] Figure 4 Haplotype analysis of SNPs on chromosome 8 of Large White pigs that are associated with the trait of average daily weight gain. A: LDblock obtained based on GWAS signal and linkage disequilibrium analysis; B: Correlation analysis of haplotypes H001 and H002 with the trait of average daily weight gain. Detailed Implementation

[0018] The present invention will be further illustrated below with specific embodiments, but these embodiments do not limit the scope of the invention. Modifications or substitutions to the details and form of the technical solutions of the present invention may be made without departing from the spirit and scope of the invention, but all such modifications or substitutions fall within the protection scope of the present invention.

[0019] The inventive concept of this invention is as follows: In the identification of genetic markers for average daily weight gain, the number of genetic markers for Large White pigs remains insufficient, traditional microarray screening strategies struggle to capture all key variations, and genetic markers exhibit strong breed and population specificity, particularly in domestically bred populations where their discovery is inadequate. This invention provides a genetic marker for the average daily weight gain trait in a domestic Large White pig population and its application. Specifically, this invention aims to supplement or solve the following problems:

[0020] 1. How to improve the accuracy of identifying genetic markers for pig feed utilization efficiency traits by using a genome sequencing full-coverage strategy to fill in SNPs across the entire genome and then performing GWAS analysis.

[0021] 2. How to perform haplotype analysis on multiple identified SNP markers, solve the problem of low effect of a single SNP marker, and screen and identify haplotypes of traits related to average daily weight gain.

[0022] This invention provides 12 SNP loci that significantly affect the average daily weight gain trait of Large White pigs, forming an LDblock module. Two SNP haplotype molecular markers affecting the average daily weight gain of Large White pigs were detected on chromosome 8 of the pig genome (Sus_scrofa.11.1), as described below: (1) The rs331572019 locus is located at the base position 41794916 on chromosome 8 of the pig genome (Sus_scrofa.11.1). The base of the reference genome at this locus is A. The variation here is A to T. Among them, the average daily weight gain of AA genotype > the average daily weight gain of AT genotype > the average daily weight gain of TT genotype.

[0023] (2) The rs322865251 locus is located at the base of chromosome 8, position 41795033 in the pig genome (Sus_scrofa.11.1). The base of the reference genome at this locus is T. The variation here is a T mutation to C. The average daily weight gain of the TT genotype is greater than that of the TC genotype, which is greater than that of the CC genotype.

[0024] (3) The chr8_41795425 locus is located at the base position 41795425 on chromosome 8 of the pig genome (Sus_scrofa.11.1). The base of the reference genome at this locus is G. The variation here is G mutated to A. Among them, the average daily weight gain of the GG genotype is greater than that of the GA genotype, which is greater than that of the AA genotype.

[0025] (4) The rs343552563 locus is located at the base position 41795456 on chromosome 8 of the pig genome (Sus_scrofa.11.1). The base of the reference genome at this locus is C. The variation here is C to T. The average daily weight gain of CC genotype is > average daily weight gain of CT genotype is > average daily weight gain of TT genotype.

[0026] (5) The rs327336273 locus is located at the base of chromosome 8, position 41795520 in the pig genome (Sus_scrofa.11.1). The base of the reference genome at this locus is C. The variation here is C mutated to A. The average daily weight gain of CC genotype is greater than that of CA genotype, which is greater than that of AA genotype.

[0027] (6) The rs337482363 locus is located at the base of chromosome 8, position 41795875 in the pig genome (Sus_scrofa.11.1). The base of the reference genome at this locus is C. The variation here is C to T. The average daily weight gain of the CC genotype is greater than that of the CT genotype, which is greater than that of the TT genotype.

[0028] (7) The rs319466350 locus is located at the base of chromosome 8, 41795893 in the pig genome (Sus_scrofa.11.1). The base of the reference genome at this locus is C. The variation here is C to T. The average daily weight gain of CC genotype is greater than that of CT genotype and TT genotype.

[0029] (8) The rs333397212 locus is located at the base of chromosome 8, 41796533 in the pig genome (Sus_scrofa.11.1). The base of the reference genome at this locus is AA. The variation here is A to T. The average daily weight gain of the AA genotype is greater than that of the AT genotype, which is greater than that of the TT genotype.

