SSR marker primers linked to the pollen fertility restorability trait of allium fistulosum and application thereof
By developing SSR marker primers linked to fertility restoration traits in scallion pollen, and combining them with the improved CTAB method and the highly specific SSR marker primer AF45, efficient and accurate detection of fertility restoration traits in scallion pollen was achieved. This filled the gap in the application of cell nucleus-related sterility genes and restoration genes in scallion breeding, and improved breeding efficiency.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- ZHEJIANG MITSUO SEED CO LTD
- Filing Date
- 2026-04-08
- Publication Date
- 2026-06-02
AI Technical Summary
The molecular mechanisms of fertility restoration traits in scallion pollen are unclear in existing technologies, and there is a lack of effective markers for nuclear-related sterility genes and restoration genes, resulting in low breeding efficiency for scallions.
SSR marker primers linked to the fertility restoration trait in scallion pollen were developed. The molecular weight of the amplified products was detected by PCR amplification and agarose gel electrophoresis. DNA was extracted using a modified CTAB method, and the highly specific SSR marker primer AF45 was designed for detection using dithiothreitol as a reducing agent.
This study enables efficient and accurate detection of fertility restoration traits in scallion pollen, filling the application gap in nuclear-related sterility and restoration genes, and improving the efficiency of scallion breeding and the molecular mechanism of fertility switching.
Smart Images

Figure CN122128456A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to an SSR marker primer linked to the fertility restorer trait of scallion pollen and its application. Background Technology
[0002] scallions ( Allium fistulosum L. var. gigantum Makino is a plant belonging to the genus Allium in the family Liliaceae. It is an indispensable spice and seasoning in the daily lives of Chinese people and is a vegetable crop with a long history of cultivation in my country.
[0003] Cytoplasmic male sterility is widespread in higher plants, and cytoplasmic male sterile plants have also been found in natural populations of scallions, providing a basis for hybridization breeding of scallions. However, previous researchers, through population genetic analysis of scallions, have shown that male sterility in scallions is controlled by the interaction between the cytoplasm and the nucleus, with hypotheses of "interaction between the cytoplasm and two pairs of recessive nuclear genes" and "the quantitative effect of the cytoplasm on multiple pairs of nuclear genes." In actual field research, micropollen conditions are common in scallion breeding materials, and pollen status is easily affected by the environment, indicating that the molecular mechanisms controlling male sterility in scallions are complex.
[0004] Currently, only a few studies have reported linkage molecular markers and applications of cytoplasmic mitochondrial and chloroplast-related sterility genes, while reports and applications of nuclear-related sterility and fertility restoration genes are scarce or nonexistent. Furthermore, the molecular mechanisms of male sterility and fertility restoration in scallions are unclear. Therefore, the development of linkage markers for fertility restoration-related genes in scallion pollen is of significant practical importance for improving scallion breeding efficiency, variety development, and understanding the molecular mechanisms of fertility switching.
[0005] In view of this, the present invention is hereby proposed. Summary of the Invention
[0006] The first objective of this invention is to provide an SSR marker primer linked to the fertility restorer trait of scallion pollen for the detection of the fertility restorer trait of scallion pollen.
[0007] The second objective of this invention is to provide the application of the above-mentioned SSR marker primers in the detection of fertility restoration traits in scallion pollen.
[0008] The third objective of this invention is to provide a method for detecting the fertility restoration trait of scallion pollen.
[0009] The fourth objective of this invention is to provide the application of the above-mentioned detection method in scallion breeding.
[0010] To achieve the above objectives, the following technical solution is adopted: In a first aspect, the present invention provides an SSR marker primer linked to the fertility restorer trait of scallion pollen, the nucleotide sequence of which is shown in SEQ ID NO.1 and SEQ ID NO.2.
[0011] Secondly, this invention provides the application of the above-mentioned SSR marker primers in the detection of fertility restoration traits in scallion pollen.
[0012] Thirdly, the present invention provides a method for detecting the fertility restorer trait of scallion pollen, comprising the following steps: DNA was extracted from scallions, and then PCR amplification was performed using the SSR marker primers to obtain amplification products. The fertility restoration trait of scallion pollen was determined based on the molecular weight of the amplification products.