[0030] (9) The rs328239654 locus is located at the base of chromosome 8, position 41796797 in the pig genome (Sus_scrofa.11.1). The base of the reference genome at this locus is C. The variation here is C to T. The average daily weight gain of the CC genotype is greater than that of the CT genotype, which is greater than that of the TT genotype.

[0031] (10) The rs337564520 locus is located at the base of chromosome 8, 41796901 in the pig genome (Sus_scrofa.11.1). The base of the reference genome at this locus is A. The variation here is A mutated to G. Among them, the average daily weight gain of AA genotype > the average daily weight gain of AG genotype > the average daily weight gain of GG genotype.

[0032] (11) The rs323689742 locus is located at the base position 41797852 on chromosome 8 of the pig genome (Sus_scrofa.11.1). The base of the reference genome at this locus is A. The variation here is A mutated to G. Among them, the average daily weight gain of AA genotype is > the average daily weight gain of AG genotype is > the average daily weight gain of GG genotype.

[0033] (12) The rs319067320 locus is located at the base of chromosome 8, position 41801724 in the pig genome (Sus_scrofa.11.1). The base of the reference genome at this locus is T. The variation here is a T mutation to C. The average daily weight gain of the TT genotype is greater than that of the TC genotype, which is greater than that of the CC genotype.

[0034] The haplotypes H001 (TTGCCCCACAGT) and H002 (TCATATTTTGGC) formed by SNP sites on chromosome 8 are located between sites 41794916 and 41801724, spanning 6.809 kb. The average daily weight gain of haplotype H001 is greater than that of haplotype H002.

[0035] In actual breeding processes, retaining individuals with the H001 haplotype is beneficial for selecting pig breeds with high average daily weight gain, improving the accuracy of early selection for the average daily weight gain trait, and has good economic benefits and broad application prospects.

[0036] To enable those skilled in the art to better understand and implement the technical solutions of this invention, the invention will be further described below with reference to specific embodiments. In the description of this invention, unless otherwise specified, all reagents used are commercially available, and all methods used are conventional techniques in the art.

[0037] The average daily weight gain mentioned in this invention refers to the ratio of the total weight gain of Large White pigs during the fattening period to the total number of feeding days, and the calculation formula is as follows: .

[0038] In the formula, the unit of average daily weight gain is kg / d, the unit of final weight and starting weight is kg, and the unit of measurement days is d.

[0039] Example 1: Application of SNP haplotype molecular markers related to the average daily weight gain of Large White pigs, as detailed below: 1. Method.

[0040] 1.1 Sample collection and genomic DNA preparation.

[0041] Phenotypic data collection and cleaning were performed on feed utilization efficiency traits of the Large White pig population, and DNA was extracted from the collected ear tissue.

[0042] 1.1.1 Phenotypic data collection.

[0043] The Bos Intelligent Measurement Station is used to measure the breeding pigs in the pig farm. When the pigs enter the measurement equipment, the equipment door closes automatically, the equipment recognizes the pig's electronic ear tag, and then opens the feed trough door. The measurement equipment will automatically record the weight of feed (g), feeding time (s), and remaining feed weight (g) of each pig's feeding each time. The feeding records of the pigs are statistically analyzed every day, and all data is automatically uploaded to the cloud system corresponding to the measurement equipment and stored.

[0044] 1.1.2. Phenotypic data cleaning.

[0045] Quality control was conducted based on factors such as feed intake (18g), feeding duration (60s), feeding rate (18g / min~66g / min), body weight (median corrected for daily weight), and number of feedings per day (2 times / day~15 times / day).

[0046] 1.1.3 DNA extraction.

[0047] Genomic DNA was extracted from porcine ear tissue using a fully automated nucleotide extractor (Bayer) and its accompanying kit. The extracted DNA was then examined using 2% agarose gel electrophoresis to detect degradation, and DNA concentration was determined using a NanoDrop 2000 ultra-micro spectrophotometer. Samples that passed the above DNA quality tests were then used for library construction and sequencing.

[0048] 1.2 Sequencing of pig genomic DNA samples.

[0049] Samples that passed quality control were sent to Wuhan Shadow Gene Technology Co., Ltd. for 2× low-depth resequencing (BGI T7 genome sequencing platform). Raw sequencing data were quality controlled using fastp (v0.23.4), with the main quality control parameter being "-q 20".

[0050] 1.3 SNP typing and filling.

[0051] The quality-controlled FASTQ files were aligned to the pig reference genome (Sus_scrofa.Sscrofa.11.1) using BWA (v0.7.17) software. Then, samtools (v1.22.1) was used to sort, deduplicate, remove redundancy, and index the obtained BAM files, resulting in pre-processed BAM files. Genetic variations were detected and genotyped using GATK 4.5's Haplotype Caller, Genotype GVCFs, and CombineGVCFs tools. The Haplotype Caller tool was used to detect variations and generate GVCF files for each sample. These GVCF files record variation information for all loci, preparing for joint genotyping. The GVCF files from all samples were merged using GLnexus software, and joint genotyping was performed to obtain VCF files containing the original SNP variation information. The SelectVariants tool was used to extract SNP variation sites from the original VCF files, and Variant was used to further refine the data. The Filtration tool was used to strictly filter SNPs, with the following filtering parameters: "QUAL < 30.0 || QD < 2.0 || FS > 60.0 || SOR > 3.0 || MQRankSum < -12.5 || ReadPosRankSum < -8.0". Population SNP filtering was performed using PLINK (v1.9) software. The filtering conditions were as follows: SNP detection rate of over 90%; minimum allele frequency (MAF) threshold set to 0.01. Then, genotyping was performed using Beagle 5.5 software combined with high-depth (>10×) Large White pig population genome data downloaded from the NCBI database. The filled data retained R... 2 Sites with a value ≥0.6 were then filtered using the same criteria in PLINK, and the resulting high-quality SNP sites were used for subsequent analysis.

[0052] 1.4 Chaining Disequilibrium (LD) Analysis.

[0053] PopLDdecay software was used to evaluate the degree of genome-wide linkage disequilibrium (LD) in a population, aiming to assess the efficiency and accuracy of association analysis.

[0054] 1.5 Genome-wide association analysis (GWAS).

[0055] GEMMA was used to perform genome-wide association analysis (GWAS) on feed utilization efficiency traits, with batch number, age at measurement, and weight gain during the measurement period as covariates. Boferroni correction was used to adjust the p-values ​​of the GWAS analysis. Because Boferroni correction is very strict, the effective number N of independent tests was calculated using the R package simpleM (https: / / github.com / LTibbs / SimpleM), with a threshold of 1 / N for the GWAS signal. The significance of each SNP was assessed using a likelihood ratio test. The genomic inflation factor (λ) for the test statistics was calculated using R (v4.3) software as the ratio between the median of the observed p-value distribution and the theoretical median. It was ensured that there was no significant stratification in the population, and that the results were not false positives due to population structure. The mixed linear model is as follows:

[0056] .

[0057] In the above model, y Indicates phenotypic value; W It is an n x (w + 1) matrix that includes the intercept and covariates; Then it is a vector of (w + 1) × 1, representing the effect size of the covariate; Gs It is an n × 1 vector representing the genotype of a certain locus. The value of each item is usually 0, 1, or 2 (the copy number of the allele). γ This is a scalar, representing the effect size of the genotype at the target locus; g This is due to the accumulation effect; ε This is the residual.

[0058] 1.6. Haplotype construction.

[0059] Linkage disequilibrium association analysis was used to identify haplotypes associated with specific phenotypic traits. Data from genome-wide significant loci obtained through GWAS were statistically analyzed and used to construct a linkage disequilibrium module. LDBlockShow was used for linkage disequilibrium module analysis and result visualization. The plink software package was used for haplotype inference and sample genotyping, and R software was used for result visualization analysis.

[0060] 2. Results.

[0061] 2.1 Phenotypic data collection and ear tissue sample DNA preparation.

[0062] 234,377 feeding records (weight range 25kg~115kg during the fattening period) of 673 Large White pigs were collected using the Boss Intelligent Feeding Station. Quality control was performed based on feed intake (18g), feeding duration (60s), feeding rate (18g / min~66g / min), weight (median corrected for daily weight), and number of feedings per day (2 times / day~15 times / day). After cleaning, 138,908 data points were obtained, and the sample size of 360 pigs met the criteria. The final average daily gain (ADG) ranged from 0.44kg / d to 1.18kg / d, as shown in Table 1.