[0013] As a further technical solution, if the molecular weight of the amplified product is 143 bp, then the scallion contains starch. If the molecular weight of the amplified products is 143 bp and 167 bp, then the scallion is powder-free.
[0014] As a further technical solution, the nucleotide sequence of the amplification product with a molecular weight of 143 bp is shown in SEQ ID NO.3.
[0015] As a further technical solution, the nucleotide sequence of the amplification product with a molecular weight of 167 bp is shown in SEQ ID NO.4.
[0016] As a further technical solution, DNA from scallions is extracted using the CTAB method; in the CTAB method, dithiothreitol is used as a reducing agent.
[0017] As a further technical solution, the method for detecting the molecular weight of the amplified products includes agarose gel electrophoresis.
[0018] As a further technical solution, the PCR reaction procedure includes: 95℃ pre-denaturation for 4 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 30-40 cycles; 72℃ extension for 10 min.
[0019] Fourthly, this invention provides the application of the above-mentioned detection method in scallion breeding.
[0020] Compared with the prior art, the present invention has the following beneficial effects: 1. This invention fills the gap in the reporting and application of nuclear-related sterility genes and fertility restoration genes by developing linkage markers for genes related to fertility restoration in scallion pollen.
[0021] 2. This invention screens for polymorphic markers in two extreme pollen pools. The polymorphic markers obtained are distributed on chromosome 2, indicating that the genes related to the fertility restoration trait of scallion pollen are located on chromosome 2, providing reference data for subsequent breeding researchers.
[0022] 3. The SSR molecular marker sites of this invention are closely linked to the fertility restoration trait of scallion pollen, with high detection matching degree and are co-dominant markers, providing a reliable molecular basis for the efficient identification of the fertility restoration trait of scallion pollen.
[0023] 4. The DNA extraction method of the present invention is a modified CTAB method. Scallions are plants containing polysaccharides and polyphenols. In order to avoid using the dangerous and toxic solvent β-mercaptoethanol with a strong pungent odor, it is replaced with dithiothreitol, a reducing agent with a much lower odor and toxicity and similar function to β-mercaptoethanol, to protect the personal safety of the experimenters. Attached Figure Description
[0024] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0025] Figure 1 Comparison of pollen-free (left) and pollen-rich (right) scallion flower heads; Figure 2 Comparison of acetic carmine staining of cells with extremely low and high pollen counts in scallion flower heads; Figure 3 Electrophoresis results of 8 pairs of polymorphic marker primers between the extreme powder-free pool and the extreme powder-rich pool of 24ON312 material (in the electrophoresis results of each primer pair, the left lane is the extreme powder-free pool and the right lane is the extreme powder-rich pool). Figure 4 Analysis of the results of primers for 8 pairs of polymorphic markers and the construction of genetic maps of pollen traits in 146 accessions of population 24ON312; Figure 5 Molecular banding diagram of 146 accessions from population 24ON312 amplified by AF45 primers; Figure 6 Molecular banding diagram of 123 accessions from population 24ON314 amplified by AF45 primers. Detailed Implementation
[0026] The embodiments and examples of the present invention will be described in detail below. However, those skilled in the art will understand that the following embodiments and examples are for illustrative purposes only and should not be considered as limiting the scope of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention. Unless otherwise specified, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.
[0027] In a first aspect, the present invention provides an SSR marker primer linked to the fertility restorer trait of scallion pollen, the nucleotide sequence of which is shown in SEQ ID NO.1 and SEQ ID NO.2.
[0028] Upstream primer: TCTGACTCTAAGTGAAGGGCAGT (SEQ ID NO.1).
[0029] Downstream primer: TCCCATTGACGAAGCTAACCTG (SEQ ID NO.2).
[0030] This primer has high specificity and good sensitivity, and can effectively detect the target. Based on the detection results, it can detect the fertility restoration trait of scallion pollen.
[0031] Secondly, this invention provides the application of the above-mentioned SSR marker primers in the detection of fertility restoration traits in scallion pollen.