[0063] Table 1. Descriptive statistics of average daily weight gain of 360 Large White pigs Genomic DNA was extracted from porcine ear tissue using a fully automated nucleotide extractor (Zhongke Bayer) and its accompanying reagent kit. Because low-quality DNA can affect sequencing results, 2% agarose gel electrophoresis was used to detect DNA degradation. The electrophoresis results are shown below. Figure 1 The DNA sample bands were clear and undegraded. Detection using an ultra-micro spectrophotometer showed that the lowest concentration of DNA in the extracted ear tissue samples was 108.75 ng / μL, the highest was 1559.51 ng / μL, and the average was 526.84 ng / μL. OD 260 / 280 The minimum value was 1.65, the maximum value was 2.11, and the average value was 1.83. These test results indicate that the DNA extracted from the ear tissue of the Large White pig population is of good quality and meets the requirements for library construction and sequencing.

[0064] 2.2 Sample sequencing.

[0065] 360 qualified samples were sent to Wuhan Shadow Gene Technology Co., Ltd. for 2× low-depth resequencing (BGI T7 genome sequencing platform). The raw sequencing data were quality controlled using fastp (v0.23.4), with the main quality control parameter being "-q 20".

[0066] 2.3 SNP typing.

[0067] Following the method described in section 1.3 above, a total of 2,274,704 high-quality SNP sites were obtained for subsequent analysis.

[0068] 2.4 Chaining Imbalance Analysis.

[0069] PopLDdecay software was used to evaluate the degree of genome-wide linkage disequilibrium (LD) in a population, aiming to assess the efficiency and accuracy of association analysis.

[0070] 2.5 Genome-wide association analysis.

[0071] This invention uses batch size, age at measurement, and weight gain during the measurement period as covariates. Boferroni correction was used. The effective number of independent tests was calculated using the R package simpleM, resulting in 182,343. Based on this, the genome-wide significance threshold was determined to be 5.48417e-06 (1 / 182,343). The genome expansion factor in the test statistics was calculated using R software as the ratio between the observed p-value distribution and the theoretical median; the genome expansion factor is denoted as λ. The calculated λ value for the average daily weight gain trait in this population is 0.98, indicating that the population does not exhibit significant stratification and that no false positives were generated due to population structure.

[0072] 2.6. Haplotype construction.

[0073] Linkage disequilibrium association analysis was used to identify SNP haplotypes associated with specific phenotypic traits. Data from genome-wide significant loci obtained through GWAS were statistically analyzed and used to construct LDblock (linkage disequilibrium module). LDBlockShow was used for linkage disequilibrium module analysis and the results were visualized. The plink software package was used for haplotype inference and sample genotyping, and R software was used for result visualization analysis.

[0074] 2.7 Chaining Imbalance Analysis.

[0075] Depend on Figure 2 It can be seen that in linkage disequilibrium (LD) analysis, as the marker distance between paired SNPs increases, r... 2 The value tends to decrease, and r is observed in the first 100Kb range. 2 The value shows a rapid downward trend. In the study population, the linkage disequilibrium was at approximately 70 kb when r... 2 The value decayed to 0.2.

[0076] 2.8 GWAS signal identification.

[0077] GWAS analysis results are as follows Figure 3 This indicates that 12 significant SNP signals are focused on chromosome 8 of Large White pigs, and the QQ plot further confirms the reliability of the analysis results. Detailed information on the 12 loci is shown in Table 2.

[0078] Table 2. Average daily weight gain signal peak locations in the Large White pig population. Note: "-" in Table 2 indicates that this item is not available.

[0079] The nucleotide sequences containing the 12 SNP sites in Table 2 are shown in SEQ ID NO.1 to SEQ ID NO.12, with the 101 bp (in bold) in SEQ ID NO.1 to SEQ ID NO.12 being the mutation site.

[0080] SEQ ID NO.1: CAGAATGAGGGAAATAACCTGGGTCTCTGGTGGCATCGAAGAGCAAGGGAAGCCGGCTCCACCTCTAGCCTTGTTGTTATGTGAACTAACACATTTTCTCATTGTTTAAATCAGTATTTAACTTTCACAGTGTATCAGAATTTCAGGTTATTCCAAAGTCAAGGCAGGGTCTTTCAGGAGCAAGCCCATTTGAGTCAGGGT.

[0081] SEQ ID NO.2: TTAACTTTCACAGTGTATCAGAATTTCAGGTTATTCCAAAGTCAAGGCAGGGTCTTTCAGGAGCAAGCCCATTTGAGTCAGGGTTTTCTGTTCATTACACTTAAAGCATTTTGACATATAAAGACACATTCACATATCTCTCCATCACTGTTCTCCATAAATCTTCATGCAGGGATTTTTGCTTTGGGTTTTTTCCAAACA.

[0082] SEQ ID NO.3: TGTGAAGAGCAGTTTTAATGTAGCAGTTACTATATTTTAGTAAATGTTGAGTTTAGGTATGACCCTCAAGTTAATACAACATTAGAATATCTTGTTGTTTGGCTGGTGCATGATGGGAGGTCACTAGTGCACTAGGATCTTCATACATTCCATTTTTATAAATTTCCAACAAGCTTCAAAAAGCTTTTTTCATTGCAAGTA.

[0083] SEQ ID NO.4: ATATTTTAGTAAATGTTGAGTTTAGGTATGACCCTCAAGTTAATACAACATTAGAATATCTTGTTGTTTGGCTGGTGCATGATGGGAGGTCACTAGTGCACTAGGATCTTCATACATTCCATTTTTATAAATTTCCAACAAGCTTCAAAAAGCTTTTTTCATTGCAAGTATACTCATAAAATCACTCATAGCAAGGAAGCT。

[0084] SEQ ID NO.5: TGTTTGGCTGGTGCATGATGGGAGGTCACTAGTGCACTAGGATCTTCATACATTCCATTTTTATAAATTTCCAACAAGCTTCAAAAAGCTTTTTTCATTGCAAGTATACTCATAAAATCACTCATAGCAAGGAAGCTCTAATAAATAGATAGGACCTGCTTAAAAGAGTTCAGTAAGTTCTTGGGAATTAAATCTTCCGGT。

[0085] SEQ ID NO.6: TTGACATGGATAATTATTAGGAAATACAGATCAAAACTACAAAGAGGTATCACCTCACACTGGTGAGAATGACCATCATGAAAAAATCTATAGGAGTTCCCGTCATGGCACAGAGGAACGAATCTGACTAGGAACCATGAGGTTGCGGGTTCTATCCCTGGCCTCTCAGTGGGTTAAGGATTCCATGTTGCCGTGAGCTGT。

[0086] SEQ ID NO.7: AGGAAATACAGATCAAAACTACAAAGAGGTATCACCTCACACTGGTGAGAATGACCATCATGAAAAAATCTATAGGAGGTTCCCGTCATGGCACAGAGGAACGAATCTGACTAGGAACCATGAGGTTGCGGGTTCTATCCCTGGCCTCTCAGTGGGTTAAGGATTCCATGTTGCCGTGAGCTGTGGTGTAGGTCGAAGACTC。

[0087] SEQ ID NO.8: AATGGCAAAAGACAAAAAAAAAAAAAAAGCTAAAAAACTAAACATACAACATCCTATCAATCCCACTCCTGAGCATCTATCCAGAGAAAAGCATAATTCAAATACAAATGCAAACACTATTATTCATAGCAGCACTATGAAGACCTGGAAGCAACCTAAACTCCCAGTGACAGATGAACAGATAAAGAAAATGTATATAG。

[0088] SEQ ID NO.9: TAAACCTAGAGATTACCATTCTACGTGAAGTAAGTCAGACAGAGAAAGAGAACCACCATATGATATCACTTATATATGGAATCTAAAAATATGACACAAACGAACTTATTTATGAAATGGAAACAGACTCACATAGTAAACAAATTTATGTTCATCAAAGGGAAAAGGAGGTGGCGAGGGATAAAGTTGAAGTTTGGGATT。

[0089] SEQ ID NO.10: CTTATTTATGAAATGGAAACAGACTCACATAGTAAACAAATTTATGTTCATCAAAGGGAAAAGGAGGTGGCGAGGGATAAAGTTGAAGTTTGGGATTAGTAGATACAAACTACTGCATATAAAATAGATAAACAACAGATCCTACTGTATAGCACAGAGAATATGCAAAATCTTGTAATAAACCATAATGAAAAAATGTAG。