[0032] The SSR marker primers provided by this invention can be used to amplify genomic DNA from scallions, and the fertility restoration trait of scallion pollen can be detected based on the fragment size of the amplified product.
[0033] Thirdly, the present invention provides a method for detecting the fertility restorer trait of scallion pollen, comprising the following steps: DNA was extracted from scallions, and then PCR amplification was performed using the SSR marker primers to obtain amplification products. The fertility restoration trait of scallion pollen was determined based on the molecular weight of the amplification products.
[0034] If the molecular weight of the amplified product is 143 bp, then the scallion contains starch. If the molecular weight of the amplified products is 143 bp and 167 bp, then the scallion is powder-free.
[0035] This detection method is simple, convenient, and highly accurate.
[0036] In some alternative embodiments, the nucleotide sequence of the amplification product with a molecular weight of 143 bp is shown in SEQ ID NO. 3.
[0037] TCCCATTGACGAAGCTAACCTGAATAAATAATATGACAGCGTTATTATTTAAAGGGAGTAAAAGTAGTTTGAAGTTTTCTATTGGAAGAGAGAGAGAGAGAGAAGTACCTGCTGGAACTGCCCTTCACTTAGAGTCAGA (SEQ ID NO. 3).
[0038] In some alternative embodiments, the nucleotide sequence of the amplification product with a molecular weight of 167 bp is shown in SEQ ID NO. 4.
[0039] TCCCATTGACGAAGCTAACCTGAATAAATAATATGACAGCGTTATTATTTAAAGGGAGTAAAAGTAGTTTGAAGTTTTCTATTGGAAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGTACCTGCTGGAACTGCCCTTCACTTAGAGTCAGA (SEQ ID NO. 4).
[0040] In some alternative embodiments, DNA from scallions is extracted using the CTAB method, in which dithiothreitol is used as a reducing agent.
[0041] Scallions are plants containing polysaccharides and polyphenols. To avoid using the dangerous and toxic solvent β-mercaptoethanol, which has a strong pungent odor, it was replaced with dithiothreitol, a reducing agent with a much lower odor and toxicity and similar function to β-mercaptoethanol, thus protecting the safety of the experimenters.
[0042] In some alternative implementations, the molecular weight of the amplified products is determined by agarose gel electrophoresis.
[0043] The molecular weight of the amplified products was determined by agarose gel electrophoresis.
[0044] In some optional embodiments, the PCR reaction system comprises: a total volume of 15 uL, including 7.5 uL of 2×F5taq master mix, 0.75 uL each of upstream and downstream primers (10 umol / L), 0.75 uL of template DNA, and 5.2 uL of ddH2O.
[0045] In some optional implementations, the PCR reaction program includes: 95°C pre-denaturation for 4 min; 94°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 30 s, 30-40 cycles; 72°C extension for 10 min.
[0046] Fourthly, this invention provides the application of the above-mentioned detection method in scallion breeding.
[0047] The detection method provided by this invention can be used to identify the fertility restoration trait of scallion pollen, and thus this detection method can be applied to scallion breeding.
[0048] The present invention will be further illustrated below with specific embodiments. However, it should be understood that these embodiments are merely for the purpose of more detailed illustration and should not be construed as limiting the present invention in any way.
[0049] Example 1 1. Experimental Methods 1.1 Modified CTAB method for extracting genomic DNA, the steps are as follows: 1) Prepare a 2 mL centrifuge tube, add 2 steel balls, 700~800 μL of 2.0×CTAB extraction solution, and 100 uL of 2% DTT reducing agent, and place it in an ice box.
[0050] 2) Take about 0.1 g of the leaf into a 2 mL centrifuge tube and grind it in a high-throughput grinder at 50-55 Hz for 120-150 s. Keep it at 65 ℃ for 30-40 min, inverting and mixing 2-3 times during the process. Remove the centrifuge tube and cool it to room temperature.
[0051] 3) Add an equal volume of chloroform:isoamyl alcohol (24:1) solution, cap the tube, gently invert the centrifuge tube several times, and centrifuge at 12000 rpm for 10 min at room temperature.
[0052] 4) Take the supernatant (about 500 μL), add 2 / 3V pre-cooled isopropanol, mix well, place at -20 ℃ for 30 min, centrifuge at 12,000 rpm for 5 min at room temperature, and discard the supernatant. 5) Wash the precipitate 2-3 times with 70-75% ethanol and air dry it upside down at room temperature.
[0053] 6) Add an appropriate amount (about 100 μl) of ddH2O to dissolve the DNA, and store at -20 ℃ for later use.
[0054] 1.2 Preparation of PCR system The total volume was 15 uL, including 7.5 uL of 2×F5 taq master mix, 0.75 uL each of upstream and downstream primers (10 umol / L), 0.75 uL of template DNA, and 5.2 uL of ddH2O. 1.3 PCR reaction procedure Pre-denaturation at 95 °C for 4 min; denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 30 s, 35 cycles; extension at 72 °C for 10 min; storage at 12 °C.
[0055] 1.4 Running the glue and taking photos PCR amplification products were detected by electrophoresis using a 5% agarose gel at a constant voltage of 120 V for 2.5 h, and photographs were taken using a UV gel imaging system.
[0056] 2. Experiment Content 2.1 In the ZTms F1 cultivar of Zhitai scallions, one single plant with normal pollen was found. This single plant was tested and found to be cytoplasm-sterile, suggesting that its cell nucleus contained material that could restore pollen fertility. This single plant was named ZT, and self-pollinated for three generations to obtain self-pollinated seeds. The ZT pollen plant was used as the male parent and backcrossed with pollenless plants of ZTms F1 to obtain the BC1F1 offspring. In the BC1F1 population, single plants with anther-free sterility were selected for further backcrossing to obtain BC3F1 seeds after three generations of backcrossing.
[0057] 2.2 The test materials were 3rd generation self-crossed and 3rd generation backcrossed leek populations planted in the field in the autumn of 2024. Pollen status was investigated multiple times in April and May of 2025. It was found that there were several types of pollen status, namely no pollen (extremely no pollen, the entire bulb anthers are small and have no pollen), very pollen (the entire bulb anthers are small and have no pollen, except for a few anthers that are normally developed but have very little pollen and are white), pollen (most of the anthers of the entire bulb are normally developed and have a considerable amount of yellow pollen, a few anthers are small and have no pollen), and very pollen (extremely very pollen, the entire bulb anthers are normally developed and have a very large amount of yellow pollen). The segregation ratio of fertile plants to sterile plants in each BC3F1 generation population was basically 1:1 (see Table 1), indicating that the ZT pollen plant may contain more than one major nuclear gene that controls pollen fertility traits.
[0058] Table 1
[0059] 2.3 Construct two extreme mixed pools to screen polymorphic marker primers closely linked to pollen fertility restoration. Take the extreme powder-free plants and extreme powdery plants from the BC3F1 generation material number 24ON312 population (see...). Figure 1 and Figure 2Ten samples from each of the two groups were used to extract DNA using a modified CTAB method. Ten samples from the extreme pollenless plants were pooled together as pool W, and ten samples from the extreme pollen-rich plants were pooled together as pool Y. Based on the leek genome (chr.Afis.genome), 516 pairs of SSR marker primers were designed using SSRhunter software. Polymorphic markers were screened between pools W and Y, initially revealing 8 pairs of polymorphic markers, all located on chromosome 2. The W pool amplified by these 8 pairs of polymorphic markers showed heterozygous banding, while pool Y showed fewer banding patterns than pool W (see [link to relevant documentation]). Figure 3 ).
[0060] 2.4 Verification of the close linkage between polymorphic marker primers and pollen fertility restoration trait A total of 146 DNA samples were collected and extracted from the BC3F1 generation material population (number 24ON312). Eight pairs of polymorphic markers were used for analysis of these 146 samples. The molecular banding patterns from gel amplification of each marker were interpreted and systematically numbered. The molecular data and pollen survey results were analyzed using QTL IciMapping 4.2 software. The LOD value of this QTL was 25.42, and the explainable phenotypic variation (PVE) was 56.35% (see [link to QTL analysis]). Figure 4 This indicates that there is a major-effect QTL controlling pollen fertility near the AF45 primer on chromosome 2.