[0090] SEQ ID NO.11: CTGGCCACAAGCCATAAATTTCTCACCATCCTAGGTCTAGCACGCAAACTCCATCATCTGATGCGCTAAATGCTCAAGGTTTAGTGCAGTCTCCCTGTACAGACTCTGCACTTTACATACAGTGCAGGGTTGAGGAAGCCTGTAGACTAAGAACCTAGCAGGCTATGGAGGTCGGTAGTAGGCAGAGACTAACTTTTAAT。

[0091] SEQ ID NO.12: TTCCTAACCATTCTTCATGTAAGACCATTCTCATCACCTCCCCTGGGTATGCTGCACCTGTGTCAGGTTGTCTCTTAAGTGTGGTTACAAGAATGGAGTGTCAGGAGTTCCCATCGTGGCTCAGTGGTTAATGAATCTGACTAGGAACCATGAGGTTGTGGAATCGATTCCTGGCCTTGCTCAGTGGGTTAAGGATCCAGC.

[0092] 2.9 Haplotype Identification and Module Analysis.

[0093] Based on the attenuation distance of GWAS signals and chain imbalance analysis, this invention studies the detection of one LDblock ( Figure 4 (A), and identified two haplotypes associated with the average daily weight gain trait ( Figure 4 Haplotypes H001 (TTGCCCCACAGT) and H002 (TCATATTTTGGC) are located between loci 41794916 and 41801724, spanning 6.809 kb. Haplotype H001 (TTGCCCCACAGT) is significantly associated with high average daily weight gain (P < 0.0001). Figure 4 (B). As shown in Table 3, the average daily weight gain of Large White pigs with haplotype H001 was 0.91 kg / d, significantly higher than that of Large White pigs with haplotype H002. This indicates that haplotype H001 can serve as a potential molecular marker and can be used for breeding pig breeds with high average daily weight gain.

[0094] SEQ ID NO.13:TTGCCCCACAGT.

[0095] SEQ ID NO.14:TCATATTTTGGC.

[0096] Table 3. Association analysis between different haplotypes of ADG_block in Large White pigs and the average daily weight gain phenotype. Note: A total of 360 individuals were used for haplotype analysis. Since no analysis results were obtained for some individuals, the effective sample size in Table 3 is 353.

[0097] 2.10 Correlation analysis between SNP loci and average daily weight gain phenotype in pigs.

[0098] Association analysis between genotypes and average daily weight gain at 12 significant loci was performed using R software. The results are shown in Table 4.

[0099] Table 4. Association analysis of genotypes at 12 SNP loci with mean daily weight gain. Table 4 shows that the correlation between the 12 SNP loci and the average daily weight gain of pigs was extremely significant (P<0.0001). The average daily weight gain of the mutant genotypes at each SNP locus was lower than that of the reference genotype. The SNP loci were: rs331572019_A / T, rs322865251_T / C, chr8_41795425_G / A, rs343552563_C / T, rs327336273_C / A, rs337482363_C / T, rs319466350_C / T, rs333397212_A / T, rs328239654_C / T, and rs337564520_. The linkage between loci A / G, rs323689742_A / G, and rs319067320_T / C is relatively high, forming a haplotype block. The average daily weight gain of haplotype H001 (TTGCCCCACAGT) is 0.91±0.00, and the average daily weight gain of haplotype H002 (TCATATTTTGGC) is 0.84±0.01. The average daily weight gain of haplotype H001 is significantly higher than that of haplotype H002.

[0100] Furthermore, the genetic effect of the dominant haplotype of this invention was estimated and analyzed using an additive linear model. The phenotypic data of the dominant haplotype and the average daily gain (ADG) of 360 individuals were analyzed using an additive linear model using R software. The genetic effect of the dominant haplotype was tested, and the phenotypic variance explained by the ADG trait was calculated. The results showed that the dominant haplotype significantly affected the average daily gain (P < 0.001). The specific model is as follows:

[0101] .

[0102] in, Let be the phenotypic value of the i-th individual; μ The group mean; G i For the genotype effect of the i-th individual; e i Let be the random residual effect of the i-th individual.

[0103] The results showed that the additive effect value of the dominant haplotype H001 was 0.0666. Under the additive linear model, the dominant haplotype explained a sum of squares of 0.1069, a residual sum of squares of 2.9914, and a total phenotypic sum of squares of 3.0983. The calculated variance of the mean daily weight gain phenotype explained by this dominant haplotype was 3.45% (0.1069 / 3.0983*100%). In practical breeding, retaining individuals carrying superior haplotypes is beneficial for screening individuals with high mean daily weight gain, improving the accuracy of early selection, and has good economic benefits and broad application prospects.

[0104] Current technologies for screening genetic markers related to the pig's average daily weight gain trait still face numerous challenges and limitations. Average daily weight gain, as a typical quantitative trait, is controlled by a large number of minor genes, each contributing very little to the phenotype. The currently detected candidate markers are insufficient to support precise and efficient molecular breeding practices, making continued and in-depth exploration and validation of relevant genetic markers extremely urgent. Microarray data, due to its sparse marker density relative to the pig genome, easily misses low-frequency variations, structural variations, and important sites located in regions whose functionalities were unknown during microarray design. This leads to insufficient statistical power in association analyses, making it difficult to effectively capture and locate many truly causal genetic variations.

[0105] This invention relates to a method and application for identifying SNP haplotypes related to important growth traits in pigs. Through GWAS screening and haplotype association analysis, a haplotype related to the average daily weight gain trait of Large White pigs that affects local breeding was accurately identified. This can enrich the number of genetic markers (haplotypes) related to growth traits in Large White pigs, laying an important foundation for carrying out domestic local molecular breeding and genome selection of Large White pigs.

[0106] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0107] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. The application of a SNP haplotype molecular marker associated with the average daily weight gain of Large White pigs, characterized in that, The SNP haplotype molecular markers include 12 sites, SNP1 to SNP12; the nucleotide sequences containing SNP1 to SNP12 are shown in SEQ ID NO.1 to SEQ ID NO.12 in sequence; SNP1 is located at 101 bp of SEQ ID NO.1, and its nucleotide is A or T; SNP2 is located at 101 bp of SEQ ID NO.2, and its nucleotide is T or C; SNP3 is located at position 101 of SEQ ID NO.3, and its nucleotide is G or A; SNP4 is located at 101 bp of SEQ ID NO.4, and its nucleotide is C or T; SNP5 is located at position 101 of SEQ ID NO.5, and its nucleotide is C or A; SNP6 is located at 101 bp of SEQ ID NO.6, and its nucleotide is C or T; SNP7 is located at 101 bp of SEQ ID NO.7, and its nucleotide is C or T; SNP8 is located at 101 bp of SEQ ID NO.8, and its nucleotide is A or T; SNP9 is located at 101 bp of SEQ ID NO.9, and its nucleotide is C or T; SNP10 is located at 101 bp of SEQ ID NO.10, and its nucleotide is A or G; SNP11 is located at 101 bp of SEQ ID NO.11, and its nucleotide is A or G; SNP12 is located at 101 bp of SEQ ID NO.12, and its nucleotide is T or C; When the combinations of SNP1 to SNP12 are TTGCCCCACAGT, the average daily weight gain of Large White pigs is higher than that of the combination TCATATTTTGGC. The application refers to any one of the following (1) and (2): (1) Determine the average daily weight gain of Large White pigs; (2) Increase the average daily weight gain of Large White pig offspring.

2. The application as described in claim 1 (Large White Pig), characterized in that, The method for determining the average daily weight gain of Large White pigs is as follows: Genomic DNA was extracted from the Large White pigs to be tested and sequenced. Determine the nucleotides at SNP1~SNP12 sites in this Large White pig; When the combination of SNP1 to SNP12 is TTGCCCCACAGT, the Large White pig has a high average daily weight gain, which means an average daily weight gain of more than 0.84 kg / d.

3. The application as described in claim 1, characterized in that, The methods to improve feed utilization in Large White pig offspring are as follows: Genomic DNA was extracted from the Large White pigs to be tested and sequenced. Determine the nucleotides at SNP1~SNP12 sites in this Large White pig; If the nucleotide sequences of SNP1 to SNP12 are TTGCCCCACAGT, then selecting Large White pigs carrying this SNP haplotype molecular marker as parents for breeding can improve the average daily weight gain of Large White pig offspring.

4. The application as described in claim 2 or claim 3, characterized in that, The genomic DNA was derived from any one of the ear tissue, hair follicles, or blood of the Large White pig.

5. The application as described in claim 1, characterized in that, The average daily weight gain refers to: The ratio of the total weight gain of Large White pigs during the fattening period to the total number of feeding days.