[0061] Among the eight polymorphic marker primers, primer AF45 amplified the molecular banding patterns of 146 individual plants with the highest matching degree to pollen phenotypic traits. The matching degrees between the pollen-free, pollen-indistinct, pollen-containing, and pollen-rich traits and genotypes were 92.9%, 81.4%, 86.2%, and 97.8%, respectively. (See Table 2, see...) Figure 5 ).
[0062] Table 2
[0063] In addition, the amplification products were ligated into pClone007 Versatile Simple Vector via gel recovery, transformed into E. coli competent cells DH5α, and single colonies resistant to Amp were selected for shaking and sequencing. The heterozygous bands amplified by AF45 primers were 143 bp and 167 bp, with the shorter single band being 143 bp.
[0064] The AF45 primer sequence and the sequencing sequence of the amplified fragment are as follows: AF45F1:TCTGACTCTAAGTGAAGGGCAGT (SEQ ID NO.1); AF45R1:TCCCATTGACGAAGCTAACCTG (SEQ ID NO. 2).
[0065] The longer segment is 167 bp: TCCCATTGACGAAGCTAACCTGAATAAATAATATGACAGCGTTATTATTTAAAGGGAGTAAAAGTAGTTTGAAGTTTTCTATTGGAAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGTACCTGCTGGAACTGCCCTTCACTTAGAGTCAGA (SEQ ID NO. 4).
[0066] Shorter fragment 143 bp: TCCCATTGACGAAGCTAACCTGAATAAATAATATGACAGCGTTATTATTTAAAGGGAGTAAAAGTAGTTTGAAGTTTTCTATTGGAAGAGAGAGAGAGAGAGAAGTACCTGCTGGAACTGCCCTTCACTTAGAGTCAGA (SEQ ID NO. 3).
[0067] 2.5 Verification using primer AF45 on other strains of the BC3F1 generation, numbered 24ON314. A total of 123 DNA samples were collected and extracted from another BC3F1 generation material, population number 24ON314. Using AF45 primers, the pollen phenotypic traits of these 123 individual plants were amplified, and the genotype matching rates with pollen absence, slight pollen production, pollen presence, and abundant pollen were 92.3%, 90.9%, 84.8%, and 100.0%, respectively. (See Table 3, see...) Figure 6 Further verification showed that the AF45 primer was a tightly linked marker for genes related to fertility restoration in scallion pollen.
[0068] Table 3
[0069] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. An SSR marker primer linked to the fertility restorer trait in scallion pollen, characterized in that, The nucleotide sequences of the SSR-labeled primers are shown in SEQ ID NO.1 and SEQ ID NO.
2.
2. The application of the SSR marker primers of claim 1 in the detection of fertility restoration traits in scallion pollen.
3. A method for detecting the fertility restorer trait of scallion pollen, characterized in that, Includes the following steps: DNA was extracted from scallions, and then PCR amplification was performed using the SSR marker primers described in claim 1 to obtain amplification products. The fertility restoration trait of scallion pollen was determined based on the molecular weight of the amplification products.
4. The detection method according to claim 3, characterized in that, If the molecular weight of the amplified product is 143 bp, then the scallion contains starch. If the molecular weight of the amplified products is 143 bp and 167 bp, then the scallion is powder-free.
5. The detection method according to claim 4, characterized in that, The nucleotide sequence of the amplification product with a molecular weight of 143 bp is shown in SEQ ID NO.
3.
6. The detection method according to claim 4, characterized in that, The nucleotide sequence of the amplification product with a molecular weight of 167 bp is shown in SEQ ID NO.
4.
7. The detection method according to claim 3, characterized in that, DNA was extracted from scallions using the CTAB method, in which dithiothreitol was used as a reducing agent.
8. The detection method according to claim 3, characterized in that, Methods for determining the molecular weight of amplified products include agarose gel electrophoresis.
9. The detection method according to claim 3, characterized in that, The PCR reaction program included: 95℃ pre-denaturation for 4 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 30-40 cycles; 72℃ extension for 10 min.
10. The application of the detection method according to any one of claims 3-9 in scallion breeding.